1 package jalview.io.vcf;
3 import static jalview.io.gff.SequenceOntologyI.SEQUENCE_VARIANT;
4 import static org.testng.Assert.assertEquals;
5 import static org.testng.Assert.assertNull;
6 import static org.testng.Assert.assertSame;
7 import static org.testng.Assert.assertTrue;
9 import jalview.bin.Cache;
10 import jalview.datamodel.AlignmentI;
11 import jalview.datamodel.DBRefEntry;
12 import jalview.datamodel.Mapping;
13 import jalview.datamodel.Sequence;
14 import jalview.datamodel.SequenceFeature;
15 import jalview.datamodel.SequenceI;
16 import jalview.datamodel.features.FeatureAttributes;
17 import jalview.datamodel.features.SequenceFeatures;
18 import jalview.gui.AlignFrame;
19 import jalview.io.DataSourceType;
20 import jalview.io.FileLoader;
21 import jalview.io.gff.Gff3Helper;
22 import jalview.util.MapList;
25 import java.io.IOException;
26 import java.io.PrintWriter;
27 import java.util.List;
30 import org.testng.annotations.BeforeClass;
31 import org.testng.annotations.BeforeTest;
32 import org.testng.annotations.Test;
34 public class VCFLoaderTest
36 private static final float DELTA = 0.00001f;
38 // columns 9717- of gene P30419 from Ensembl (much modified)
39 private static final String FASTA = ""
42 * forward strand 'gene' and 'transcript' with two exons
44 ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
45 + "CAAGCTGGCGGACGAGAGTGTGACA\n"
46 + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
49 * reverse strand gene and transcript (reverse complement alleles!)
51 + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
52 + "TGTCACACTCTCGTCCGCCAGCTTG\n"
53 + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n"
56 * 'gene' on chromosome 5 with two transcripts
58 + ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n"
59 + "CAAGCTGGCGGACGAGAGTGTGACA\n"
60 + ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
61 + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
63 private static final String[] VCF = { "##fileformat=VCFv4.2",
64 // note fields with no INFO definition are ignored when parsing
65 "##INFO=<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency, for each ALT allele, in the same order as listed\">",
66 "##INFO=<ID=AC_Female,Number=A,Type=Integer,Description=\"Allele count in Female genotypes\"",
67 "##INFO=<ID=AF_AFR,Number=A,Type=Float,Description=\"Allele Frequency among African/African American genotypes\"",
68 "##INFO=<ID=CLNSIG,Number=.,Type=String,Description=\"Clinical significance for this single variant\"",
69 "##reference=Homo_sapiens/GRCh38",
70 "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO",
71 // A/T,C variants in position 2 of gene sequence (precedes transcript)
72 // should create 2 variant features with respective AF values
73 // malformed values for AC_Female and AF_AFR should be ignored
74 "17\t45051611\trs384765\tA\tT,C\t1666.64\tRF;XYZ\tAC=15;AF=5.0e-03,4.0e-03;AC_Female=12,3d;AF_AFR=low,2.3e-4;CLNSIG=benign,probably_benign",
75 // SNP G/C in position 4 of gene sequence, position 2 of transcript
76 // insertion G/GA is transferred to nucleotide but not to peptide
77 "17\t45051613\t.\tG\tGA,C\t1666.65\t.\tAC=15;AF=3.0e-03,2.0e-03",
78 // '.' in INFO field should be ignored
79 "17\t45051615\t.\tG\tC\t1666.66\tRF\tAC=16;AF=." };
81 @BeforeClass(alwaysRun = true)
85 * configure to capture all available VCF and VEP (CSQ) fields
87 Cache.loadProperties("test/jalview/io/testProps.jvprops");
88 Cache.setProperty("VCF_FIELDS", ".*");
89 Cache.setProperty("VEP_FIELDS", ".*");
90 Cache.setProperty("VCF_ASSEMBLY", "GRCh38=GRCh38");
94 @BeforeTest(alwaysRun = true)
95 public void setUpBeforeTest()
98 * clear down feature attributes metadata
100 FeatureAttributes.getInstance().clear();
103 @Test(groups = "Functional")
104 public void testDoLoad() throws IOException
106 AlignmentI al = buildAlignment();
108 File f = makeVcfFile();
109 VCFLoader loader = new VCFLoader(f.getPath());
111 loader.doLoad(al.getSequencesArray(), null);
114 * verify variant feature(s) added to gene
115 * NB alleles at a locus may not be processed, and features added,
116 * in the order in which they appear in the VCF record as method
