X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Fio%2Fvcf%2FVCFLoaderTest.java;h=6ba6fbea371c3a1c96e502bbec52810ba3bf9ed2;hb=b53d89acfa678df63d6870176b4c7ec9285f52ee;hp=cdfe2988d31c03a7b58a3e21e7407b292974c524;hpb=4fa6faf64b0d16caffa71ac38506d473952478c5;p=jalview.git

diff --git a/test/jalview/io/vcf/VCFLoaderTest.java b/test/jalview/io/vcf/VCFLoaderTest.java
index cdfe298..6ba6fbe 100644
--- a/test/jalview/io/vcf/VCFLoaderTest.java
+++ b/test/jalview/io/vcf/VCFLoaderTest.java
@@ -1,14 +1,20 @@
 package jalview.io.vcf;
 
+import static jalview.io.gff.SequenceOntologyI.SEQUENCE_VARIANT;
 import static org.testng.Assert.assertEquals;
+import static org.testng.Assert.assertNull;
+import static org.testng.Assert.assertSame;
 
+import jalview.bin.Cache;
 import jalview.datamodel.AlignmentI;
 import jalview.datamodel.DBRefEntry;
-import jalview.datamodel.GeneLoci;
 import jalview.datamodel.Mapping;
 import jalview.datamodel.Sequence;
 import jalview.datamodel.SequenceFeature;
 import jalview.datamodel.SequenceI;
+import jalview.datamodel.features.FeatureAttributes;
+import jalview.datamodel.features.FeatureAttributes.Datatype;
+import jalview.datamodel.features.SequenceFeatures;
 import jalview.gui.AlignFrame;
 import jalview.io.DataSourceType;
 import jalview.io.FileLoader;
@@ -20,66 +26,145 @@ import java.io.File;
 import java.io.IOException;
 import java.io.PrintWriter;
 import java.util.List;
+import java.util.Map;
 
+import org.testng.annotations.BeforeClass;
+import org.testng.annotations.BeforeTest;
 import org.testng.annotations.Test;
 
 public class VCFLoaderTest
 {
-  // columns 9717- of gene P30419 from Ensembl (modified)
-  private static final String FASTA =
-  // forward strand 'gene'
-  ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
+  private static final float DELTA = 0.00001f;
+
+  // columns 9717- of gene P30419 from Ensembl (much modified)
+  private static final String FASTA = ""
+          +
+          /*
+           * forward strand 'gene' and 'transcript' with two exons
+           */
+          ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
           + "CAAGCTGGCGGACGAGAGTGTGACA\n"
-          // and a 'made up' mini-transcript with two exons
           + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
-          +
-          // 'reverse strand' gene (reverse complement)
-          ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
+
+          /*
+           * reverse strand gene and transcript (reverse complement alleles!)
+           */
+          + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
           + "TGTCACACTCTCGTCCGCCAGCTTG\n"
-          // and its 'transcript'
-          + ">transcript2/1-18\n"
-          + "-GTCACACTCT----CGCCAGCT--\n";
+          + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n"
+
+          /*
+           * 'gene' on chromosome 5 with two transcripts
+           */
+          + ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n"
+          + "CAAGCTGGCGGACGAGAGTGTGACA\n"
+          + ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
+          + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
 
