X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=sources%2Freadseq%2Fureadseq.c;fp=sources%2Freadseq%2Fureadseq.c;h=f77bc5356b4d26d2ad78392ff4250c7fe6628035;hb=a5e6297d655a784603d499da5a025d5d5fa78783;hp=0000000000000000000000000000000000000000;hpb=df24dcd3c415c000592af419f2c9304a4e05c2ee;p=jpred.git diff --git a/sources/readseq/ureadseq.c b/sources/readseq/ureadseq.c new file mode 100644 index 0000000..f77bc53 --- /dev/null +++ b/sources/readseq/ureadseq.c @@ -0,0 +1,1878 @@ +/* File: ureadseq.c + * + * Reads and writes nucleic/protein sequence in various + * formats. Data files may have multiple sequences. + * + * Copyright 1990 by d.g.gilbert + * biology dept., indiana university, bloomington, in 47405 + * e-mail: gilbertd@bio.indiana.edu + * + * This program may be freely copied and used by anyone. + * Developers are encourged to incorporate parts in their + * programs, rather than devise their own private sequence + * format. + * + * This should compile and run with any ANSI C compiler. + * + * Alexander Sherstnev, 18/11/2013 + * renamed getline to locgetline + * + */ + + +#include +#include +#include + +#define UREADSEQ_G +#include "ureadseq.h" + +#pragma segment ureadseq + + +int Strcasecmp(const char *a, const char *b) /* from Nlm_StrICmp */ +{ + int diff, done; + if (a == b) return 0; + done = 0; + while (! done) { + diff = to_upper(*a) - to_upper(*b); + if (diff) return diff; + if (*a == '\0') done = 1; + else { a++; b++; } + } + return 0; +} + +int Strncasecmp(const char *a, const char *b, long maxn) /* from Nlm_StrNICmp */ +{ + int diff, done; + if (a == b) return 0; + done = 0; + while (! done) { + diff = to_upper(*a) - to_upper(*b); + if (diff) return diff; + if (*a == '\0') done = 1; + else { + a++; b++; maxn--; + if (! maxn) done = 1; + } + } + return 0; +} + + + + + +#ifndef Local +# define Local static /* local functions */ +#endif + +#define kStartLength 500 + +const char *aminos = "ABCDEFGHIKLMNPQRSTVWXYZ*"; +const char *primenuc = "ACGTU"; +const char *protonly = "EFIPQZ"; + +const char kNocountsymbols[5] = "_.-?"; +const char stdsymbols[6] = "_.-*?"; +const char allsymbols[32] = "_.-*?<>{}[]()!@#$%^&=+;:'/|`~\"\\"; +static const char *seqsymbols = allsymbols; + +const char nummask[11] = "0123456789"; +const char nonummask[11] = "~!@#$%^&*("; + +/* + use general form of isseqchar -- all chars + symbols. + no formats except nbrf (?) use symbols in data area as + anything other than sequence chars. +*/ + + + + /* Local variables for readSeq: */ +struct ReadSeqVars { + short choice, err, nseq; + long seqlen, maxseq, seqlencount; + short topnseq; + long topseqlen; + const char *fname; + char *seq, *seqid, matchchar; + boolean allDone, done, filestart, addit; + FILE *f; + long linestart; + char s[256], *sp; + + int (*isseqchar)(); + /* int (*isseqchar)(int c); << sgi cc hates (int c) */ +}; + + + +int isSeqChar(int c) +{ + return (isalpha(c) || strchr(seqsymbols,c)); +} + +int isSeqNumChar(int c) +{ + return (isalnum(c) || strchr(seqsymbols,c)); +} + + +int isAnyChar(int c) +{ + return isascii(c); /* wrap in case isascii is macro */ +} + +Local void readline(FILE *f, char *s, long *linestart) +{ + char *cp; + + *linestart= ftell(f); + if (NULL == fgets(s, 256, f)) + *s = 0; + else { + cp = strchr(s, '\n'); + if (cp != NULL) *cp = 0; + } +} + +Local void locgetline(struct ReadSeqVars *V) +{ + readline(V->f, V->s, &V->linestart); +} + +Local void ungetline(struct ReadSeqVars *V) +{ + fseek(V->f, V->linestart, 0); +} + + +Local void addseq(char *s, struct ReadSeqVars *V) +{ + char *ptr; + + if (V->addit) while (*s != 0) { + if ((V->isseqchar)(*s)) { + if (V->seqlen >= V->maxseq) { + V->maxseq += kStartLength; + ptr = (char*) realloc(V->seq, V->maxseq+1); + if (ptr==NULL) { + V->err = eMemFull; + return; + } + else V->seq = ptr; + } + V->seq[(V->seqlen)++] = *s; + } + s++; + } +} + +Local void countseq(char *s, struct ReadSeqVars *V) + /* this must count all valid seq chars, for some formats (paup-sequential) even + if we are skipping seq... */ +{ + while (*s != 0) { + if ((V->isseqchar)(*s)) { + (V->seqlencount)++; + } + s++; + } +} + + +Local void addinfo(char *s, struct ReadSeqVars *V) +{ + char s2[256], *si; + boolean saveadd; + + si = s2; + while (*s == ' ') s++; + sprintf(si, " %d) %s\n", V->nseq, s); + + saveadd = V->addit; + V->addit = true; + V->isseqchar = isAnyChar; + addseq( si, V); + V->addit = saveadd; + V->isseqchar = isSeqChar; +} + + + + +Local void readLoop(short margin, boolean addfirst, + boolean (*endTest)(boolean *addend, boolean *ungetend, struct ReadSeqVars *V), + struct ReadSeqVars *V) +{ + boolean addend = false; + boolean ungetend = false; + + V->nseq++; + if (V->choice == kListSequences) V->addit = false; + else V->addit = (V->nseq == V->choice); + if (V->addit) V->seqlen = 0; + + if (addfirst) addseq(V->s, V); + do { + locgetline(V); + V->done = feof(V->f); + V->done |= (*endTest)( &addend, &ungetend, V); + if (V->addit && (addend || !V->done) && (strlen(V->s) > margin)) { + addseq( (V->s)+margin, V); + } + } while (!V->done); + + if (V->choice == kListSequences) addinfo(V->seqid, V); + else { + V->allDone = (V->nseq >= V->choice); + if (V->allDone && ungetend) ungetline(V); + } +} + + + +Local boolean endIG( boolean *addend, boolean *ungetend, struct ReadSeqVars *V) +{ + *addend = true; /* 1 or 2 occur in line w/ bases */ + *ungetend= false; + return((strchr(V->s,'1')!=NULL) || (strchr(V->s,'2')!