117 * VariantContext.getAlternateAlleles() does not guarantee order
118 * - order of assertions here matches what we find (is not important)
120 List<SequenceFeature> geneFeatures = al.getSequenceAt(0)
121 .getSequenceFeatures();
122 SequenceFeatures.sortFeatures(geneFeatures, true);
123 assertEquals(geneFeatures.size(), 5);
124 SequenceFeature sf = geneFeatures.get(0);
125 assertEquals(sf.getFeatureGroup(), "VCF");
126 assertEquals(sf.getBegin(), 2);
127 assertEquals(sf.getEnd(), 2);
128 assertEquals(sf.getScore(), 0f);
129 assertEquals(sf.getValue("AF"), "4.0e-03");
130 assertEquals(sf.getValue("AF_AFR"), "2.3e-4");
131 assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C");
132 assertEquals(sf.getType(), SEQUENCE_VARIANT);
133 assertEquals(sf.getValue("POS"), "45051611");
134 assertEquals(sf.getValue("ID"), "rs384765");
135 assertEquals(sf.getValue("QUAL"), "1666.64");
136 assertEquals(sf.getValue("FILTER"), "RF;XYZ");
138 * if INFO declares Number=1, all values are attached to each allele
140 assertEquals(sf.getValue("CLNSIG"), "benign,probably_benign");
141 // malformed integer for AC_Female is ignored (JAL-3375)
142 assertNull(sf.getValue("AC_Female"));
144 sf = geneFeatures.get(1);
145 assertEquals(sf.getFeatureGroup(), "VCF");
146 assertEquals(sf.getBegin(), 2);
147 assertEquals(sf.getEnd(), 2);
148 assertEquals(sf.getType(), SEQUENCE_VARIANT);
149 assertEquals(sf.getScore(), 0f);
150 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
152 assertEquals(sf.getValue("AC_Female"), "12");
153 // malformed float for AF_AFR is ignored (JAL-3375)
154 assertNull(sf.getValue("AC_AFR"));
155 assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
156 assertEquals(sf.getValue("CLNSIG"), "benign,probably_benign");
158 sf = geneFeatures.get(2);
159 assertEquals(sf.getFeatureGroup(), "VCF");
160 assertEquals(sf.getBegin(), 4);
161 assertEquals(sf.getEnd(), 4);
162 assertEquals(sf.getType(), SEQUENCE_VARIANT);
163 assertEquals(sf.getScore(), 0f);
164 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
166 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
168 sf = geneFeatures.get(3);
169 assertEquals(sf.getFeatureGroup(), "VCF");
170 assertEquals(sf.getBegin(), 4);
171 assertEquals(sf.getEnd(), 4);
172 assertEquals(sf.getType(), SEQUENCE_VARIANT);
173 assertEquals(sf.getScore(), 0f);
174 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
176 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
177 assertNull(sf.getValue("ID")); // '.' is ignored
178 assertNull(sf.getValue("FILTER")); // '.' is ignored
180 sf = geneFeatures.get(4);
181 assertEquals(sf.getFeatureGroup(), "VCF");
182 assertEquals(sf.getBegin(), 6);
183 assertEquals(sf.getEnd(), 6);
184 assertEquals(sf.getType(), SEQUENCE_VARIANT);
185 assertEquals(sf.getScore(), 0f);
186 // AF=. should not have been captured
187 assertNull(sf.getValue("AF"));
188 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
191 * verify variant feature(s) added to transcript
193 List<SequenceFeature> transcriptFeatures = al.getSequenceAt(1)
194 .getSequenceFeatures();
195 assertEquals(transcriptFeatures.size(), 3);
196 sf = transcriptFeatures.get(0);
197 assertEquals(sf.getFeatureGroup(), "VCF");
198 assertEquals(sf.getBegin(), 2);
199 assertEquals(sf.getEnd(), 2);
200 assertEquals(sf.getType(), SEQUENCE_VARIANT);
201 assertEquals(sf.getScore(), 0f);
202 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
204 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
205 sf = transcriptFeatures.get(1);
206 assertEquals(sf.getFeatureGroup(), "VCF");
207 assertEquals(sf.getBegin(), 2);
208 assertEquals(sf.getEnd(), 2);
209 assertEquals(sf.getType(), SEQUENCE_VARIANT);
210 assertEquals(sf.getScore(), 0f);
211 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
213 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
216 * verify SNP variant feature(s) computed and added to protein
217 * first codon AGC varies to ACC giving S/T
219 DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs();
220 SequenceI peptide = null;
221 for (DBRefEntry dbref : dbRefs)