   private static final String[] VCF = { "##fileformat=VCFv4.2",
+      // fields other than AF are ignored when parsing as they have no INFO definition
       "##INFO=<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency, for each ALT allele, in the same order as listed\">",
-      "##reference=GRCh38",
+      "##reference=Homo_sapiens/GRCh38",
       "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO",
-      // SNP A/T in position 2 of gene sequence (precedes transcript)
-      "17\t45051611\t.\tA\tT\t1666.64\tRF\tAC=15;AF=5.08130e-03",
+      // A/T,C variants in position 2 of gene sequence (precedes transcript)
+      // should create 2 variant features with respective AF values
+      "17\t45051611\t.\tA\tT,C\t1666.64\tRF\tAC=15;AF=5.0e-03,4.0e-03",
       // SNP G/C in position 4 of gene sequence, position 2 of transcript
-      // this is a mixed variant, the insertion G/GA is not transferred
-      "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.08130e-03" };
+      // insertion G/GA is transferred to nucleotide but not to peptide
+      "17\t45051613\t.\tG\tGA,C\t1666.65\tRF\tAC=15;AF=3.0e-03,2.0e-03",
+      // '.' in INFO field should be ignored
+      "17\t45051615\t.\tG\tC\t1666.66\tRF\tAC=16;AF=." };
+
+  @BeforeClass(alwaysRun = true)
+  public void setUp()
+  {
+    /*
+     * configure to capture all available VCF and VEP (CSQ) fields
+     */
+    Cache.loadProperties("test/jalview/io/testProps.jvprops");
+    Cache.setProperty("VCF_FIELDS", ".*");
+    Cache.setProperty("VEP_FIELDS", ".*");
+    Cache.setProperty("VCF_ASSEMBLY", "GRCh38=GRCh38");
+    Cache.initLogger();
+  }
+
+  @BeforeTest(alwaysRun = true)
+  public void setUpBeforeTest()
+  {
+    /*
+     * clear down feature attributes metadata
+     */
+    FeatureAttributes.getInstance().clear();
+  }
 
   @Test(groups = "Functional")
-  public void testLoadVCF() throws IOException
+  public void testDoLoad() throws IOException
   {
     AlignmentI al = buildAlignment();
-    VCFLoader loader = new VCFLoader(al);
 
-    File f = makeVcf();
+    File f = makeVcfFile();
+    VCFLoader loader = new VCFLoader(f.getPath());
 
-    loader.loadVCF(f.getPath(), null);
+    loader.doLoad(al.getSequencesArray(), null);
 
     /*
      * verify variant feature(s) added to gene
+     * NB alleles at a locus may not be processed, and features added,
+     * in the order in which they appear in the VCF record as method
+     * VariantContext.getAlternateAlleles() does not guarantee order
+     * - order of assertions here matches what we find (is not important) 
      */
     List<SequenceFeature> geneFeatures = al.getSequenceAt(0)
             .getSequenceFeatures();
-    assertEquals(geneFeatures.size(), 2);
+    SequenceFeatures.sortFeatures(geneFeatures, true);
+    assertEquals(geneFeatures.size(), 5);
     SequenceFeature sf = geneFeatures.get(0);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 2);
     assertEquals(sf.getEnd(), 2);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
-    assertEquals(sf.getScore(), 5.08130e-03, 0.000001f);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 4.0e-03,
+            DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C");
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    sf = geneFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 2);
+    assertEquals(sf.getEnd(), 2);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
+            DELTA);
     assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
 
-    sf = geneFeatures.get(1);
+    sf = geneFeatures.get(2);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 4);
     assertEquals(sf.getEnd(), 4);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
-    assertEquals(sf.getScore(), 3.08130e-03, 0.000001f);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
+            DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
+
+    sf = geneFeatures.get(3);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 4);
+    assertEquals(sf.getEnd(), 4);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
+            DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
+
+    sf = geneFeatures.get(4);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 6);
+    assertEquals(sf.getEnd(), 6);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    // AF=. should not have been captured
+    assertNull(sf.getValue("AF"));
     assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
 
     /*
@@ -87,32 +172,61 @@ public class VCFLoaderTest
      */
     List<SequenceFeature> transcriptFeatures = al.getSequenceAt(1)
             .getSequenceFeatures();
-    assertEquals(transcriptFeatures.size(), 1);
+    assertEquals(transcriptFeatures.size(), 3);
     sf = transcriptFeatures.get(0);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 2);
     assertEquals(sf.getEnd(), 2);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
-    assertEquals(sf.getScore(), 3.08130e-03, 0.000001f);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
+            DELTA);
     assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
+    sf = transcriptFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 2);
+    assertEquals(sf.getEnd(), 2);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
+            DELTA);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
 