=NULL)); +} + +Local void readIG(struct ReadSeqVars *V) +{ +/* 18Aug92: new IG format -- ^L between sequences in place of ";" */ + char *si; + + while (!V->allDone) { + do { + locgetline(V); + for (si= V->s; *si != 0 && *si < ' '; si++) *si= ' '; /* drop controls */ + if (*si == 0) *V->s= 0; /* chop line to empty */ + } while (! (feof(V->f) || ((*V->s != 0) && (*V->s != ';') ) )); + if (feof(V->f)) + V->allDone = true; + else { + strcpy(V->seqid, V->s); + readLoop(0, false, endIG, V); + } + } +} + + + +Local boolean endStrider( boolean *addend, boolean *ungetend, struct ReadSeqVars *V) +{ + *addend = false; + *ungetend= false; + return (strstr( V->s, "//") != NULL); +} + +Local void readStrider(struct ReadSeqVars *V) +{ /* ? only 1 seq/file ? */ + + while (!V->allDone) { + locgetline(V); + if (strstr(V->s,"; DNA sequence ") == V->s) + strcpy(V->seqid, (V->s)+16); + else + strcpy(V->seqid, (V->s)+1); + while ((!feof(V->f)) && (*V->s == ';')) { + locgetline(V); + } + if (feof(V->f)) V->allDone = true; + else readLoop(0, true, endStrider, V); + } +} + + +Local boolean endPIR( boolean *addend, boolean *ungetend, struct ReadSeqVars *V) +{ + *addend = false; + *ungetend= (strstr(V->s,"ENTRY") == V->s); + return ((strstr(V->s,"///") != NULL) || *ungetend); +} + +Local void readPIR(struct ReadSeqVars *V) +{ /*PIR -- many seqs/file */ + + while (!V->allDone) { + while (! (feof(V->f) || strstr(V->s,"ENTRY") || strstr(V->s,"SEQUENCE")) ) + locgetline(V); + strcpy(V->seqid, (V->s)+16); + while (! (feof(V->f) || strstr(V->s,"SEQUENCE") == V->s)) + locgetline(V); + readLoop(0, false, endPIR, V); + + if (!V->allDone) { + while (! (feof(V->f) || ((*V->s != 0) + && (strstr( V->s,"ENTRY") == V->s)))) + locgetline(V); + } + if (feof(V->f)) V->allDone = true; + } +} + + +Local boolean endGB( boolean *addend, boolean *ungetend, struct ReadSeqVars *V) +{ + *addend = false; + *ungetend= (strstr(V->s,"LOCUS") == V->s); + return ((strstr(V->s,"//") != NULL) || *ungetend); +} + +Local void readGenBank(struct ReadSeqVars *V) +{ /*GenBank -- many seqs/file */ + + while (!V->allDone) { + strcpy(V->seqid, (V->s)+12); + while (! (feof(V->f) || strstr(V->s,"ORIGIN") == V->s)) + locgetline(V); + readLoop(0, false, endGB, V); + + if (!V->allDone) { + while (! (feof(V->f) || ((*V->s != 0) + && (strstr( V->s,"LOCUS") == V->s)))) + locgetline(V); + } + if (feof(V->f)) V->allDone = true; + } +} + + +Local boolean endNBRF( boolean *addend, boolean *ungetend, struct ReadSeqVars *V) +{ + char *a; + + if ((a = strchr(V->s, '*')) != NULL) { /* end of 1st seq */ + /* "*" can be valid base symbol, drop it here */ + *a = 0; + *addend = true; + *ungetend= false; + return(true); + } + else if (*V->s == '>') { /* start of next seq */ + *addend = false; + *ungetend= true; + return(true); + } + else + return(false); +} + +Local void readNBRF(struct ReadSeqVars *V) +{ + while (!V->allDone) { + strcpy(V->seqid, (V->s)+4); + locgetline(V); /*skip title-junk line*/ + readLoop(0, false, endNBRF, V); + if (!V->allDone) { + while (!(feof(V->f) || (*V->s != 0 && *V->s == '>'))) + locgetline(V); + } + if (feof(V->f)) V->allDone = true; + } +} + + + +Local boolean endPearson( boolean *addend, boolean *ungetend, struct ReadSeqVars *V) +{ + *addend = false; + *ungetend= true; + return(*V->s == '>'); +} + +Local void readPearson(struct ReadSeqVars *V) +{ + while (!V->allDone) { + strcpy(V->seqid, (V->s)+1); + readLoop(0, false, endPearson, V); + if (!V->allDone) { + while (!(feof(V->f) || ((*V->s != 0) && (*V->s == '>')))) + locgetline(V); + } + if (feof(V->f)) V->allDone = true; + } +} + + + +Local boolean endEMBL( boolean *addend, boolean *ungetend, struct ReadSeqVars *V) +{ + *addend = false; + *ungetend= (strstr(V->s,"ID ") == V->s); + return ((strstr(V->s,"//") != NULL) || *ungetend); +} + +Local void readEMBL(struct ReadSeqVars *V) +{ + while (!V->allDone) { + strcpy(V->seqid, (V->s)+5); + do { + locgetline(V); + } while (!(feof(V->f) | (strstr(V->s,"SQ ") == V->s))); + + readLoop(0, false, endEMBL, V); + if (!V->allDone) { + while (!(feof(V->f) | + ((*V->s != '\0') & (strstr(V->s,"ID ") == V->s)))) + locgetline(V); + } + if (feof(V->f)) V->allDone = true; + } +} + + + +Local boolean endZuker( boolean *addend, boolean *ungetend, struct ReadSeqVars *V) +{ + *addend = false; + *ungetend= true; + return( *V->s == '(' ); +} + +Local void readZuker(struct ReadSeqVars *V) +{ + /*! 1st string is Zuker's Fortran format */ + + while (!V->allDone) { + locgetline(V); /*s == "seqLen seqid string..."*/ + strcpy(V->seqid, (V->s)+6); + readLoop(0, false, endZuker, V); + if (!V->allDone) { + while (!(feof(V->f) | + ((*V->s != '\0') & (*V->s == '(')))) + locgetline(V); + } + if (feof(V->f)) V->allDone = true; + } +} + + + +Local boolean endFitch( boolean *addend, boolean *ungetend, struct ReadSeqVars *V) +{ + /* this is a somewhat shaky end, + 1st char of line is non-blank for seq. title + */ + *addend = false; + *ungetend= true; + return( *V->s != ' ' ); +} + +Local void readFitch(struct ReadSeqVars *V) +{ + boolean first; + + first = true; + while (!V->allDone) { + if (!first) strcpy(V->seqid, V->s); + readLoop(0, first, endFitch, V); + if (feof(V->f)) V->allDone = true; + first = false; + } +} + + +Local void readPlain(struct ReadSeqVars *V) +{ + V->nseq++; + V->addit = (V->choice > 0); + if (V->addit) V->seqlen = 0; + addseq(V->seqid, V); /*from above..*/ + if (V->fname!=NULL) sprintf(V->seqid, "%s [Unknown form]", V->fname); + else sprintf(V->seqid, " [Unknown form]"); + do { + addseq(V->s, V); + V->done = feof(V->f); + locgetline(V); + } while (!V->done); + if (V->choice == kListSequences) addinfo(V->seqid, V); + V->allDone = true; +} + + +Local void readUWGCG(struct ReadSeqVars *V) +{ +/* +10nov91: Reading GCG files casued duplication of last line when + EOF followed that line !!! + fix: locgetline now sets *V->s = 0 +*/ + char *si; + + V->nseq++; + V->addit = (V->choice > 0); + if (V->addit) V->seqlen = 0; + strcpy(V->seqid, V->s); + /*writeseq: " %s Length: %d (today) Check: %d ..