X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=srcjar%2Ffr%2Forsay%2Flri%2Fvarna%2Fapplications%2FNussinovDemo.java;fp=srcjar%2Ffr%2Forsay%2Flri%2Fvarna%2Fapplications%2FNussinovDemo.java;h=0000000000000000000000000000000000000000;hb=4f77328104498504339216829abf5ea87e2791ec;hp=94ac79d13946df977a3f75b2193a1b781fa2600b;hpb=2b8c0785318a3528e1876e8e2dd48b7d831eae69;p=jalview.git

diff --git a/srcjar/fr/orsay/lri/varna/applications/NussinovDemo.java b/srcjar/fr/orsay/lri/varna/applications/NussinovDemo.java
deleted file mode 100644
index 94ac79d..0000000
--- a/srcjar/fr/orsay/lri/varna/applications/NussinovDemo.java
+++ /dev/null
@@ -1,819 +0,0 @@
-/*
- VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
- Copyright (C) 2008  Kevin Darty, Alain Denise and Yann Ponty.
- electronic mail : Yann.Ponty@lri.fr
- paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
-
- This file is part of VARNA version 3.1.
- VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
- as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
-
- VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
- without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
- See the GNU General Public License for more details.
-
- You should have received a copy of the GNU General Public License along with VARNA version 3.1.
- If not, see http://www.gnu.org/licenses.
- */
-package fr.orsay.lri.varna.applications;
-
-import java.awt.BorderLayout;
-import java.awt.Color;
-import java.awt.Dimension;
-import java.awt.Font;
-import java.awt.GridLayout;
-import java.awt.event.ActionEvent;
-import java.awt.event.ActionListener;
-import java.awt.event.MouseEvent;
-import java.math.BigInteger;
-import java.util.ArrayList;
-import java.util.Collections;
-
-import javax.swing.BorderFactory;
-import javax.swing.DefaultComboBoxModel;
-import javax.swing.JButton;
-import javax.swing.JComboBox;
-import javax.swing.JFrame;
-import javax.swing.JLabel;
-import javax.swing.JPanel;
-import javax.swing.JTextArea;
-import javax.swing.JTextField;
-import javax.swing.JTextPane;
-import javax.swing.border.BevelBorder;
-
-import fr.orsay.lri.varna.VARNAPanel;
-import fr.orsay.lri.varna.controlers.ControleurInterpolator;
-import fr.orsay.lri.varna.exceptions.ExceptionDrawingAlgorithm;
-import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
-import fr.orsay.lri.varna.exceptions.ExceptionModeleStyleBaseSyntaxError;
-import fr.orsay.lri.varna.exceptions.ExceptionNAViewAlgorithm;
-import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
-import fr.orsay.lri.varna.exceptions.ExceptionParameterError;
-import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
-import fr.orsay.lri.varna.exceptions.MappingException;
-import fr.orsay.lri.varna.models.VARNAConfig;
-import fr.orsay.lri.varna.models.VARNAConfig.BP_STYLE;
-import fr.orsay.lri.varna.models.rna.Mapping;
-import fr.orsay.lri.varna.models.rna.ModeleBase;
-import fr.orsay.lri.varna.models.rna.ModelBaseStyle;
-import fr.orsay.lri.varna.models.rna.RNA;
-import fr.orsay.lri.varna.interfaces.InterfaceVARNABasesListener;