     /*
-     * verify variant feature(s) computed and added to protein
+     * verify SNP variant feature(s) computed and added to protein
      * first codon AGC varies to ACC giving S/T
      */
-    SequenceI peptide = al.getSequenceAt(1)
-            .getDBRefs()[0].getMap().getTo();
+    DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs();
+    SequenceI peptide = null;
+    for (DBRefEntry dbref : dbRefs)
+    {
+      if (dbref.getMap().getMap().getFromRatio() == 3)
+      {
+        peptide = dbref.getMap().getTo();
+      }
+    }
     List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
-    assertEquals(proteinFeatures.size(), 1);
+    assertEquals(proteinFeatures.size(), 3);
     sf = proteinFeatures.get(0);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 1);
     assertEquals(sf.getEnd(), 1);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
     assertEquals(sf.getDescription(), "p.Ser1Thr");
+
+    /*
+     * check that sequence_variant attribute AF has been clocked as
+     * numeric with correct min and max values
+     * (i.e. invalid values have been ignored - JAL-3375)
+     */
+    FeatureAttributes fa = FeatureAttributes.getInstance();
+    assertSame(fa.getDatatype(SEQUENCE_VARIANT, "AF"), Datatype.Number);
+    float[] minmax = fa.getMinMax(SEQUENCE_VARIANT, "AF");
+    assertEquals(minmax[0], 0.002f);
+    assertEquals(minmax[1], 0.005f);
   }
 
-  private File makeVcf() throws IOException
+  private File makeVcfFile() throws IOException
   {
     File f = File.createTempFile("Test", ".vcf");
     f.deleteOnExit();
@@ -140,11 +254,11 @@ public class VCFLoaderTest
      * from Ensembl and transcripts computed)
      */
     AlignmentI alignment = af.getViewport().getAlignment();
-    SequenceI gene1 = alignment.getSequenceAt(0);
+    SequenceI gene1 = alignment.findName("gene1");
     int[] to = new int[] { 45051610, 45051634 };
     int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
-    gene1.setGeneLoci(new GeneLoci("human", "GRCh38", "17", new MapList(
-            from, to, 1, 1)));
+    gene1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
+            1, 1));
 
     /*
      * map 'transcript1' to chromosome via 'gene1'
@@ -152,19 +266,20 @@ public class VCFLoaderTest
      * which is chromosome 45051612-45051619,45051624-45051633
      */
     to = new int[] { 45051612, 45051619, 45051624, 45051633 };
-    SequenceI transcript1 = alignment.getSequenceAt(1);
+    SequenceI transcript1 = alignment.findName("transcript1");
     from = new int[] { transcript1.getStart(), transcript1.getEnd() };
-    transcript1.setGeneLoci(new GeneLoci("human", "GRCh38", "17",
-            new MapList(from, to, 1, 1)));
+    transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
+            from, to,
+            1, 1));
 
     /*
      * map gene2 to chromosome reverse strand
      */
-    SequenceI gene2 = alignment.getSequenceAt(2);
+    SequenceI gene2 = alignment.findName("gene2");
     to = new int[] { 45051634, 45051610 };
     from = new int[] { gene2.getStart(), gene2.getEnd() };
-    gene2.setGeneLoci(new GeneLoci("human", "GRCh38", "17", new MapList(
-            from, to, 1, 1)));
+    gene2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to,
+            1, 1));
 
     /*
      * map 'transcript2' to chromosome via 'gene2'
@@ -172,10 +287,11 @@ public class VCFLoaderTest
      * which is chromosome 45051633-45051624,45051619-45051612
      */
     to = new int[] { 45051633, 45051624, 45051619, 45051612 };
-    SequenceI transcript2 = alignment.getSequenceAt(3);
+    SequenceI transcript2 = alignment.findName("transcript2");
     from = new int[] { transcript2.getStart(), transcript2.getEnd() };
-    transcript2.setGeneLoci(new GeneLoci("human", "GRCh38", "17",
-            new MapList(from, to, 1, 1)));
+    transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(
+            from, to,
+            1, 1));
 