\n" */ + /*drop above or ".." from id*/ + if (si = strstr(V->seqid," Length: ")) *si = 0; + else if (si = strstr(V->seqid,"..")) *si = 0; + do { + V->done = feof(V->f); + locgetline(V); + if (!V->done) addseq((V->s), V); + } while (!V->done); + if (V->choice == kListSequences) addinfo(V->seqid, V); + V->allDone = true; +} + + +Local void readOlsen(struct ReadSeqVars *V) +{ /* G. Olsen /print output from multiple sequence editor */ + + char *si, *sj, *sk, *sm, sid[40], snum[20]; + boolean indata = false; + int snumlen; + + V->addit = (V->choice > 0); + if (V->addit) V->seqlen = 0; + rewind(V->f); V->nseq= 0; + do { + locgetline(V); + V->done = feof(V->f); + + if (V->done && !(*V->s)) break; + else if (indata) { + if ( (si= strstr(V->s, sid)) + /* && (strstr(V->s, snum) == si - snumlen - 1) ) { */ + && (sm= strstr(V->s, snum)) && (sm < si - snumlen) ) { + + /* Spaces are valid alignment data !! */ +/* 17Oct91: Error, the left margin is 21 not 22! */ +/* dropped some nucs up to now -- my example file was right shifted ! */ +/* variable right id margin, drop id-2 spaces at end */ +/* + VMS CC COMPILER (VAXC031) mess up: + -- Index of 21 is chopping 1st nuc on VMS systems Only! + Byte-for-byte same ame rnasep.olsen sequence file ! +*/ + + /* si = (V->s)+21; < was this before VMS CC wasted my time */ + si += 10; /* use strstr index plus offset to outfox VMS CC bug */ + + if (sk = strstr(si, sid)) *(sk-2) = 0; + for (sk = si; *sk != 0; sk++) { + if (*sk == ' ') *sk = '.'; + /* 18aug92: !! some olsen masks are NUMBERS !! which addseq eats */ + else if (isdigit(*sk)) *sk= nonummask[*sk - '0']; + } + + addseq(si, V); + } + } + + else if (sk = strstr(V->s, "): ")) { /* seq info header line */ + /* 18aug92: correct for diff seqs w/ same name -- use number, e.g. */ + /* 3 (Agr.tume): agrobacterium.prna 18-JUN-1987 16:12 */ + /* 328 (Agr.tume): agrobacterium.prna XYZ 19-DEC-1992 */ + (V->nseq)++; + si = 1 + strchr(V->s,'('); + *sk = ' '; + if (V->choice == kListSequences) addinfo( si, V); + else if (V->nseq == V->choice) { + strcpy(V->seqid, si); + sj = strchr(V->seqid, ':'); + while (*(--sj) == ' ') ; + while (--sj != V->seqid) { if (*sj == ' ') *sj = '_'; } + + *sk = 0; + while (*(--sk) == ' ') *sk = 0; + strcpy(sid, si); + + si= V->s; + while ((*si <= ' ') && (*si != 0)) si++; + snumlen=0; + while (si[snumlen] > ' ' && snumlen<20) + { snum[snumlen]= si[snumlen]; snumlen++; } + snum[snumlen]= 0; + } + + } + + else if (strstr(V->s,"identity: Data:")) { + indata = true; + if (V->choice == kListSequences) V->done = true; + } + + } while (!V->done); + + V->allDone = true; +} /*readOlsen*/ + + +Local void readMSF(struct ReadSeqVars *V) +{ /* gcg's MSF, mult. sequence format, interleaved ! */ + + char *si, *sj, sid[128]; + boolean indata = false; + int atseq= 0, iline= 0; + + V->addit = (V->choice > 0); + if (V->addit) V->seqlen = 0; + rewind(V->f); V->nseq= 0; + do { + locgetline(V); + V->done = feof(V->f); + + if (V->done && !(*V->s)) break; + else if (indata) { + /*somename ...gpvedai .......t.. aaigr..vad tvgtgptnse aipaltaaet */ + /* E gvenae.kgv tentna.tad fvaqpvylpe .nqt...... kv.affynrs */ + + si= V->s; + skipwhitespace(si); + /* for (sj= si; isalnum(*sj); sj++) ; bug -- cdelwiche uses "-", "_" and others in names*/ + for (sj= si; *sj > ' '; sj++) ; + *sj= 0; + if ( *si ) { + if ( (0==strcmp(si, sid)) ) { + addseq(sj+1, V); + } + iline++; + } + } + + else if (NULL != (si = strstr(V->s, "Name: "))) { /* seq info header line */ + /* Name: somename Len: 100 Check: 7009 Weight: 1.00 */ + + (V->nseq)++; + si += 6; + if (V->choice == kListSequences) addinfo( si, V); + else if (V->nseq == V->choice) { + strcpy(V->seqid, si); + si = V->seqid; + skipwhitespace(si); + /* for (sj= si; isalnum(*sj); sj++) ; -- bug */ + for (sj= si; *sj > ' '; sj++) ; + *sj= 0; + strcpy(sid, si); + } + } + + else if ( strstr(V->s,"//") /*== V->s*/ ) { + indata = true; + iline= 0; + if (V->choice == kListSequences) V->done = true; + } + + } while (!V->done); + + + V->allDone = true; +} /*readMSF*/ + + + +Local void readPAUPinterleaved(struct ReadSeqVars *V) +{ /* PAUP mult. sequence format, interleaved or sequential! */ + + char *si, *sj, *send, sid[40], sid1[40], saveseq[255]; + boolean first = true, indata = false, domatch; + int atseq= 0, iline= 0, ifmc, saveseqlen=0; + +#define fixmatchchar(s) { \ + for (ifmc=0; ifmcmatchchar) s[ifmc]= saveseq[ifmc]; } + + V->addit = (V->choice > 0); + V->seqlencount = 0; + if (V->addit) V->seqlen = 0; + /* rewind(V->f); V->nseq= 0; << do in caller !*/ + indata= true; /* call here after we find "matrix" */ + domatch= (V->matchchar > 0); + + do { + locgetline(V); + V->done = feof(V->f); + + if (V->done && !(*V->s)) break; + else if (indata) { + /* [ 1 1 1 ]*/ + /* human aagcttcaccggcgcagtca ttctcataatcgcccacggR cttacatcct*/ + /* chimp ................a.t. .c.................a ..........