-import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;;
-
-public class NussinovDemo extends JFrame implements InterfaceVARNAListener,InterfaceVARNABasesListener {
-
-	/**
-	 * 
-	 */
-	private static final long serialVersionUID = -790155708306987257L;
-
-	private static final String SEQUENCE_DUMMY =        "AAAAAAAAAA";
-	private static final String SEQUENCE_A =        "AGGCACGUCU";
-	private static final String SEQUENCE_B =  "GAGUAGCCUC";
-	private static final String SEQUENCE_C = "GCAUAGCUGC";
-	private static final String SEQUENCE_INRIA = "GAGAAGUACUUGAAAUUGGCCUCCUC";
-	
-
-	private static final String SEQUENCE_BIG = "AAAACAAAAACACCAUGGUGUUUUCACCCAAUUGGGUGAAAACAGAGAUCUCGAGAUCUCUGUUUUUGUUUU"; 
-
-	private static final String DEFAULT_STRUCTURE = "..........";
-	// private static final String DEFAULT_STRUCTURE1 = "((((....))))";
-	// private static final String DEFAULT_STRUCTURE2 =
-	// "((((..(((....)))..))))";
-
-	private VARNAPanel _vpMaster;
-
-	private InfoPanel _infos = new InfoPanel();
-	private JPanel _tools = new JPanel();
-	private JPanel _input = new JPanel();
-
-	private JPanel _seqPanel = new JPanel();
-	private JPanel _structPanel = new JPanel();
-	private JLabel _actions = new JLabel();
-	private JLabel _struct = new JLabel(DEFAULT_STRUCTURE);
-	private JComboBox _seq1 = new JComboBox();
-	private JLabel _structLabel = new JLabel("Structure Secondaire");
-	private JLabel _seqLabel = new JLabel("Sequence d'ARN");
-	private JButton _goButton = new JButton("Repliement");
-	private JButton _switchButton = new JButton("Effacer");
-
-
-	private Color _backgroundColor = Color.white;
-	
-	public static Font textFieldsFont = Font.decode("MonoSpaced-BOLD-16");
-	public static Font labelsFont = Font.decode("SansSerif-BOLD-20");
-	public static final int marginTools = 250;
-	public static String APP_TITLE = "Fête de la science 2015 - Inria AMIB - Repliement d'ARN";
-	
-
-	public static ModelBaseStyle createStyle(String txt) 
-	{
-		ModelBaseStyle result = new ModelBaseStyle();
-		try {
-			result.assignParameters(txt);
-		} catch (ExceptionModeleStyleBaseSyntaxError e) {
-			// TODO Auto-generated catch block
-			e.printStackTrace();
-		} catch (ExceptionParameterError e) {
-			// TODO Auto-generated catch block
-			e.printStackTrace();
-		}
-		return result;
-	}
-	
-	public void applyTo(VARNAPanel vp, ModelBaseStyle mb, int[] indices)
-	{
-		for(int i=0;i<indices.length;i++)
-		{ 
-			ModeleBase m = vp.getRNA().getBaseAt(indices[i]);
-			m.setStyleBase(mb);
-			if (m.getElementStructure()!=-1)
-			{
-				vp.getRNA().getBaseAt(m.getElementStructure()).setStyleBase(mb);
-			}
-		}
-		vp.repaint();
-	}
-	
-	
-	public NussinovDemo() {
-		super();
-		try {
-			_vpMaster = new VARNAPanel(getSeq(), "");
-		} catch (ExceptionNonEqualLength e) {
-			_vpMaster.errorDialog(e);
-		}
-		_vpMaster.setPreferredSize(new Dimension(600, 600));
-		RNAPanelDemoInit();
-	}
-
-	public static void formatLabel(JLabel j)
-	{
-		j.setHorizontalTextPosition(JLabel.LEFT);
-		j.setPreferredSize(new Dimension(marginTools, 15));
-		j.setFont(labelsFont);
