X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=help%2Fhtml%2Fmenus%2Falwcalculate.html;fp=help%2Fhtml%2Fmenus%2Falwcalculate.html;h=0000000000000000000000000000000000000000;hb=4f77328104498504339216829abf5ea87e2791ec;hp=c7a1c87c9c005b8a5c8b5f14265ac4f8be54d305;hpb=2b8c0785318a3528e1876e8e2dd48b7d831eae69;p=jalview.git
diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html
deleted file mode 100755
index c7a1c87..0000000
--- a/help/html/menus/alwcalculate.html
+++ /dev/null
@@ -1,120 +0,0 @@
-
-
-
-Alignment Window Menus
-
-
-
-
- Alignment Window Calculate Menu
-
-
- - Sort
-
- - By ID
This will sort
- the sequences according to sequence name. If the sort is
- repeated, the order of the sorted sequences will be
- inverted.
- - By Length
This will
- sort the sequences according to their length (excluding gap
- characters). If the sort is repeated, the order of the
- sorted sequences will be inverted.
- - By Group
This
- will sort the sequences according to sequence name. If the
- sort is repeated, the order of the sorted sequences will be
- inverted.
- - By Pairwise Identity
- This will sort the selected sequences by their
- percentage identity to the consensus sequence. The most
- similar sequence is put at the top.
- - The Sort
- menu will have some additional options if the alignment
- has any associated score annotation, or you have just done a
- multiple alignment calculation or opened a tree viewer
- window.
-
-
- - Calculate Tree or PCA ...
Opens the
- calculations dialog for
- for calculating trees or
- principle component analysis
- plots on the alignment or the currently selected
- region.
-
-
- - Pairwise Alignments
Applies
- Smith and Waterman algorithm to selected sequences. See pairwise
- alignments.
-
- - Extract Scores ... (optional)
This
- option is only visible if Jalview detects one or more
- white-space separated values in the description line of the
- alignment sequences.
When selected, these numbers are
- parsed into sequence associated annotation which can then be
- used to sort the alignment via the Sort by→Score menu.
-
- - Translate as cDNA (not applet)
This
- option is visible for nucleotide alignments. Selecting this
- option shows the DNA's calculated protein product in a new split frame window. Note
- that the translation is not frame- or intron-aware; it simply
- translates all codons in each sequence, using the standard genetic code (any incomplete
- final codon is discarded). You can perform this action on the
- whole alignment, or selected rows, columns, or regions.
-
- - Reverse, Reverse Complement (not applet)
- These options are visible for nucleotide alignments.
- Selecting them adds the reverse (or reverse complement) of the
- sequences (or selected region) as new sequences in the
- alignment. To try this out, add this sequence and perform
- 'Reverse Complement' followed by 'Translate as cDNA':
- Seq
- GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
- TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG
-
- - Get Cross-References (not applet)
- This option is visible where sequences have
- cross-references to other standard databases; for example, an
- EMBL entry may have cross-references to one or more UNIPROT
- entries. Select the database to view all cross-referenced
- sequences in a new split
- frame window.
-
- - Autocalculate Consensus
For
- large alignments it can be useful to deselect
- "Autocalculate Consensus" when editing. This prevents
- the sometimes lengthy calculations performed after each sequence
- edit.
- - Sort Alignment With New Tree
If
- this option is selected, the alignment will be automatically
- sorted whenever a new tree is calculated or loaded.
- - Show Flanking Regions
Opens
- a new alignment window showing any additional sequence data
- either side of the current alignment. Useful in conjunction with
- 'Fetch Database References' when the 'Trim Retrieved Sequences'
- option is disabled to retrieve full length sequences for a set
- of aligned peptides.
-
-
-