*/ + /* !! need to correct for V->matchchar */ + si= V->s; + skipwhitespace(si); + if (strchr(si,';')) indata= false; + + if (isalnum(*si)) { + /* valid data line starts w/ a left-justified seq name in columns [0..8] */ + if (first) { + (V->nseq)++; + if (V->nseq >= V->topnseq) first= false; + for (sj = si; isalnum(*sj); sj++) ; + send= sj; + skipwhitespace(sj); + if (V->choice == kListSequences) { + *send= 0; + addinfo( si, V); + } + else if (V->nseq == V->choice) { + if (domatch) { + if (V->nseq == 1) { strcpy( saveseq, sj); saveseqlen= strlen(saveseq); } + else fixmatchchar( sj); + } + addseq(sj, V); + *send= 0; + strcpy(V->seqid, si); + strcpy(sid, si); + if (V->nseq == 1) strcpy(sid1, sid); + } + } + + else if ( (strstr(si, sid) == si) ){ + while (isalnum(*si)) si++; + skipwhitespace(si); + if (domatch) { + if (V->nseq == 1) { strcpy( saveseq, si); saveseqlen= strlen(saveseq); } + else fixmatchchar( si); + } + addseq(si, V); + } + + else if (domatch && (strstr(si, sid1) == si)) { + strcpy( saveseq, si); + saveseqlen= strlen(saveseq); + } + + iline++; + } + } + + else if ( strstr(V->s,"matrix") ) { + indata = true; + iline= 0; + if (V->choice == kListSequences) V->done = true; + } + + } while (!V->done); + + V->allDone = true; +} /*readPAUPinterleaved*/ + + + +Local void readPAUPsequential(struct ReadSeqVars *V) +{ /* PAUP mult. sequence format, interleaved or sequential! */ + char *si, *sj; + boolean atname = true, indata = false; + + V->addit = (V->choice > 0); + if (V->addit) V->seqlen = 0; + V->seqlencount = 0; + /* rewind(V->f); V->nseq= 0; << do in caller !*/ + indata= true; /* call here after we find "matrix" */ + do { + locgetline(V); + V->done = feof(V->f); + + if (V->done && !(*V->s)) break; + else if (indata) { + /* [ 1 1 1 ]*/ + /* human aagcttcaccggcgcagtca ttctcataatcgcccacggR cttacatcct*/ + /* aagcttcaccggcgcagtca ttctcataatcgcccacggR cttacatcct*/ + /* chimp ................a.t. .c.................a ..........*/ + /* ................a.t. .c.................a ..........*/ + + si= V->s; + skipwhitespace(si); + if (strchr(si,';')) indata= false; + if (isalnum(*si)) { + /* valid data line starts w/ a left-justified seq name in columns [0..8] */ + if (atname) { + (V->nseq)++; + V->seqlencount = 0; + atname= false; + sj= si+1; + while (isalnum(*sj)) sj++; + if (V->choice == kListSequences) { + /* !! we must count bases to know when topseqlen is reached ! */ + countseq(sj, V); + if (V->seqlencount >= V->topseqlen) atname= true; + *sj= 0; + addinfo( si, V); + } + else if (V->nseq == V->choice) { + addseq(sj, V); + V->seqlencount= V->seqlen; + if (V->seqlencount >= V->topseqlen) atname= true; + *sj= 0; + strcpy(V->seqid, si); + } + else { + countseq(sj, V); + if (V->seqlencount >= V->topseqlen) atname= true; + } + } + + else if (V->nseq == V->choice) { + addseq(V->s, V); + V->seqlencount= V->seqlen; + if (V->seqlencount >= V->topseqlen) atname= true; + } + else { + countseq(V->s, V); + if (V->seqlencount >= V->topseqlen) atname= true; + } + } + } + + else if ( strstr(V->s,"matrix") ) { + indata = true; + atname= true; + if (V->choice == kListSequences) V->done = true; + } + + } while (!V->done); + + V->allDone = true; +} /*readPAUPsequential*/ + + +Local void readPhylipInterleaved(struct ReadSeqVars *V) +{ + char *si, *sj; + boolean first = true; + int iline= 0; + + V->addit = (V->choice > 0); + if (V->addit) V->seqlen = 0; + V->seqlencount = 0; + /* sscanf( V->s, "%d%d", &V->topnseq, &V->topseqlen); << topnseq == 0 !!! bad scan !! */ + si= V->s; + skipwhitespace(si); + V->topnseq= atoi(si); + while (isdigit(*si)) si++; + skipwhitespace(si); + V->topseqlen= atol(si); + /* fprintf(stderr,"Phylip-ileaf: topnseq=%d topseqlen=%d\n",V->topnseq, V->topseqlen); */ + + do { + locgetline(V); + V->done = feof(V->f); + + if (V->done && !(*V->s)) break; + si= V->s; + skipwhitespace(si); + if (*si != 0) { + + if (first) { /* collect seq names + seq, as fprintf(outf,"%-10s ",seqname); */ + (V->nseq)++; + if (V->nseq >= V->topnseq) first= false; + sj= V->s+10; /* past name, start of data */ + if (V->choice == kListSequences) { + *sj= 0; + addinfo( si, V); + } + else if (V->nseq == V->choice) { + addseq(sj, V); + *sj= 0; + strcpy(V->seqid, si); + } + } + else if ( iline % V->nseq == V->choice -1 ) { + addseq(si, V); + } + iline++; + } + } while (!V->done); + + V->allDone = true; +} /*readPhylipInterleaved*/ + + + +Local boolean endPhylipSequential( boolean *addend, boolean *ungetend, struct ReadSeqVars *V) +{ + *addend = false; + *ungetend= false; + countseq( V->s, V); + return V->seqlencount >= V->topseqlen; +} + +Local void readPhylipSequential(struct ReadSeqVars *V) +{ + short i; + char *si; + /* sscanf( V->s, "%d%d", &V->topnseq, &V->topseqlen); < ? bad sscan ? */ + si= V->s; + skipwhitespace(si); + V->topnseq= atoi(si); + while (isdigit(*si)) si++; + skipwhitespace(si); + V->topseqlen= atol(si); + locgetline(V); + while (!V->allDone) { + V->seqlencount= 0; + strncpy(V->seqid, (V->s), 10); + V->seqid[10]= 0; + for (i=0; i<10 && V->s[i]; i++) V->s[i]= ' '; + readLoop(0, true, endPhylipSequential, V); + if (feof(V->f)) V->allDone = true; + } +} + + + + +Local void readSeqMain( + struct ReadSeqVars *V, + const long skiplines_, + const short format_) +{ +#define tolowerstr(s) { long Itlwr, Ntlwr= strlen(s); \ + for (Itlwr=0; Itlwrlinestart= 0; + V->matchchar= 0; + if (V->f == NULL) + V->err = eFileNotFound; + else { + + for (l = skiplines_; l > 0; l--) locgetline( V); + + do { + locgetline( V); + for (l= strlen(V->s); (l > 0) && (V->s[l] == ' '); l--) ; + } while ((l == 0) && !feof(V->f)); + + if (feof(V->f)) V->err = eNoData; + + else switch (format_) { + case kPlain : readPlain(V); break; + case kIG : readIG(V); break; + case kStrider: readStrider(V); break; + case kGenBank: readGenBank(V); break; + case kPIR : readPIR(V); break; + case kNBRF : readNBRF(V); break; + case kPearson: readPearson(V); break; + case kEMBL : readEMBL(V); break; + case kZuker : readZuker(V); break; + case kOlsen : readOlsen(V); break; + case kMSF : readMSF(V); break; + + case kPAUP : { + boolean done= false; + boolean interleaved= false; + char *cp; + /* rewind(V->f); V->nseq= 0; ?? assume it is at top ?? skiplines ... */ + while (!done) { + locgetline( V); + tolowerstr( V->s); + if (strstr( V->s, "matrix")) done= true; + if (strstr( V->s, "interleav")) interleaved= true; + if (NULL != (cp=strstr( V->s, "ntax=")) ) V->topnseq= atoi(cp+5); + if (NULL != (cp=strstr( V->s, "nchar=")) ) V->topseqlen= atoi(cp+6); + if (NULL != (cp=strstr( V->s, "matchchar=")) ) { + cp += 10; + if (*cp=='\'') cp++; + else if (*cp=='"') cp++; + V->matchchar= *cp; + } + } + if (interleaved) readPAUPinterleaved(V); + else readPAUPsequential(V); + } + break; + + /* kPhylip: ! can't determine in middle of file which type it is...