-	}
-	
-	private void RNAPanelDemoInit() {
-		
-		
-
-		_seq1.setFont(textFieldsFont);
-		String[] seqs = {SEQUENCE_DUMMY,SEQUENCE_INRIA,SEQUENCE_A,SEQUENCE_B,SEQUENCE_C,SEQUENCE_BIG};
-		_seq1.setModel(new DefaultComboBoxModel(seqs));
-		_seq1.setEditable(true);
-		
-
-		setBackground(_backgroundColor);
-		_vpMaster.setBackground(_backgroundColor);
-		_vpMaster.addVARNAListener(this);
-		_vpMaster.setFlatExteriorLoop(true);
-		
-
-
-		formatLabel(_seqLabel);
-		formatLabel(_structLabel);
-
-		_goButton.addActionListener(new ActionListener() {
-			public void actionPerformed(ActionEvent e) {
-				showSolution();
-				onStructureRedrawn();
-			}
-		});
-
-		_switchButton.addActionListener(new ActionListener() {
-			public void actionPerformed(ActionEvent e) {
-				try {
-							RNA r = new RNA();
-							r.setRNA("", "");
-							_struct.setText("");
-							_vpMaster.setTitle("");
-							_vpMaster.showRNA(r);
-							onStructureRedrawn();
-					} 
-				catch (ExceptionFileFormatOrSyntax e2) {
-					e2.printStackTrace();
-				} catch (ExceptionUnmatchedClosingParentheses e2) {
-					// TODO Auto-generated catch block
-					e2.printStackTrace();
-				}
-				_vpMaster.repaint();
-			}
-		});
-
-		_seqPanel.setLayout(new BorderLayout());
-		_seqPanel.add(_seqLabel, BorderLayout.WEST);
-		_seqPanel.add(_seq1, BorderLayout.CENTER);
-
-		_structLabel.setPreferredSize(new Dimension(marginTools, 15));
-		_structLabel.setHorizontalTextPosition(JLabel.LEFT);
-		_struct.setFont(textFieldsFont);
-		_structPanel.setLayout(new BorderLayout());
-		_structPanel.add(_structLabel, BorderLayout.WEST);
-		_structPanel.add(_struct, BorderLayout.CENTER);
-
-		_input.setLayout(new GridLayout(0, 1));
-		_input.add(_seqPanel);
-		_input.add(_structPanel);
-
-		JPanel goPanel = new JPanel();
-		goPanel.setLayout(new BorderLayout());
-
-		_infos.setFont(labelsFont);
-
-		
-		_tools.setLayout(new BorderLayout());
-		_tools.add(_infos, BorderLayout.SOUTH);
-		_tools.add(_input, BorderLayout.CENTER);
-		_tools.add(_actions, BorderLayout.NORTH);
-		_tools.add(goPanel, BorderLayout.EAST);
-		_tools.setBorder(BorderFactory.createEmptyBorder(5, 5, 5, 5));
-
-		goPanel.add(_goButton, BorderLayout.CENTER);
-		goPanel.add(_switchButton, BorderLayout.SOUTH);
-
-		getContentPane().setLayout(new BorderLayout());
-		JPanel VARNAs = new JPanel();
-		VARNAs.setLayout(new GridLayout(1,2));
-		VARNAs.add(_vpMaster);
-		VARNAs.setBorder(BorderFactory.createBevelBorder(BevelBorder.RAISED));
-		getContentPane().add(VARNAs, BorderLayout.CENTER);
-		getContentPane().add(_tools, BorderLayout.SOUTH);
-
-		setVisible(true);
-
-		_vpMaster.getVARNAUI().UIRadiate();
-		_vpMaster.setTitleFontSize(26f);
-		_vpMaster.setTitleFontStyle(Font.PLAIN);
-		_vpMaster.addVARNABasesListener(this);
-		_vpMaster.setBackground(Color.decode("#308099"));
-		_vpMaster.setModifiable(false);
-		_vpMaster.setTitle("Repliement cible");
-		_vpMaster.setBPStyle(BP_STYLE.SIMPLE);
-		_vpMaster.setBackboneColor(Color.white);
-		_vpMaster.setDefaultBPColor(Color.white);
-		_vpMaster.setBaseNumbersColor(Color.white);
