ranges = new ArrayList<>();
/*
* case 1: truncate last range
*/
ranges.add(new int[] { 1, 10 });
ranges.add(new int[] { 20, 30 });
MappingUtils.removeEndPositions(5, ranges);
assertEquals(2, ranges.size());
assertEquals(25, ranges.get(1)[1]);
/*
* case 2: remove last range
*/
ranges.clear();
ranges.add(new int[] { 1, 10 });
ranges.add(new int[] { 20, 22 });
MappingUtils.removeEndPositions(3, ranges);
assertEquals(1, ranges.size());
assertEquals(10, ranges.get(0)[1]);
/*
* case 3: truncate penultimate range
*/
ranges.clear();
ranges.add(new int[] { 1, 10 });
ranges.add(new int[] { 20, 21 });
MappingUtils.removeEndPositions(3, ranges);
assertEquals(1, ranges.size());
assertEquals(9, ranges.get(0)[1]);
/*
* case 4: remove last two ranges
*/
ranges.clear();
ranges.add(new int[] { 1, 10 });
ranges.add(new int[] { 20, 20 });
ranges.add(new int[] { 30, 30 });
MappingUtils.removeEndPositions(3, ranges);
assertEquals(1, ranges.size());
assertEquals(9, ranges.get(0)[1]);
}
/**
* Test mapping a sequence group where sequences in and outside the group
* share a dataset sequence (e.g. alternative CDS for the same gene)
*
* This scenario doesn't arise after JAL-3763 changes, but test left as still valid
* @throws IOException
*/
@Test(groups = { "Functional" })
public void testMapSequenceGroup_sharedDataset() throws IOException
{
/*
* Set up dna and protein Seq1/2/3 with mappings (held on the protein
* viewport). CDS sequences share the same 'gene' dataset sequence.
*/
SequenceI dna = new Sequence("dna", "aaatttgggcccaaatttgggccc");
SequenceI cds1 = new Sequence("cds1/1-6", "aaattt");
SequenceI cds2 = new Sequence("cds1/4-9", "tttggg");
SequenceI cds3 = new Sequence("cds1/19-24", "gggccc");
cds1.setDatasetSequence(dna);
cds2.setDatasetSequence(dna);
cds3.setDatasetSequence(dna);
SequenceI pep1 = new Sequence("pep1", "KF");
SequenceI pep2 = new Sequence("pep2", "FG");
SequenceI pep3 = new Sequence("pep3", "GP");
pep1.createDatasetSequence();
pep2.createDatasetSequence();
pep3.createDatasetSequence();
/*
* add mappings from coding positions of dna to respective peptides
*/
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(dna, pep1,
new MapList(new int[]
{ 1, 6 }, new int[] { 1, 2 }, 3, 1));
acf.addMap(dna, pep2,
new MapList(new int[]
{ 4, 9 }, new int[] { 1, 2 }, 3, 1));
acf.addMap(dna, pep3,
new MapList(new int[]
{ 19, 24 }, new int[] { 1, 2 }, 3, 1));
List acfList = Arrays
.asList(new AlignedCodonFrame[]
{ acf });
AlignmentI cdna = new Alignment(new SequenceI[] { cds1, cds2, cds3 });
AlignmentI protein = new Alignment(
new SequenceI[]
{ pep1, pep2, pep3 });
AlignViewportI cdnaView = new AlignViewport(cdna);
AlignViewportI peptideView = new AlignViewport(protein);
protein.setCodonFrames(acfList);
/*
* Select pep1 and pep3 in the protein alignment
*/
SequenceGroup sg = new SequenceGroup();
sg.setColourText(true);
sg.setIdColour(Color.GREEN);
sg.setOutlineColour(Color.LIGHT_GRAY);
sg.addSequence(pep1, false);
sg.addSequence(pep3, false);
sg.setEndRes(protein.getWidth() - 1);
/*
* Verify the mapped sequence group in dna is cds1 and cds3
*/
SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg,
peptideView, cdnaView);
assertTrue(mappedGroup.getColourText());
assertSame(sg.getIdColour(), mappedGroup.getIdColour());
assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
assertEquals(2, mappedGroup.getSequences().size());
assertSame(cds1, mappedGroup.getSequences().get(0));
assertSame(cds3, mappedGroup.getSequences().get(1));
// columns 1-6 selected (0-5 base zero)
assertEquals(0, mappedGroup.getStartRes());
assertEquals(5, mappedGroup.getEndRes());
/*
* Select mapping sequence group from dna to protein
*/
sg.clear();
sg.addSequence(cds2, false);
sg.addSequence(cds1, false);
sg.setStartRes(0);
sg.setEndRes(cdna.getWidth() - 1);
mappedGroup = MappingUtils.mapSequenceGroup(sg, cdnaView, peptideView);
assertTrue(mappedGroup.getColourText());
assertSame(sg.getIdColour(), mappedGroup.getIdColour());
assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
assertEquals(2, mappedGroup.getSequences().size());
assertSame(protein.getSequenceAt(1), mappedGroup.getSequences().get(0));
assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(1));
assertEquals(0, mappedGroup.getStartRes());
assertEquals(1, mappedGroup.getEndRes()); // two columns
}
}