*/ + /* test for interleave or sequential and use Phylip4(ileave) or Phylip2 */ + case kPhylip2: + readPhylipSequential(V); + break; + case kPhylip4: /* == kPhylip3 */ + readPhylipInterleaved(V); + break; + + default: + V->err = eUnknownFormat; + break; + + case kFitch : + strcpy(V->seqid, V->s); locgetline(V); + readFitch(V); + break; + + case kGCG: + do { + gotuw = (strstr(V->s,"..") != NULL); + if (gotuw) readUWGCG(V); + locgetline(V); + } while (!(feof(V->f) || V->allDone)); + break; + } + } + + V->filestart= false; + V->seq[V->seqlen] = 0; /* stick a string terminator on it */ +} + + +char *readSeqFp( + const short whichEntry_, /* index to sequence in file */ + FILE *fp_, /* pointer to open seq file */ + const long skiplines_, + const short format_, /* sequence file format */ + long *seqlen_, /* return seq size */ + short *nseq_, /* number of seqs in file, for listSeqs() */ + short *error_, /* return error */ + char *seqid_) /* return seq name/info */ +{ + struct ReadSeqVars V; + + if (format_ < kMinFormat || format_ > kMaxFormat) { + *error_ = eUnknownFormat; + *seqlen_ = 0; + return NULL; + } + + V.choice = whichEntry_; + V.fname = NULL; /* don't know */ + V.seq = (char*) calloc(1, kStartLength+1); + V.maxseq = kStartLength; + V.seqlen = 0; + V.seqid = seqid_; + + V.f = fp_; + V.filestart= (ftell( fp_) == 0); + /* !! in sequential read, must remove current seq position from choice/whichEntry_ counter !! ... */ + if (V.filestart) V.nseq = 0; + else V.nseq= *nseq_; /* track where we are in file...*/ + + *V.seqid = '\0'; + V.err = 0; + V.nseq = 0; + V.isseqchar = isSeqChar; + if (V.choice == kListSequences) ; /* leave as is */ + else if (V.choice <= 0) V.choice = 1; /* default ?? */ + V.addit = (V.choice > 0); + V.allDone = false; + + readSeqMain(&V, skiplines_, format_); + + *error_ = V.err; + *seqlen_ = V.seqlen; + *nseq_ = V.nseq; + return V.seq; +} + +char *readSeq( + const short whichEntry_, /* index to sequence in file */ + const char *filename_, /* file name */ + const long skiplines_, + const short format_, /* sequence file format */ + long *seqlen_, /* return seq size */ + short *nseq_, /* number of seqs in file, for listSeqs() */ + short *error_, /* return error */ + char *seqid_) /* return seq name/info */ +{ + struct ReadSeqVars V; + + if (format_ < kMinFormat || format_ > kMaxFormat) { + *error_ = eUnknownFormat; + *seqlen_ = 0; + return NULL; + } + + V.choice = whichEntry_; + V.fname = filename_; /* don't need to copy string, just ptr to it */ + V.seq = (char*) calloc(1, kStartLength+1); + V.maxseq = kStartLength; + V.seqlen = 0; + V.seqid = seqid_; + + V.f = NULL; + *V.seqid = '\0'; + V.err = 0; + V.nseq = 0; + V.isseqchar = isSeqChar; + if (V.choice == kListSequences) ; /* leave as is */ + else if (V.choice <= 0) V.choice = 1; /* default ?? */ + V.addit = (V.choice > 0); + V.allDone = false; + + V.f = fopen(V.fname, "r"); + V.filestart= true; + + readSeqMain(&V, skiplines_, format_); + + if (V.f != NULL) fclose(V.f); + *error_ = V.err; + *seqlen_ = V.seqlen; + *nseq_ = V.nseq; + return V.seq; +} + + + + + +char *listSeqs( + const char *filename_, /* file name */ + const long skiplines_, + const short format_, /* sequence file format */ + short *nseq_, /* number of seqs in file, for listSeqs() */ + short *error_) /* return error */ +{ + char seqid[256]; + long seqlen; + + return readSeq( kListSequences, filename_, skiplines_, format_, + &seqlen, nseq_, error_, seqid); +} + + + + +short seqFileFormat( /* return sequence format number, see ureadseq.h */ + const char *filename, + long *skiplines, /* return #lines to skip any junk like mail header */ + short *error) /* return any error value or 0 */ +{ + FILE *fseq; + short format; + + fseq = fopen(filename, "r"); + format= seqFileFormatFp( fseq, skiplines, error); + if (fseq!=NULL) fclose(fseq); + return format; +} + +short seqFileFormatFp( + FILE *fseq, + long *skiplines, /* return #lines to skip any junk like mail header */ + short *error) /* return any error value or 0 */ +{ + boolean foundDNA= false, foundIG= false, foundStrider= false, + foundGB= false, foundPIR= false, foundEMBL= false, foundNBRF= false, + foundPearson= false, foundFitch= false, foundPhylip= false, foundZuker= false, + gotolsen= false, gotpaup = false, gotasn1 = false, gotuw= false, gotMSF= false, + isfitch= false, isphylip= false, done= false; + short format= kUnknown; + int nlines= 0, k, splen= 0, otherlines= 0, aminolines= 0, dnalines= 0; + char sp[256]; + long linestart=0; + int maxlines2check=500; + +#define ReadOneLine(sp) \ + { done |= (feof(fseq)); \ + readline( fseq, sp, &linestart); \ + if (!done) { splen = strlen(sp); ++nlines; } } + + *skiplines = 0; + *error = 0; + if (fseq == NULL) { *error = eFileNotFound; return kNoformat; } + + while ( !done ) { + ReadOneLine(sp); + + /* check for mailer head & skip past if found */ + if (nlines < 4 && !done) { + if ((strstr(sp,"From ") == sp) || (strstr(sp,"Received:") == sp)) { + do { + /* skip all lines until find one blank line */ + ReadOneLine(sp); + if (!done) for (k=0; (k') { + if (sp[3] == ';') foundNBRF= true; + else foundPearson= true; + } + + else if (strstr(sp,"ID ") == sp) + foundEMBL= true; + else if (strstr(sp,"SQ ") == sp) + foundEMBL= true; + + else if (*sp == '(') + foundZuker= true; + + else { + if (nlines - *skiplines == 1) { + int ispp= 0, ilen= 0; + sscanf( sp, "%d%d", &ispp, &ilen); + if (ispp > 0 && ilen > 0) isphylip= true; + } + else if (isphylip && nlines - *skiplines == 2) { + int tseq; + tseq= getseqtype(sp+10, strlen(sp+10)); + if ( isalpha(*sp) /* 1st letter in 2nd line must be of a name */ + && (tseq != kOtherSeq)) /* sequence section must be okay */ + foundPhylip= true; + } + + for (k=0, isfitch= true; isfitch & (k < splen); k++) { + if (k % 4 == 0) isfitch &= (sp[k] == ' '); + else isfitch &= (sp[k] != ' '); + } + if (isfitch & (splen > 20)) foundFitch= true; + + /* kRNA && kDNA are fairly certain...