223 if (dbref.getMap().getMap().getFromRatio() == 3)
225 peptide = dbref.getMap().getTo();
228 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
231 * JAL-3187 don't precompute protein features, do dynamically instead
233 assertTrue(proteinFeatures.isEmpty());
236 private File makeVcfFile() throws IOException
238 File f = File.createTempFile("Test", ".vcf");
240 PrintWriter pw = new PrintWriter(f);
241 for (String vcfLine : VCF)
250 * Make a simple alignment with one 'gene' and one 'transcript'
254 private AlignmentI buildAlignment()
256 AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(FASTA,
257 DataSourceType.PASTE);
260 * map gene1 sequence to chromosome (normally done when the sequence is fetched
261 * from Ensembl and transcripts computed)
263 AlignmentI alignment = af.getViewport().getAlignment();
264 SequenceI gene1 = alignment.findName("gene1");
265 int[] to = new int[] { 45051610, 45051634 };
266 int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
267 gene1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
271 * map 'transcript1' to chromosome via 'gene1'
272 * transcript1/1-18 is gene1/3-10,15-24
273 * which is chromosome 45051612-45051619,45051624-45051633
275 to = new int[] { 45051612, 45051619, 45051624, 45051633 };
276 SequenceI transcript1 = alignment.findName("transcript1");
277 from = new int[] { transcript1.getStart(), transcript1.getEnd() };
278 transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
283 * map gene2 to chromosome reverse strand
285 SequenceI gene2 = alignment.findName("gene2");
286 to = new int[] { 45051634, 45051610 };
287 from = new int[] { gene2.getStart(), gene2.getEnd() };
288 gene2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
292 * map 'transcript2' to chromosome via 'gene2'
293 * transcript2/1-18 is gene2/2-11,16-23
294 * which is chromosome 45051633-45051624,45051619-45051612
296 to = new int[] { 45051633, 45051624, 45051619, 45051612 };
297 SequenceI transcript2 = alignment.findName("transcript2");
298 from = new int[] { transcript2.getStart(), transcript2.getEnd() };
299 transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
304 * add a protein product as a DBRef on transcript1
306 SequenceI peptide1 = new Sequence("ENSP001", "SWRECD");
307 MapList mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 },
309 Mapping map = new Mapping(peptide1, mapList);
310 DBRefEntry product = new DBRefEntry("", "", "ENSP001", map);
311 transcript1.addDBRef(product);
314 * add a protein product as a DBRef on transcript2
316 SequenceI peptide2 = new Sequence("ENSP002", "VTLSPA");
317 mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
318 map = new Mapping(peptide2, mapList);
319 product = new DBRefEntry("", "", "ENSP002", map);
320 transcript2.addDBRef(product);
323 * map gene3 to chromosome
325 SequenceI gene3 = alignment.findName("gene3");
326 to = new int[] { 45051610, 45051634 };
327 from = new int[] { gene3.getStart(), gene3.getEnd() };
328 gene3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(from, to,
332 * map 'transcript3' to chromosome
334 SequenceI transcript3 = alignment.findName("transcript3");
335 to = new int[] { 45051612, 45051619, 45051624, 45051633 };
336 from = new int[] { transcript3.getStart(), transcript3.getEnd() };
337 transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
342 * map 'transcript4' to chromosome
344 SequenceI transcript4 = alignment.findName("transcript4");
345 to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
347 from = new int[] { transcript4.getStart(), transcript4.getEnd() };
348 transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
353 * add a protein product as a DBRef on transcript3
355 SequenceI peptide3 = new Sequence("ENSP003", "SWRECD");
356 mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
357 map = new Mapping(peptide3, mapList);
358 product = new DBRefEntry("", "", "ENSP003", map);
359 transcript3.addDBRef(product);
365 * Test with 'gene' and 'transcript' mapped to the reverse strand of the
366 * chromosome. The VCF variant positions (in forward coordinates) should get
367 * correctly located on sequence positions.