-		_vpMaster.setBaseOutlineColor(Color.white);
-		_vpMaster.setTitleColor(Color.white);		
-		_vpMaster.setTitleFontSize(26f);
-
-		
-		
-		this.setTitle(APP_TITLE);
-		
-		showSolution();
-		onStructureRedrawn();
-	}
-
-	private synchronized void showSolution()
-	{
-		ArrayList<String> sols = getStructs();
-		_infos.setInfo(sols, count(getSeq()));
-	}
-	
-
-
-
- 	public String getSeq()
-	{
-		return (""+_seq1.getSelectedItem()).toUpperCase();
-	}
-
- 	
- 	private boolean canBasePairAll(char a, char b)
- 	{
-		return true;
- 	}
-
- 	private boolean canBasePairBasic(char a, char b)
- 	{
- 		if ((a=='G')&&(b=='C'))
- 			return true;
- 		if ((a=='C')&&(b=='G'))
- 			return true;
- 		if ((a=='U')&&(b=='A'))
- 			return true;
- 		if ((a=='A')&&(b=='U'))
- 			return true;
- 		if ((a=='G')&&(b=='U'))
- 			return true;
- 		if ((a=='U')&&(b=='G'))
- 			return true;
- 		return false;
- 	}
-
- 	private double basePairScoreBasic(char a, char b)
- 	{
- 		if ((a=='G')&&(b=='C'))
- 			return 1.0;
- 		if ((a=='C')&&(b=='G'))
- 			return 1.0;
- 		if ((a=='U')&&(b=='A'))
- 			return 1.0;
- 		if ((a=='A')&&(b=='U'))
- 			return 1.0;
- 		if ((a=='G')&&(b=='U'))
- 			return 1.0;
- 		if ((a=='U')&&(b=='G'))
- 			return 1.0;
- 		return Double.NEGATIVE_INFINITY;
- 	}
-
- 	
- 	private boolean canBasePairNussinov(char a, char b)
- 	{
- 		if ((a=='G')&&(b=='C'))
- 			return true;
- 		if ((a=='C')&&(b=='G'))
- 			return true;
- 		if ((a=='U')&&(b=='A'))
- 			return true;
- 		if ((a=='A')&&(b=='U'))
- 			return true;
- 		if ((a=='U')&&(b=='G'))
- 			return true;
- 		if ((a=='G')&&(b=='U'))
- 			return true;
- 		return false;
- 	}
-
- 	private double basePairScoreNussinov(char a, char b)
- 	{
- 		if ((a=='G')&&(b=='C'))
- 			return 3.0;
- 		if ((a=='C')&&(b=='G'))
- 			return 3.0;
- 		if ((a=='U')&&(b=='A'))
- 			return 2.0;
- 		if ((a=='A')&&(b=='U'))
- 			return 2.0;
- 		if ((a=='U')&&(b=='G'))
- 			return 1.0;
- 		if ((a=='G')&&(b=='U'))
- 			return 1.0;
- 		return Double.NEGATIVE_INFINITY;
- 	}
-
- 	private boolean canBasePairINRIA(char a, char b)
- 	{
- 		if ((a=='U')&&(b=='A'))
- 			return true;
- 		if ((a=='A')&&(b=='U'))
- 			return true;
- 		if ((a=='G')&&(b=='C'))
- 			return true;
- 		if ((a=='C')&&(b=='G'))
- 			return true;
-
- 		if ((a=='A')&&(b=='G'))
- 			return true;
- 		if ((a=='G')&&(b=='A'))
- 			return true;
- 		if ((a=='U')&&(b=='C'))
- 			return true;
- 		if ((a=='C')&&(b=='U'))
- 			return true;
- 		if ((a=='A')&&(b=='A'))
- 			return true;
- 		if ((a=='U')&&(b=='U'))
- 			return true;
-
- 		if ((a=='U')&&(b=='G'))
- 			return true;
- 		if ((a=='G')&&(b=='U'))
- 			return true;
- 		if ((a=='A')&&(b=='C'))
- 			return true;
- 		if ((a=='C')&&(b=='A'))
- 			return true;
- 		return false;
- 	}
-
- 	private double basePairScoreINRIA(char a, char b)
- 	{
- 		if ((a=='U')&&(b=='A'))
- 			return 3;
- 		if ((a=='A')&&(b=='U'))
- 			return 3;
- 		if ((a=='G')&&(b=='C'))
- 			return 3;
- 		if ((a=='C')&&(b=='G'))
- 			return 3;
-
- 		if ((a=='A')&&(b=='G'))
- 			return 2;
- 		if ((a=='G')&&(b=='A'))
- 			return 2;
- 		if ((a=='U')&&(b=='C'))
