# Copyright 2004-2008 by Sebastian Bassi. # All rights reserved. # This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package. """Calculate the thermodynamic melting temperatures of nucleotide sequences.""" import math def Tm_staluc(s,dnac=50,saltc=50,rna=0): """Returns DNA/DNA tm using nearest neighbor thermodynamics. dnac is DNA concentration [nM] saltc is salt concentration [mM]. rna=0 is for DNA/DNA (default), for RNA, rna should be 1. Sebastian Bassi """ #Credits: #Main author: Sebastian Bassi #Overcount function: Greg Singer #Based on the work of Nicolas Le Novere Bioinformatics. #17:1226-1227(2001) #This function returns better results than EMBOSS DAN because it uses #updated thermodynamics values and takes into account inicialization #parameters from the work of SantaLucia (1998). #Things to do: #+Detect complementary sequences. Change K according to result. #+Add support for heteroduplex (see Sugimoto et al. 1995). #+Correction for Mg2+. Now supports only monovalent ions. #+Put thermodinamics table in a external file for users to change at will #+Add support for danglings ends (see Le Novele. 2001) and mismatches. dh = 0 #DeltaH. Enthalpy ds = 0 #deltaS Entropy def tercorr(stri): deltah = 0 deltas = 0 if rna==0: #DNA/DNA #Allawi and SantaLucia (1997). Biochemistry 36 : 10581-10594 if stri.startswith('G') or stri.startswith('C'): deltah -= 0.1 deltas += 2.8 elif stri.startswith('A') or stri.startswith('T'): deltah -= 2.3 deltas -= 4.1 if stri.endswith('G') or stri.endswith('C'): deltah -= 0.1 deltas += 2.8 elif stri.endswith('A') or stri.endswith('T'): deltah -= 2.3 deltas -= 4.1 dhL = dh + deltah dsL = ds + deltas return dsL,dhL elif rna==1: #RNA if stri.startswith('G') or stri.startswith('C'): deltah -= 3.61 deltas -= 1.5 elif stri.startswith('A') or stri.startswith('T') or \ stri.startswith('U'): deltah -= 3.72 deltas += 10.5 if stri.endswith('G') or stri.endswith('C'): deltah -= 3.61 deltas -= 1.5 elif stri.endswith('A') or stri.endswith('T') or \ stri.endswith('U'): deltah -= 3.72 deltas += 10.5 dhL = dh + deltah dsL = ds + deltas # print "delta h=",dhL return dsL,dhL def overcount(st,p): """Returns how many p are on st, works even for overlapping""" ocu = 0 x = 0 while 1: try: i = st.index(p,x) except ValueError: break ocu += 1 x = i + 1 return ocu R = 1.987 # universal gas constant in Cal/degrees C*Mol sup = s.upper() vsTC,vh = tercorr(sup) vs = vsTC k = (dnac/4.0)*1e-9 #With complementary check on, the 4.0 should be changed to a variable. if rna==0: #DNA/DNA #Allawi and SantaLucia (1997). Biochemistry 36 : 10581-10594 vh = vh + (overcount(sup,"AA"))*7.9 + (overcount(sup,"TT"))*\ 7.9 + (overcount(sup,"AT"))*7.2 + (overcount(sup,"TA"))*7.2 \ + (overcount(sup,"CA"))*8.5 + (overcount(sup,"TG"))*8.5 + \ (overcount(sup,"GT"))*8.4 + (overcount(sup,"AC"))*8.4 vh = vh + (overcount(sup,"CT"))*7.8+(overcount(sup,"AG"))*\ 7.8 + (overcount(sup,"GA"))*8.2 + (overcount(sup,"TC"))*8.2 vh = vh + (overcount(sup,"CG"))*10.6+(overcount(sup,"GC"))*\ 9.8 + (overcount(sup,"GG"))*8 + (overcount(sup,"CC"))*8 vs = vs + (overcount(sup,"AA"))*22.2+(overcount(sup,"TT"))*\ 22.2 + (overcount(sup,"AT"))*20.4 + (overcount(sup,"TA"))*21.3 vs = vs + (overcount(sup,"CA"))*22.7+(overcount(sup,"TG"))*\ 22.7 + (overcount(sup,"GT"))*22.4 + (overcount(sup,"AC"))*22.4 vs = vs + (overcount(sup,"CT"))*21.0+(overcount(sup,"AG"))*\ 21.0 + (overcount(sup,"GA"))*22.2 + (overcount(sup,"TC"))*22.2 vs = vs + (overcount(sup,"CG"))*27.2+(overcount(sup,"GC"))*\ 24.4 + (overcount(sup,"GG"))*19.9 + (overcount(sup,"CC"))*19.9 ds = vs dh = vh else: #RNA/RNA hybridisation of Xia et al (1998) #Biochemistry 37: 14719-14735 vh = vh+(overcount(sup,"AA"))*6.82+(overcount(sup,"TT"))*6.6+\ (overcount(sup,"AT"))*9.38 + (overcount(sup,"TA"))*7.69+\ (overcount(sup,"CA"))*10.44 + (overcount(sup,"TG"))*10.5+\ (overcount(sup,"GT"))*11.4 + (overcount(sup,"AC"))*10.2 vh = vh + (overcount(sup,"CT"))*10.48 + (overcount(sup,"AG"))\ *7.6+(overcount(sup,"GA"))*12.44+(overcount(sup,"TC"))*13.3 vh = vh + (overcount(sup,"CG"))*10.64 + (overcount(sup,"GC"))\ *14.88+(overcount(sup,"GG"))*13.39+(overcount(sup,"CC"))*12.2 vs = vs + (overcount(sup,"AA"))*19.0 + (overcount(sup,"TT"))*\ 18.4+(overcount(sup,"AT"))*26.7+(overcount(sup,"TA"))*20.5 vs = vs + (overcount(sup,"CA"))*26.9 + (overcount(sup,"TG"))*\ 27.8 + (overcount(sup,"GT"))*29.5 + (overcount(sup,"AC"))*26.2 vs = vs + (overcount(sup,"CT"))*27.1 + (overcount(sup,"AG"))*\ 19.2 + (overcount(sup,"GA"))*32.5 + (overcount(sup,"TC"))*35.5 vs = vs + (overcount(sup,"CG"))*26.7 + (overcount(sup,"GC"))\ *36.9 + (overcount(sup,"GG"))*32.7 + (overcount(sup,"CC"))*29.7 ds = vs dh = vh ds = ds-0.368*(len(s)-1)*math.log(saltc/1e3) tm = ((1000* (-dh))/(-ds+(R * (math.log(k)))))-273.15 # print "ds="+str(ds) # print "dh="+str(dh) return tm if __name__ == "__main__" : print "Quick self test" assert Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA') == 59.865612727457972 assert Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA',rna=1) == 68.141611264576682 print "Done"