369 * @throws IOException
371 @Test(groups = "Functional")
372 public void testDoLoad_reverseStrand() throws IOException
374 AlignmentI al = buildAlignment();
376 File f = makeVcfFile();
378 VCFLoader loader = new VCFLoader(f.getPath());
380 loader.doLoad(al.getSequencesArray(), null);
383 * verify variant feature(s) added to gene2
384 * gene2/1-25 maps to chromosome 45051634- reverse strand
386 List<SequenceFeature> geneFeatures = al.getSequenceAt(2)
387 .getSequenceFeatures();
388 SequenceFeatures.sortFeatures(geneFeatures, true);
389 assertEquals(geneFeatures.size(), 5);
393 * insertion G/GA at 45051613 maps to an insertion at
394 * the preceding position (21) on reverse strand gene
395 * reference: CAAGC -> GCTTG/21-25
396 * genomic variant: CAAGAC (G/GA)
397 * gene variant: GTCTTG (G/GT at 21)
399 sf = geneFeatures.get(1);
400 assertEquals(sf.getFeatureGroup(), "VCF");
401 assertEquals(sf.getBegin(), 21);
402 assertEquals(sf.getEnd(), 21);
403 assertEquals(sf.getType(), SEQUENCE_VARIANT);
404 assertEquals(sf.getScore(), 0f);
405 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
406 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
410 * variant G/C at 45051613 maps to C/G at gene position 22
412 sf = geneFeatures.get(2);
413 assertEquals(sf.getFeatureGroup(), "VCF");
414 assertEquals(sf.getBegin(), 22);
415 assertEquals(sf.getEnd(), 22);
416 assertEquals(sf.getType(), SEQUENCE_VARIANT);
417 assertEquals(sf.getScore(), 0f);
418 assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
419 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
423 * variant A/C at 45051611 maps to T/G at gene position 24
425 sf = geneFeatures.get(3);
426 assertEquals(sf.getFeatureGroup(), "VCF");
427 assertEquals(sf.getBegin(), 24);
428 assertEquals(sf.getEnd(), 24);
429 assertEquals(sf.getType(), SEQUENCE_VARIANT);
430 assertEquals(sf.getScore(), 0f);
431 assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G");
432 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 4.0e-03,
436 * variant A/T at 45051611 maps to T/A at gene position 24
438 sf = geneFeatures.get(4);
439 assertEquals(sf.getFeatureGroup(), "VCF");
440 assertEquals(sf.getBegin(), 24);
441 assertEquals(sf.getEnd(), 24);
442 assertEquals(sf.getType(), SEQUENCE_VARIANT);
443 assertEquals(sf.getScore(), 0f);
444 assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A");
445 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
449 * verify 3 variant features added to transcript2
451 List<SequenceFeature> transcriptFeatures = al.getSequenceAt(3)
452 .getSequenceFeatures();
453 assertEquals(transcriptFeatures.size(), 3);
456 * insertion G/GT at position 21 of gene maps to position 16 of transcript
458 sf = transcriptFeatures.get(1);
459 assertEquals(sf.getFeatureGroup(), "VCF");
460 assertEquals(sf.getBegin(), 16);
461 assertEquals(sf.getEnd(), 16);
462 assertEquals(sf.getType(), SEQUENCE_VARIANT);
463 assertEquals(sf.getScore(), 0f);
464 assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
465 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
469 * SNP C/G at position 22 of gene maps to position 17 of transcript
471 sf = transcriptFeatures.get(2);
472 assertEquals(sf.getFeatureGroup(), "VCF");
473 assertEquals(sf.getBegin(), 17);
474 assertEquals(sf.getEnd(), 17);
475 assertEquals(sf.getType(), SEQUENCE_VARIANT);
476 assertEquals(sf.getScore(), 0f);
477 assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
478 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
482 * verify variant feature(s) computed and added to protein