*/ + switch (getseqtype( sp, splen)) { + case kOtherSeq: otherlines++; break; + case kAmino : if (splen>20) aminolines++; break; + case kDNA : + case kRNA : if (splen>20) dnalines++; break; + case kNucleic : break; /* not much info ? */ + } + + } + + /* pretty certain */ + if (gotolsen) { + format= kOlsen; + done= true; + } + else if (gotMSF) { + format= kMSF; + done= true; + } + else if (gotasn1) { + /* !! we need to look further and return kASNseqentry | kASNseqset */ + /* + seqentry key is Seq-entry ::= + seqset key is Bioseq-set ::= + ?? can't read these yet w/ ncbi tools ?? + Seq-submit ::= + Bioseq ::= << fails both bioseq-seq and seq-entry parsers ! + */ + if (strstr(sp,"Bioseq-set")) format= kASNseqset; + else if (strstr(sp,"Seq-entry")) format= kASNseqentry; + else format= kASN1; /* other form, we can't yet read... */ + done= true; + } + else if (gotpaup) { + format= kPAUP; + done= true; + } + + else if (gotuw) { + if (foundIG) format= kIG; /* a TOIG file from GCG for certain */ + else format= kGCG; + done= true; + } + + else if ((dnalines > 1) || done || (nlines > maxlines2check)) { + /* decide on most likely format */ + /* multichar idents: */ + if (foundStrider) format= kStrider; + else if (foundGB) format= kGenBank; + else if (foundPIR) format= kPIR; + else if (foundEMBL) format= kEMBL; + else if (foundNBRF) format= kNBRF; + /* single char idents: */ + else if (foundIG) format= kIG; + else if (foundPearson) format= kPearson; + else if (foundZuker) format= kZuker; + /* digit ident: */ + else if (foundPhylip) format= kPhylip; + /* spacing ident: */ + else if (foundFitch) format= kFitch; + /* no format chars: */ + else if (otherlines > 0) format= kUnknown; + else if (dnalines > 1) format= kPlain; + else if (aminolines > 1) format= kPlain; + else format= kUnknown; + + done= true; + } + + /* need this for possible long header in olsen format */ + else if (strstr(sp,"): ") != NULL) + maxlines2check++; + } + + if (format == kPhylip) { + /* check for interleaved or sequential -- really messy */ + int tname, tseq; + long i, j, nspp= 0, nlen= 0, ilen, leaf= 0, seq= 0; + char *ps; + + rewind(fseq); + for (i=0; i < *skiplines; i++) ReadOneLine(sp); + nlines= 0; + ReadOneLine(sp); + sscanf( sp, "%d%d", &nspp, &nlen); + ReadOneLine(sp); /* 1st seq line */ + for (ps= sp+10, ilen=0; *ps!=0; ps++) if (isprint(*ps)) ilen++; + + for (i= 1; i=9) seq += 10; /* pretty certain not ileaf */ + else { + if (tseq != tname) leaf++; else seq++; + if (tname == kDNA || tname == kRNA) seq++; else leaf++; + } + + if (ilen <= nlen && j<9) { + if (tname == kOtherSeq) leaf += 10; + else if (tname == kAmino || tname == kDNA || tname == kRNA) seq++; else leaf++; + } + else if (ilen > nlen) { + ilen= 0; + } + } + for ( nspp *= 2 ; i nlen) { + if (j>9) leaf += 10; /* must be a name here for sequent */ + else if (tname == kOtherSeq) seq += 10; + ilen= 0; + } + } + + if (leaf > seq) format= kPhylip4; + else format= kPhylip2; + } + + return(format); +#undef ReadOneLine +} /* SeqFileFormat */ + + + + +unsigned long GCGchecksum( const char *seq, const long seqlen, unsigned long *checktotal) +/* GCGchecksum */ +{ + register long i, check = 0, count = 0; + + for (i = 0; i < seqlen; i++) { + count++; + check += count * to_upper(seq[i]); + if (count == 57) count = 0; + } + check %= 10000; + *checktotal += check; + *checktotal %= 10000; + return check; +} + +/* Table of CRC-32's of all single byte values (made by makecrc.c of ZIP source) */ +const unsigned long crctab[] = { + 0x00000000L, 0x77073096L, 0xee0e612cL, 0x990951baL, 0x076dc419L, + 0x706af48fL, 0xe963a535L, 0x9e6495a3L, 0x0edb8832L, 0x79dcb8a4L, + 0xe0d5e91eL, 0x97d2d988L, 0x09b64c2bL, 0x7eb17cbdL, 0xe7b82d07L, + 0x90bf1d91L, 0x1db71064L, 0x6ab020f2L, 0xf3b97148L, 0x84be41deL, + 0x1adad47dL, 0x6ddde4ebL, 0xf4d4b551L, 0x83d385c7L, 0x136c9856L, + 0x646ba8c0L, 0xfd62f97aL, 0x8a65c9ecL, 0x14015c4fL, 0x63066cd9L, + 0xfa0f3d63L, 0x8d080df5L, 0x3b6e20c8L, 0x4c69105eL, 0xd56041e4L, + 0xa2677172L, 0x3c03e4d1L, 0x4b04d447L, 0xd20d85fdL, 0xa50ab56bL, + 0x35b5a8faL, 0x42b2986cL, 0xdbbbc9d6L, 0xacbcf940L, 0x32d86ce3L, + 0x45df5c75L, 0xdcd60dcfL, 0xabd13d59L, 0x26d930acL, 0x51de003aL, + 0xc8d75180L, 0xbfd06116L, 0x21b4f4b5L, 0x56b3c423L, 0xcfba9599L, + 0xb8bda50fL, 0x2802b89eL, 0x5f058808L, 0xc60cd9b2L, 0xb10be924L, + 0x2f6f7c87L, 0x58684c11L, 0xc1611dabL, 0xb6662d3dL, 0x76dc4190L, + 0x01db7106L, 0x98d220bcL, 0xefd5102aL, 0x71b18589L, 0x06b6b51fL, + 0x9fbfe4a5L, 0xe8b8d433L, 0x7807c9a2L, 0x0f00f934L, 0x9609a88eL, + 0xe10e9818L, 0x7f6a0dbbL, 0x086d3d2dL, 0x91646c97L, 0xe6635c01L, + 0x6b6b51f4L, 0x1c6c6162L, 0x856530d8L, 0xf262004eL, 0x6c0695edL, + 0x1b01a57bL, 0x8208f4c1L, 0xf50fc457L, 0x65b0d9c6L, 0x12b7e950L, + 0x8bbeb8eaL, 0xfcb9887cL, 0x62dd1ddfL, 0x15da2d49L, 0x8cd37cf3L, + 0xfbd44c65L, 0x4db26158L, 0x3ab551ceL, 0xa3bc0074L, 0xd4bb30e2L, + 0x4adfa541L, 0x3dd895d7L, 0xa4d1c46dL, 0xd3d6f4fbL, 0x4369e96aL, + 0x346ed9fcL, 0xad678846L, 0xda60b8d0L, 0x44042d73L, 0x33031de5L, + 0xaa0a4c5fL, 0xdd0d7cc9L, 