- 			return 2;
- 		if ((a=='C')&&(b=='U'))
- 			return 2;
- 		if ((a=='A')&&(b=='A'))
- 			return 2;
- 		if ((a=='U')&&(b=='U'))
- 			return 2;
-
- 		if ((a=='U')&&(b=='G'))
- 			return 1;
- 		if ((a=='G')&&(b=='U'))
- 			return 1;
- 		if ((a=='A')&&(b=='C'))
- 			return 1;
- 		if ((a=='C')&&(b=='A'))
- 			return 1;
- 		return Double.NEGATIVE_INFINITY;
- 	}
- 	
- 	private boolean canBasePair(char a, char b)
- 	{
- 		return canBasePairBasic(a,b);
- 		//return canBasePairNussinov(a,b);
- 		//return canBasePairINRIA(a,b);
- 	}
- 	
- 	private double basePairScore(char a, char b)
- 	{
- 		return basePairScoreBasic(a,b);
- 		//return basePairScoreNussinov(a,b);
- 		//return basePairScoreINRIA(a,b);
- 	}
- 	
- 	public double[][] fillMatrix(String seq)
- 	{
-		int n = seq.length();
-		double[][] tab = new double[n][n];
-		for(int m=1;m<=n;m++)
-		{
-			for(int i=0;i<n-m+1;i++)
-			{
-				int j = i+m-1;
-				tab[i][j] = 0;
-				if (i<j)
-				{ 
-					tab[i][j] = Math.max(tab[i][j], tab[i+1][j]); 
-					for (int k=i+1;k<=j;k++)
-					{
-						if (canBasePair(seq.charAt(i),seq.charAt(k)))
-						{
-							double fact1 = 0;
-							if (k>i+1)
-							{
-								fact1 = tab[i+1][k-1];
-							}
-							double fact2 = 0;
-							if (k<j)
-							{
-								fact2 = tab[k+1][j];
-							}
-							tab[i][j] = Math.max(tab[i][j],basePairScore(seq.charAt(i),seq.charAt(k))+fact1+fact2);
-						} 
-					}
-				}
-			}			
-		}
- 		return tab;
- 	}
-
- 	public static ArrayList<Double> combine(double bonus, ArrayList<Double> part1, ArrayList<Double> part2)
- 	{
- 		ArrayList<Double> base = new ArrayList<Double>();
- 		for(double d1: part1)
- 		{
- 	 		for(double d2: part2)
- 	 		{
- 	 			base.add(bonus+d1+d2);
- 	 		}
- 		}
- 		return base;
- 	}
-
- 	public static ArrayList<Double> selectBests(ArrayList<Double> base)
- 	{
- 		ArrayList<Double> result = new ArrayList<Double>();
- 		double best = Double.NEGATIVE_INFINITY;
- 		for(double val: base)
- 		{
- 			best = Math.max(val, best);
- 		}
- 		for(double val: base)
- 		{
- 			if (val == best)
- 				result.add(val);
- 		}
- 		return result;
- 	}
-
- 	
- 	private ArrayList<String> backtrack(double[][] tab, String seq)
- 	{
- 		return backtrack(tab,seq, 0, seq.length()-1);
- 	}
-
- 	private ArrayList<String> backtrack(double[][] tab, String seq, int i, int j)
- 	{
- 		ArrayList<String> result = new ArrayList<String>();
- 		if (i<j)
-		{ 
- 			ArrayList<Integer> indices = new ArrayList<Integer>();
- 			indices.add(-1);
-			for (int k=i+1;k<=j;k++)
-			{
-				indices.add(k);
-			}
-			for (int k : indices)
- 			{
- 				if (k==-1)
- 				{
- 					if (tab[i][j] == tab[i+1][j])
- 					{
- 						for (String s:backtrack(tab, seq, i+1,j))
- 						{
- 							result.add("."+s);
- 						}
- 					}
- 				}
- 				else
- 				{
- 					if (canBasePair(seq.charAt(i),seq.charAt(k)))
- 					{
- 						double fact1 = 0;
- 						if (k>i+1)
- 						{
- 							fact1 = tab[i+1][k-1];
- 						}
- 						double fact2 = 0;
- 						if (k<j)
- 						{
- 							fact2 = tab[k+1][j];
- 						}