483 * last codon GCT varies to GGT giving A/G in the last peptide position
485 DBRefEntry[] dbRefs = al.getSequenceAt(3).getDBRefs();
486 SequenceI peptide = null;
487 for (DBRefEntry dbref : dbRefs)
489 if (dbref.getMap().getMap().getFromRatio() == 3)
491 peptide = dbref.getMap().getTo();
494 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
497 * JAL-3187 don't precompute protein features, do dynamically instead
499 assertTrue(proteinFeatures.isEmpty());
503 * Tests that if VEP consequence (CSQ) data is present in the VCF data, then
504 * it is added to the variant feature, but restricted where possible to the
505 * consequences for a specific transcript
507 * @throws IOException
509 @Test(groups = "Functional")
510 public void testDoLoad_vepCsq() throws IOException
512 AlignmentI al = buildAlignment();
514 VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf.vcf");
517 * VCF data file with variants at gene3 positions
522 * 17 A/AC (insertion), A/G
524 loader.doLoad(al.getSequencesArray(), null);
527 * verify variant feature(s) added to gene3
529 List<SequenceFeature> geneFeatures = al.findName("gene3")
530 .getSequenceFeatures();
531 SequenceFeatures.sortFeatures(geneFeatures, true);
532 assertEquals(geneFeatures.size(), 7);
533 SequenceFeature sf = geneFeatures.get(0);
534 assertEquals(sf.getBegin(), 1);
535 assertEquals(sf.getEnd(), 1);
536 assertEquals(sf.getScore(), 0f);
537 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.1f, DELTA);
538 assertEquals(sf.getValue("alleles"), "C,A");
539 // gene features include Consequence for all transcripts
540 Map map = (Map) sf.getValue("CSQ");
541 assertEquals(map.size(), 9);
542 assertEquals(map.get("PolyPhen"), "Bad");
544 sf = geneFeatures.get(1);
545 assertEquals(sf.getBegin(), 5);
546 assertEquals(sf.getEnd(), 5);
547 assertEquals(sf.getScore(), 0f);
548 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA);
549 assertEquals(sf.getValue("alleles"), "C,T");
550 map = (Map) sf.getValue("CSQ");
551 assertEquals(map.size(), 9);
552 assertEquals(map.get("PolyPhen"), "Bad++"); // %3B%3B decoded
554 sf = geneFeatures.get(2);
555 assertEquals(sf.getBegin(), 9);
556 assertEquals(sf.getEnd(), 11); // deletion over 3 positions
557 assertEquals(sf.getScore(), 0f);
558 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.3f, DELTA);
559 assertEquals(sf.getValue("alleles"), "CGG,C");
560 map = (Map) sf.getValue("CSQ");
561 assertEquals(map.size(), 9);
563 sf = geneFeatures.get(3);
564 assertEquals(sf.getBegin(), 13);
565 assertEquals(sf.getEnd(), 13);
566 assertEquals(sf.getScore(), 0f);
567 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA);
568 assertEquals(sf.getValue("alleles"), "C,T");
569 map = (Map) sf.getValue("CSQ");
570 assertEquals(map.size(), 9);
572 sf = geneFeatures.get(4);
573 assertEquals(sf.getBegin(), 13);
574 assertEquals(sf.getEnd(), 13);
575 assertEquals(sf.getScore(), 0f);
576 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA);
577 assertEquals(sf.getValue("alleles"), "C,G");
578 map = (Map) sf.getValue("CSQ");
579 assertEquals(map.size(), 9);
581 sf = geneFeatures.get(5);
582 assertEquals(sf.getBegin(), 17);
583 assertEquals(sf.getEnd(), 17);
584 assertEquals(sf.getScore(), 0f);
585 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
586 assertEquals(sf.getValue("alleles"), "A,G");
587 map = (Map) sf.getValue("CSQ");
588 assertEquals(map.size(), 9);
590 sf = geneFeatures.get(6);
591 assertEquals(sf.getBegin(), 17);
592 assertEquals(sf.getEnd(), 17); // insertion
593 assertEquals(sf.getScore(), 0f);