0x5005713cL, 0x270241aaL, 0xbe0b1010L, + 0xc90c2086L, 0x5768b525L, 0x206f85b3L, 0xb966d409L, 0xce61e49fL, + 0x5edef90eL, 0x29d9c998L, 0xb0d09822L, 0xc7d7a8b4L, 0x59b33d17L, + 0x2eb40d81L, 0xb7bd5c3bL, 0xc0ba6cadL, 0xedb88320L, 0x9abfb3b6L, + 0x03b6e20cL, 0x74b1d29aL, 0xead54739L, 0x9dd277afL, 0x04db2615L, + 0x73dc1683L, 0xe3630b12L, 0x94643b84L, 0x0d6d6a3eL, 0x7a6a5aa8L, + 0xe40ecf0bL, 0x9309ff9dL, 0x0a00ae27L, 0x7d079eb1L, 0xf00f9344L, + 0x8708a3d2L, 0x1e01f268L, 0x6906c2feL, 0xf762575dL, 0x806567cbL, + 0x196c3671L, 0x6e6b06e7L, 0xfed41b76L, 0x89d32be0L, 0x10da7a5aL, + 0x67dd4accL, 0xf9b9df6fL, 0x8ebeeff9L, 0x17b7be43L, 0x60b08ed5L, + 0xd6d6a3e8L, 0xa1d1937eL, 0x38d8c2c4L, 0x4fdff252L, 0xd1bb67f1L, + 0xa6bc5767L, 0x3fb506ddL, 0x48b2364bL, 0xd80d2bdaL, 0xaf0a1b4cL, + 0x36034af6L, 0x41047a60L, 0xdf60efc3L, 0xa867df55L, 0x316e8eefL, + 0x4669be79L, 0xcb61b38cL, 0xbc66831aL, 0x256fd2a0L, 0x5268e236L, + 0xcc0c7795L, 0xbb0b4703L, 0x220216b9L, 0x5505262fL, 0xc5ba3bbeL, + 0xb2bd0b28L, 0x2bb45a92L, 0x5cb36a04L, 0xc2d7ffa7L, 0xb5d0cf31L, + 0x2cd99e8bL, 0x5bdeae1dL, 0x9b64c2b0L, 0xec63f226L, 0x756aa39cL, + 0x026d930aL, 0x9c0906a9L, 0xeb0e363fL, 0x72076785L, 0x05005713L, + 0x95bf4a82L, 0xe2b87a14L, 0x7bb12baeL, 0x0cb61b38L, 0x92d28e9bL, + 0xe5d5be0dL, 0x7cdcefb7L, 0x0bdbdf21L, 0x86d3d2d4L, 0xf1d4e242L, + 0x68ddb3f8L, 0x1fda836eL, 0x81be16cdL, 0xf6b9265bL, 0x6fb077e1L, + 0x18b74777L, 0x88085ae6L, 0xff0f6a70L, 0x66063bcaL, 0x11010b5cL, + 0x8f659effL, 0xf862ae69L, 0x616bffd3L, 0x166ccf45L, 0xa00ae278L, + 0xd70dd2eeL, 0x4e048354L, 0x3903b3c2L, 0xa7672661L, 0xd06016f7L, + 0x4969474dL, 0x3e6e77dbL, 0xaed16a4aL, 0xd9d65adcL, 0x40df0b66L, + 0x37d83bf0L, 0xa9bcae53L, 0xdebb9ec5L, 0x47b2cf7fL, 0x30b5ffe9L, + 0xbdbdf21cL, 0xcabac28aL, 0x53b39330L, 0x24b4a3a6L, 0xbad03605L, + 0xcdd70693L, 0x54de5729L, 0x23d967bfL, 0xb3667a2eL, 0xc4614ab8L, + 0x5d681b02L, 0x2a6f2b94L, 0xb40bbe37L, 0xc30c8ea1L, 0x5a05df1bL, + 0x2d02ef8dL +}; + +unsigned long CRC32checksum(const char *seq, const long seqlen, unsigned long *checktotal) +/*CRC32checksum: modified from CRC-32 algorithm found in ZIP compression source */ +{ + register unsigned long c = 0xffffffffL; + register long n = seqlen; + + while (n--) { + c = crctab[((int)c ^ (to_upper(*seq))) & 0xff] ^ (c >> 8); + seq++; /* fixed aug'98 finally */ + } + c= c ^ 0xffffffffL; + *checktotal += c; + return c; +} + + + + +short getseqtype( const char *seq, const long seqlen) +{ /* return sequence kind: kDNA, kRNA, kProtein, kOtherSeq, ??? */ + char c; + short i, maxtest; + short na = 0, aa = 0, po = 0, nt = 0, nu = 0, ns = 0, no = 0; + + maxtest = min(300, seqlen); + for (i = 0; i < maxtest; i++) { + c = to_upper(seq[i]); + if (strchr(protonly, c)) po++; + else if (strchr(primenuc,c)) { + na++; + if (c == 'T') nt++; + else if (c == 'U') nu++; + } + else if (strchr(aminos,c)) aa++; + else if (strchr(seqsymbols,c)) ns++; + else if (isalpha(c)) no++; + } + + if ((no > 0) || (po+aa+na == 0)) return kOtherSeq; + /* ?? test for probability of kOtherSeq ?, e.g., + else if (po+aa+na / maxtest < 0.70) return kOtherSeq; + */ + else if (po > 0) return kAmino; + else if (aa == 0) { + if (nu > nt) return kRNA; + else return kDNA; + } + else if (na > aa) return kNucleic; + else return kAmino; +} /* getseqtype */ + + +char* compressSeq( const char gapc, const char *seq, const long seqlen, long *newlen) +{ + register char *a, *b; + register long i; + char *newseq; + + *newlen= 0; + if (!seq) return NULL; + newseq = (char*) malloc(seqlen+1); + if (!newseq) return NULL; + for (a= (char*)seq, b=newseq, i=0; *a!=0; a++) + if (*a != gapc) { + *b++= *a; + i++; + } + *b= '\0'; + newseq = (char*) realloc(newseq, i+1); + *newlen= i; + return newseq; +} + + + +/*** +char *rtfhead = "{\\rtf1\\defformat\\mac\\deff2 \ +{\\fonttbl\ + {\\f1\\fmodern Courier;}{\\f2\\fmodern Monaco;}\ + {\\f3\\fswiss Helvetica;}{\\f4\\fswiss Geneva;}\ + {\\f5\\froman Times;}{\\f6\\froman Palatino;}\ + {\\f7\\froman New Century Schlbk;}{\\f8\\ftech Symbol;}}\ +{\\stylesheet\ + {\\s1 \\f5\\fs20 \\sbasedon0\\snext1 name;}\ + {\\s2 \\f3\\fs20 \\sbasedon0\\snext2 num;}\ + {\\s3 \\f1\\f21 \\sbasedon0\\snext3 seq;}}"; + +char *rtftail = "}"; +****/ + +short writeSeq(FILE *outf, const char *seq, const long seqlen, + const short outform, const char *seqid) +/* dump sequence to standard output */ +{ + const short kSpaceAll = -9; +#define kMaxseqwidth 250 + + boolean baseonlynum= false; /* nocountsymbols -- only count true bases, not "-" */ + short numline = 0; /* only true if we are writing seq number line (for interleave) */ + boolean numright = false, numleft = false; + boolean nameright = false, nameleft = false; + short namewidth = 8, numwidth = 8; + short spacer = 0, width = 50, tab = 0; + /* new parameters: width, spacer, those above... */ + + short linesout = 0, seqtype = kNucleic; + long i, j, l, l1, ibase; + char idword[31], endstr[10]; + char seqnamestore[128], *seqname = seqnamestore; + char s[kMaxseqwidth], *cp; + char nameform[10], numform[10], nocountsymbols[10]; + unsigned long checksum = 0, checktotal = 0; + + gPretty.atseq++; + skipwhitespace(seqid); + l = min(128, strlen(seqid)); + strncpy( seqnamestore, seqid, l); + seqname[l] = 0; + + sscanf( seqname, "%30s", idword); + sprintf(numform, "%d", seqlen); + numwidth= strlen(numform)+1; + nameform[0]= '\0'; + + if (strstr(seqname,"checksum") != NULL) { + cp = strstr(seqname,"bases"); + if (cp!=NULL) { + for ( ; (cp!=seqname) && (*cp!=','); cp--) ; + if (cp!