- 						if (tab[i][j]==basePairScore(seq.charAt(i),seq.charAt(k))+fact1+fact2)
- 						{ 
- 	 						for (String s1:backtrack(tab, seq, i+1,k-1))
- 	 						{
- 	 	 						for (String s2:backtrack(tab, seq, k+1,j))
- 	 	 						{
- 	 	 							result.add("("+s1+")"+s2);
- 	 	 						}
- 	 						}
- 						}
- 					}  					
- 				} 				
-			}
-		}
-		else if  (i==j)
-		{
-			result.add(".");
-		}
-		else 
-		{
-			result.add("");
-		}
- 		return result;
- 	}
- 	
- 	public BigInteger count(String seq)
- 	{
-		int n = seq.length();
-		
-		BigInteger[][] tab = new BigInteger[n][n];
-		for(int m=1;m<=n;m++)
-		{
-			for(int i=0;i<n-m+1;i++)
-			{
-				int j = i+m-1;
-				tab[i][j] = BigInteger.ZERO;
-				if (i<j)
-				{ 
-					tab[i][j] = tab[i][j].add(tab[i+1][j]); 
-					for (int k=i+1;k<=j;k++)
-					{
-						if (canBasePair(seq.charAt(i),seq.charAt(k)))
-						{
-							BigInteger fact1 = BigInteger.ONE;
-							if (k>i+1)
-							{
-								fact1 = tab[i+1][k-1];
-							}
-							BigInteger fact2 = BigInteger.ONE;
-							if (k<j)
-							{
-								fact2 = tab[k+1][j];
-							}
-							tab[i][j] = tab[i][j].add(fact1.multiply(fact2));
-						} 
-					}
-				}
-				else
-				{
-					tab[i][j] = BigInteger.ONE;
-				}
-			}			
-		}
- 		return tab[0][n-1];
- 	}
- 	
- 	private String _cache = "";
- 	ArrayList<String> _cacheStructs = new ArrayList<String>(); 
- 	
-	public ArrayList<String> getStructs() {
-		String seq = getSeq();
-		seq = seq.toUpperCase();
-		if (!_cache.equals(seq))
-		{
-			double[][] mfe = fillMatrix(seq);
-			_cacheStructs = backtrack(mfe,seq);
-			_cache = seq;
-		}
-		return _cacheStructs;
-	}
-
-	public VARNAPanel get_varnaPanel() {
-		return _vpMaster;
-	}
-
-	public void set_varnaPanel(VARNAPanel surface) {
-		_vpMaster = surface;
-	}
-
-
-	public JLabel get_info() {
-		return _actions;
-	}
-
-	public void set_info(JLabel _info) {
-		this._actions = _info;
-	}
-
-	public static void main(String[] args) {
-		NussinovDemo d = new NussinovDemo();
-		d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
-		d.pack();
-		d.setVisible(true);
-	}
-
-	public void onStructureRedrawn() {
-		_vpMaster.repaint();
-	}
-
-	public void onWarningEmitted(String s) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void onLoad(String path) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void onLoaded() {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void onUINewStructure(VARNAConfig v, RNA r) {
-		// TODO Auto-generated method stub
-		
-	}
-
-	static final String[] _bases =     {"A","C","G","U"};
-	static final String[] _basesComp = {"U","G","C","A"};
-	
-	public void onBaseClicked(ModeleBase mb, MouseEvent e) {
-	}
-	
-	public void onZoomLevelChanged() {
-		// TODO Auto-generated method stub
-		
-	}
-
-	public void onTranslationChanged() {
-		// TODO Auto-generated method stub
-		
-	}
-	private class InfoPanel extends JPanel
-	{
-		ArrayList<String> _sols = new ArrayList<String>();
-		BigInteger _nbFolds = BigInteger.ZERO;
-		JTextArea _text = new JTextArea("");
-		JTextArea _subopts = new JTextArea("");
-		JPanel _suboptBrowser = new JPanel();