594 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
595 assertEquals(sf.getValue("alleles"), "A,AC");
596 map = (Map) sf.getValue("CSQ");
597 assertEquals(map.size(), 9);
600 * verify variant feature(s) added to transcript3
601 * at columns 5 (1), 17 (2), positions 3, 11
602 * note the deletion at columns 9-11 is not transferred since col 11
603 * has no mapping to transcript 3
605 List<SequenceFeature> transcriptFeatures = al.findName("transcript3")
606 .getSequenceFeatures();
607 SequenceFeatures.sortFeatures(transcriptFeatures, true);
608 assertEquals(transcriptFeatures.size(), 3);
609 sf = transcriptFeatures.get(0);
610 assertEquals(sf.getBegin(), 3);
611 assertEquals(sf.getEnd(), 3);
612 assertEquals(sf.getScore(), 0f);
613 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA);
614 assertEquals(sf.getValue("alleles"), "C,T");
615 // transcript features only have Consequence for that transcripts
616 map = (Map) sf.getValue("CSQ");
617 assertEquals(map.size(), 9);
618 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
620 sf = transcriptFeatures.get(1);
621 assertEquals(sf.getBegin(), 11);
622 assertEquals(sf.getEnd(), 11);
623 assertEquals(sf.getScore(), 0f);
624 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
625 assertEquals(sf.getValue("alleles"), "A,G");
626 assertEquals(map.size(), 9);
627 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
629 sf = transcriptFeatures.get(2);
630 assertEquals(sf.getBegin(), 11);
631 assertEquals(sf.getEnd(), 11);
632 assertEquals(sf.getScore(), 0f);
633 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
634 assertEquals(sf.getValue("alleles"), "A,AC");
635 assertEquals(map.size(), 9);
636 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
639 * verify variants computed on protein product for transcript3
641 * codon variants are AGC/AGT position 1 which is synonymous
642 * and GAG/GGG which is E/G in position 4
643 * the insertion variant is not transferred to the peptide
645 DBRefEntry[] dbRefs = al.findName("transcript3").getDBRefs();
646 SequenceI peptide = null;
647 for (DBRefEntry dbref : dbRefs)
649 if (dbref.getMap().getMap().getFromRatio() == 3)
651 peptide = dbref.getMap().getTo();
654 List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
656 * JAL-3187 don't precompute protein features, do dynamically instead
658 assertTrue(proteinFeatures.isEmpty());
659 // SequenceFeatures.sortFeatures(proteinFeatures, true);
660 // assertEquals(proteinFeatures.size(), 2);
661 // sf = proteinFeatures.get(0);
662 // assertEquals(sf.getFeatureGroup(), "VCF");
663 // assertEquals(sf.getBegin(), 1);
664 // assertEquals(sf.getEnd(), 1);
665 // assertEquals(sf.getType(), SequenceOntologyI.SYNONYMOUS_VARIANT);
666 // assertEquals(sf.getDescription(), "agC/agT");
667 // sf = proteinFeatures.get(1);
668 // assertEquals(sf.getFeatureGroup(), "VCF");
669 // assertEquals(sf.getBegin(), 4);
670 // assertEquals(sf.getEnd(), 4);
671 // assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
672 // assertEquals(sf.getDescription(), "p.Glu4Gly");
675 * verify variant feature(s) added to transcript4
676 * at columns 13 (2) and 17 (2), positions 7 and 11
678 transcriptFeatures = al.findName("transcript4").getSequenceFeatures();
679 SequenceFeatures.sortFeatures(transcriptFeatures, true);
680 assertEquals(transcriptFeatures.size(), 4);
681 sf = transcriptFeatures.get(0);
682 assertEquals(sf.getBegin(), 7);
683 assertEquals(sf.getEnd(), 7);
684 assertEquals(sf.getScore(), 0f);
685 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA);