=seqname) *cp=0; + } + } + + strcpy( endstr,""); + l1 = 0; + + if (outform == kGCG || outform == kMSF) + checksum = GCGchecksum(seq, seqlen, &checktotal); + else + checksum = seqchecksum(seq, seqlen, &checktotal); + + switch (outform) { + + case kPlain: + case kUnknown: /* no header, just sequence */ + strcpy(endstr,"\n"); /* end w/ extra blank line */ + break; + + case kOlsen: /* Olsen seq. editor takes plain nucs OR Genbank */ + case kGenBank: + fprintf(outf,"LOCUS %s %d bp\n", idword, seqlen); + fprintf(outf,"DEFINITION %s, %d bases, %X checksum.\n", seqname, seqlen, checksum); + /* fprintf(outf,"ACCESSION %s\n", accnum); */ + fprintf(outf,"ORIGIN \n"); + spacer = 11; + numleft = true; + numwidth = 8; /* dgg. 1Feb93, patch for GDE fail to read short numwidth */ + strcpy(endstr, "\n//"); + linesout += 4; + break; + + case kPIR: + /* somewhat like genbank... \\\*/ + /* fprintf(outf,"\\\\\\\n"); << only at top of file, not each entry... */ + fprintf(outf,"ENTRY %s \n", idword); + fprintf(outf,"TITLE %s, %d bases, %X checksum.\n", seqname, seqlen, checksum); + /* fprintf(outf,"ACCESSION %s\n", accnum); */ + fprintf(outf,"SEQUENCE \n"); + numwidth = 7; + width= 30; + spacer = kSpaceAll; + numleft = true; + strcpy(endstr, "\n///"); + /* run a top number line for PIR */ + for (j=0; jP1;%s\n", idword); + else + fprintf(outf,">DL;%s\n", idword); + fprintf(outf,"%s, %d bases, %X checksum.\n", seqname, seqlen, checksum); + spacer = 11; + strcpy(endstr,"*\n"); + linesout += 3; + break; + + case kEMBL: + fprintf(outf,"ID %s\n", idword); + /* fprintf(outf,"AC %s\n", accnum); */ + fprintf(outf,"DE %s, %d bases, %X checksum.\n", seqname, seqlen, checksum); + fprintf(outf,"SQ %d BP\n", seqlen); + strcpy(endstr, "\n//"); /* 11Oct90: bug fix*/ + tab = 4; /** added 31jan91 */ + spacer = 11; /** added 31jan91 */ + width = 60; + linesout += 4; + break; + + case kGCG: + fprintf(outf,"%s\n", seqname); + /* fprintf(outf,"ACCESSION %s\n", accnum); */ + fprintf(outf," %s Length: %d (today) Check: %d ..\n", idword, seqlen, checksum); + spacer = 11; + numleft = true; + strcpy(endstr, "\n"); /* this is insurance to help prevent misreads at eof */ + linesout += 3; + break; + + case kStrider: /* ?? map ?*/ + fprintf(outf,"; ### from DNA Strider ;-)\n"); + fprintf(outf,"; DNA sequence %s, %d bases, %X checksum.\n;\n", seqname, seqlen, checksum); + strcpy(endstr, "\n//"); + linesout += 3; + break; + + case kFitch: + fprintf(outf,"%s, %d bases, %X checksum.\n", seqname, seqlen, checksum); + spacer = 4; + width = 60; + linesout += 1; + break; + + case kPhylip2: + case kPhylip4: + /* this is version 3.2/3.4 -- simplest way to write + version 3.3 is to write as version 3.2, then + re-read file and interleave the species lines */ + if (strlen(idword)>10) idword[10] = 0; + fprintf(outf,"%-10s ",idword); + l1 = -1; + tab = 12; + spacer = 11; + break; + + case kASN1: + seqtype= getseqtype(seq, seqlen); + switch (seqtype) { + case kDNA : cp= "dna"; break; + case kRNA : cp= "rna"; break; + case kNucleic : cp= "na"; break; + case kAmino : cp= "aa"; break; + case kOtherSeq: cp= "not-set"; break; + } + fprintf(outf," seq {\n"); + fprintf(outf," id { local id %d },\n", gPretty.atseq); + fprintf(outf," descr { title \"%s\" },\n", seqid); + fprintf(outf," inst {\n"); + fprintf(outf," repr raw, mol %s, length %d, topology linear,\n", cp, seqlen); + fprintf(outf," seq-data\n"); + if (seqtype == kAmino) + fprintf(outf," iupacaa \""); + else + fprintf(outf," iupacna \""); + l1 = 17; + spacer = 0; + width = 78; + tab = 0; + strcpy(endstr,"\"\n } } ,"); + linesout += 7; + break; + + case kPAUP: + nameleft= true; + namewidth = 9; + spacer = 21; + width = 100; + tab = 0; /* 1; */ + /* strcpy(endstr,";\nend;"); << this is end of all seqs.. */ + /* do a header comment line for paup */ + fprintf(outf,"[Name: %-16s Len:%6d Check: %8X]\n", idword, seqlen, checksum); + linesout += 1; + break; + + case kPretty: + numline= gPretty.numline; + baseonlynum= gPretty.baseonlynum; + namewidth = gPretty.namewidth; + numright = gPretty.numright; + numleft = gPretty.numleft; + nameright = gPretty.nameright; + nameleft = gPretty.nameleft; + spacer = gPretty.spacer + 1; + width = gPretty.seqwidth; + tab = gPretty.tab; + /* also add rtf formatting w/ font, size, style */ + if (gPretty.nametop) { + fprintf(outf,"Name: %-16s Len:%6d Check: %8X\n", idword, seqlen, checksum); + linesout++; + } + break; + + case kMSF: + fprintf(outf," Name: %-16s Len:%6d Check: %5d Weight: 1.00\n", + idword, seqlen, checksum); + linesout++; + nameleft= true; + namewidth= 15; /* need MAX namewidth here... */ + sprintf(nameform, "%%+%ds ",namewidth); + spacer = 11; + width = 50; + tab = 0; /* 1; */ + break; + + case kIG: + fprintf(outf,";%s, %d bases, %X checksum.\n", seqname, seqlen, checksum); + fprintf(outf,"%s\n", idword); + strcpy(endstr,"1"); /* == linear dna */ + linesout += 2; + break; + + default : + case kZuker: /* don't attempt Zuker's ftn format */ + case kPearson: + fprintf(outf,">%s, %d bases, %X checksum.\n", seqname, seqlen, checksum); + linesout += 1; + break; + } + + if (*nameform==0) sprintf(nameform, "%%%d.%ds ",namewidth,namewidth); + if (numline) sprintf(numform, "%%%ds ",numwidth); + else sprintf(numform, "%%%dd ",numwidth); + strcpy( nocountsymbols, kNocountsymbols); + if (baseonlynum) { + if (strchr(nocountsymbols,gPretty.gapchar)==NULL) { + strcat(nocountsymbols," "); + nocountsymbols[strlen(nocountsymbols)-1]= gPretty.gapchar; + } + if (gPretty.domatch && (cp=strchr(nocountsymbols,gPretty.matchchar))!=NULL) { + *cp= ' '; + } + } + + if (numline) { + *idword= 0; + } + + width = min(width,kMaxseqwidth); + for (i=0, l=0, ibase = 1; i < seqlen; ) { + + if (l1 < 0) l1 = 0; + else if (l1 == 0) { + if (nameleft) fprintf(outf, nameform, idword); + if (numleft) { if (numline) fprintf(outf, numform, ""); + else fprintf(outf, numform, ibase);} + for (j=0; j