     /*
      * add a protein product as a DBRef on transcript1
@@ -196,6 +312,45 @@ public class VCFLoaderTest
     product = new DBRefEntry("", "", "ENSP002", map);
     transcript2.addDBRef(product);
 
+    /*
+     * map gene3 to chromosome 
+     */
+    SequenceI gene3 = alignment.findName("gene3");
+    to = new int[] { 45051610, 45051634 };
+    from = new int[] { gene3.getStart(), gene3.getEnd() };
+    gene3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(from, to,
+            1, 1));
+
+    /*
+     * map 'transcript3' to chromosome
+     */
+    SequenceI transcript3 = alignment.findName("transcript3");
+    to = new int[] { 45051612, 45051619, 45051624, 45051633 };
+    from = new int[] { transcript3.getStart(), transcript3.getEnd() };
+    transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
+            from, to,
+            1, 1));
+
+    /*
+     * map 'transcript4' to chromosome
+     */
+    SequenceI transcript4 = alignment.findName("transcript4");
+    to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
+        45051634 };
+    from = new int[] { transcript4.getStart(), transcript4.getEnd() };
+    transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(
+            from, to,
+            1, 1));
+
+    /*
+     * add a protein product as a DBRef on transcript3
+     */
+    SequenceI peptide3 = new Sequence("ENSP003", "SWRECD");
+    mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
+    map = new Mapping(peptide3, mapList);
+    product = new DBRefEntry("", "", "ENSP003", map);
+    transcript3.addDBRef(product);
+
     return alignment;
   }
 
@@ -207,69 +362,399 @@ public class VCFLoaderTest
    * @throws IOException
    */
   @Test(groups = "Functional")
-  public void testLoadVCF_reverseStrand() throws IOException
+  public void testDoLoad_reverseStrand() throws IOException
   {
     AlignmentI al = buildAlignment();
 
-    VCFLoader loader = new VCFLoader(al);
+    File f = makeVcfFile();
 
-    File f = makeVcf();
+    VCFLoader loader = new VCFLoader(f.getPath());
 
-    loader.loadVCF(f.getPath(), null);
+    loader.doLoad(al.getSequencesArray(), null);
 
     /*
      * verify variant feature(s) added to gene2
-     * gene/1-25 maps to chromosome 45051634- reverse strand
-     * variants A/T at 45051611 and G/C at 45051613 map to
-     * T/A and C/G at gene positions 24 and 22 respectively
+     * gene2/1-25 maps to chromosome 45051634- reverse strand
      */
     List<SequenceFeature> geneFeatures = al.getSequenceAt(2)
             .getSequenceFeatures();
-    assertEquals(geneFeatures.size(), 2);
-    SequenceFeature sf = geneFeatures.get(0);
+    SequenceFeatures.sortFeatures(geneFeatures, true);
+    assertEquals(geneFeatures.size(), 5);
+    SequenceFeature sf;
+
+    /*
+     * insertion G/GA at 45051613 maps to an insertion at
+     * the preceding position (21) on reverse strand gene
+     * reference: CAAGC -> GCTTG/21-25
+     * genomic variant: CAAGAC (G/GA)
+     * gene variant: GTCTTG (G/GT at 21)
+     */
+    sf = geneFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 21);
+    assertEquals(sf.getEnd(), 21);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
+            DELTA);
+
+    /*
+     * variant G/C at 45051613 maps to C/G at gene position 22
+     */
+    sf = geneFeatures.get(2);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 22);
     assertEquals(sf.getEnd(), 22);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
-    assertEquals(sf.getScore(), 3.08130e-03, 0.000001f);
-    assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES));
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
+            DELTA);
 
-    sf = geneFeatures.get(1);
+    /*
+     * variant A/C at 45051611 maps to T/G at gene position 24
+     */
+    sf = geneFeatures.get(3);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 24);
     assertEquals(sf.getEnd(), 24);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
-    assertEquals(sf.getScore(), 5.08130e-03, 0.000001f);
-    assertEquals("T,A", sf.getValue(Gff3Helper.ALLELES));
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G");
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 4.0e-03,
+            DELTA);
 