686 assertEquals(sf.getValue("alleles"), "C,T");
687 assertEquals(map.size(), 9);
688 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
690 sf = transcriptFeatures.get(1);
691 assertEquals(sf.getBegin(), 7);
692 assertEquals(sf.getEnd(), 7);
693 assertEquals(sf.getScore(), 0f);
694 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA);
695 assertEquals(sf.getValue("alleles"), "C,G");
696 assertEquals(map.size(), 9);
697 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
699 sf = transcriptFeatures.get(2);
700 assertEquals(sf.getBegin(), 11);
701 assertEquals(sf.getEnd(), 11);
702 assertEquals(sf.getScore(), 0f);
703 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
704 assertEquals(sf.getValue("alleles"), "A,G");
705 assertEquals(map.size(), 9);
706 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
708 sf = transcriptFeatures.get(3);
709 assertEquals(sf.getBegin(), 11);
710 assertEquals(sf.getEnd(), 11);
711 assertEquals(sf.getScore(), 0f);
712 assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
713 assertEquals(sf.getValue("alleles"), "A,AC");
714 assertEquals(map.size(), 9);
715 assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
719 * A test that demonstrates loading a contig sequence from an indexed sequence
720 * database which is the reference for a VCF file
722 * @throws IOException
724 @Test(groups = "Functional")
725 public void testLoadVCFContig() throws IOException
727 VCFLoader loader = new VCFLoader(
728 "test/jalview/io/vcf/testVcf2.vcf");
730 SequenceI seq = loader.loadVCFContig("contig123");
731 assertEquals(seq.getLength(), 15);
732 assertEquals(seq.getSequenceAsString(), "AAAAACCCCCGGGGG");
733 List<SequenceFeature> features = seq.getSequenceFeatures();
734 SequenceFeatures.sortFeatures(features, true);
735 assertEquals(features.size(), 2);
736 SequenceFeature sf = features.get(0);
737 assertEquals(sf.getBegin(), 8);
738 assertEquals(sf.getEnd(), 8);
739 assertEquals(sf.getDescription(), "C,A");
740 sf = features.get(1);
741 assertEquals(sf.getBegin(), 12);
742 assertEquals(sf.getEnd(), 12);
743 assertEquals(sf.getDescription(), "G,T");
745 seq = loader.loadVCFContig("contig789");
746 assertEquals(seq.getLength(), 25);
747 assertEquals(seq.getSequenceAsString(), "GGGGGTTTTTAAAAACCCCCGGGGG");
748 features = seq.getSequenceFeatures();
749 SequenceFeatures.sortFeatures(features, true);
750 assertEquals(features.size(), 2);
751 sf = features.get(0);
752 assertEquals(sf.getBegin(), 2);
753 assertEquals(sf.getEnd(), 2);
754 assertEquals(sf.getDescription(), "G,T");
755 sf = features.get(1);
756 assertEquals(sf.getBegin(), 21);
757 assertEquals(sf.getEnd(), 21);
758 assertEquals(sf.getDescription(), "G,A");
760 seq = loader.loadVCFContig("contig456");
761 assertEquals(seq.getLength(), 20);
762 assertEquals(seq.getSequenceAsString(), "CCCCCGGGGGTTTTTAAAAA");
763 features = seq.getSequenceFeatures();
764 SequenceFeatures.sortFeatures(features, true);
765 assertEquals(features.size(), 1);
766 sf = features.get(0);
767 assertEquals(sf.getBegin(), 15);
768 assertEquals(sf.getEnd(), 15);
769 assertEquals(sf.getDescription(), "T,C");
772 @Test(groups = "Functional")
773 public void testDecodeSpecialCharacters() throws IOException
775 String encoded = "hello world";
776 String decoded = VCFLoader.decodeSpecialCharacters(encoded);
777 assertSame(encoded, decoded); // no change needed
779 encoded = "ab%3Acd%3Bef%3Dgh%25ij%2Ckl%3A";
780 decoded = VCFLoader.decodeSpecialCharacters(encoded);
781 assertEquals(decoded, "ab:cd;ef=gh%ij,kl:");