-		JPanel _suboptCount = new JPanel();
-		int _selectedIndex = 0;
-		JButton next = new JButton(">");
-		JButton previous = new JButton("<");
-		
-		InfoPanel()
-		{
-			setLayout(new BorderLayout());
-			add(_suboptBrowser,BorderLayout.SOUTH);
-			add(_suboptCount,BorderLayout.NORTH);
-			
-			next.addActionListener(new ActionListener(){
-				public void actionPerformed(ActionEvent arg0) {
-					if (_sols.size()>0)
-					{
-						setSelectedIndex((_selectedIndex+1)%_sols.size());
-					}
-				}				
-			});
-
-			previous.addActionListener(new ActionListener(){
-				public void actionPerformed(ActionEvent arg0) {
-					if (_sols.size()>0)
-					{
-						setSelectedIndex((_selectedIndex+_sols.size()-1)%_sols.size());
-					}
-				}				
-			});
-			next.setEnabled(false);
-			previous.setEnabled(false);
-			
-
-			JLabel nbLab = new JLabel("#Repliements");
-			NussinovDemo.formatLabel(nbLab);
-
-			_suboptCount.setLayout(new BorderLayout());
-			_suboptCount.add(nbLab,BorderLayout.WEST);
-			_suboptCount.add(_text,BorderLayout.CENTER);
-
-			JLabel cooptlab = new JLabel("#Co-optimaux");
-			NussinovDemo.formatLabel(cooptlab);
-			
-			JPanel commands = new JPanel();
-			commands.add(previous);
-			commands.add(next);
-			
-			JPanel jp = new JPanel();
-			jp.setLayout(new BorderLayout());
-			jp.add(_subopts,BorderLayout.WEST);
-			jp.add(commands,BorderLayout.CENTER);
-
-			_suboptBrowser.setLayout(new BorderLayout());
-			_suboptBrowser.add(cooptlab,BorderLayout.WEST);
-			_suboptBrowser.add(jp,BorderLayout.CENTER);
-			
-			
-		}
-			
-				
-		public void setSelectedIndex(int i)
-		{
-			_selectedIndex = i;
-			RNA rfolded = new RNA();
-			try {
-				rfolded.setRNA(getSeq(), _sols.get(i));
-				rfolded.drawRNARadiate(_vpMaster.getConfig());
-				rfolded.setBaseNameColor(Color.white);
-				rfolded.setBaseOutlineColor(Color.white);
-				rfolded.setBaseNumbersColor(Color.white);
-				_vpMaster.setBaseNumbersColor(Color.white);
-				_vpMaster.setBaseOutlineColor(Color.white);
-				_vpMaster.setFillBases(false);
-				_vpMaster.setBaseNameColor(Color.white);
-				_vpMaster.showRNAInterpolated(rfolded);		        
-				
-			} catch (ExceptionUnmatchedClosingParentheses e) {
-				// TODO Auto-generated catch block
-				e.printStackTrace();
-			} catch (ExceptionFileFormatOrSyntax e) {
-				// TODO Auto-generated catch block
-				e.printStackTrace();
-			}
-			_struct.setText(_sols.get(i));
-			formatDescription();
-		}
-		
-		public void setFont(Font f)
-		{
-			super.setFont(f);
-			if(_text!=null)
-			{
-				_text.setFont(f);
-				_text.setOpaque(false);
-			}
-			if(_subopts!=null)
-			{
-			_subopts.setFont(f);
-			_subopts.setOpaque(false);
-			}
-		}
-		public void setInfo(ArrayList<String> sols, BigInteger nbFolds)
-		{
-			_sols = sols;
-			_nbFolds = nbFolds;
-			formatDescription();
-			setSelectedIndex(0);
-		}
-		
-		private void formatDescription()
-		{
-			_text.setText(""+_nbFolds);
-			_subopts.setText(""+_sols.size());
-			next.setEnabled(_sols.size()>1);
-			previous.setEnabled(_sols.size()>1);
-			
-		}
-		
-	}
-	
-}