     /*
-     * verify variant feature(s) added to transcript2
-     * variant C/G at position 22 of gene overlaps and maps to
-     * position 17 of transcript
+     * variant A/T at 45051611 maps to T/A at gene position 24
+     */
+    sf = geneFeatures.get(4);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 24);
+    assertEquals(sf.getEnd(), 24);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A");
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
+            DELTA);
+
+    /*
+     * verify 3 variant features added to transcript2
      */
     List<SequenceFeature> transcriptFeatures = al.getSequenceAt(3)
             .getSequenceFeatures();
-    assertEquals(transcriptFeatures.size(), 1);
-    sf = transcriptFeatures.get(0);
+    assertEquals(transcriptFeatures.size(), 3);
+
+    /*
+     * insertion G/GT at position 21 of gene maps to position 16 of transcript
+     */
+    sf = transcriptFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 16);
+    assertEquals(sf.getEnd(), 16);
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
+            DELTA);
+
+    /*
+     * SNP C/G at position 22 of gene maps to position 17 of transcript
+     */
+    sf = transcriptFeatures.get(2);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 17);
     assertEquals(sf.getEnd(), 17);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
-    assertEquals(sf.getScore(), 3.08130e-03, 0.000001f);
-    assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES));
+    assertEquals(sf.getType(), SEQUENCE_VARIANT);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
+            DELTA);
 
     /*
      * verify variant feature(s) computed and added to protein
      * last codon GCT varies to GGT giving A/G in the last peptide position
      */
-    SequenceI peptide = al.getSequenceAt(3).getDBRefs()[0].getMap().getTo();
+    DBRefEntry[] dbRefs = al.getSequenceAt(3).getDBRefs();
+    SequenceI peptide = null;
+    for (DBRefEntry dbref : dbRefs)
+    {
+      if (dbref.getMap().getMap().getFromRatio() == 3)
+      {
+        peptide = dbref.getMap().getTo();
+      }
+    }
     List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
-    assertEquals(proteinFeatures.size(), 1);
+    assertEquals(proteinFeatures.size(), 3);
     sf = proteinFeatures.get(0);
     assertEquals(sf.getFeatureGroup(), "VCF");
     assertEquals(sf.getBegin(), 6);
     assertEquals(sf.getEnd(), 6);
-    assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT);
+    assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
     assertEquals(sf.getDescription(), "p.Ala6Gly");
   }
-}
+
+  /**
+   * Tests that if VEP consequence (CSQ) data is present in the VCF data, then
+   * it is added to the variant feature, but restricted where possible to the
+   * consequences for a specific transcript
+   * 
+   * @throws IOException
+   */
+  @Test(groups = "Functional")
+  public void testDoLoad_vepCsq() throws IOException
+  {
+    AlignmentI al = buildAlignment();
+
+    VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf.vcf");
+
+    /*
+     * VCF data file with variants at gene3 positions
+     * 1 C/A
+     * 5 C/T
+     * 9 CGT/C (deletion)
+     * 13 C/G, C/T
+     * 17 A/AC (insertion), A/G
+     */
+    loader.doLoad(al.getSequencesArray(), null);
+
+    /*
+     * verify variant feature(s) added to gene3
+     */
+    List<SequenceFeature> geneFeatures = al.findName("gene3")
+            .getSequenceFeatures();
+    SequenceFeatures.sortFeatures(geneFeatures, true);
+    assertEquals(geneFeatures.size(), 7);
+    SequenceFeature sf = geneFeatures.get(0);
+    assertEquals(sf.getBegin(), 1);
+    assertEquals(sf.getEnd(), 1);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.1f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,A");
+    // gene features include Consequence for all transcripts
+    Map map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    sf = geneFeatures.get(1);
+    assertEquals(sf.getBegin(), 5);
+    assertEquals(sf.getEnd(), 5);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,T");
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    sf = geneFeatures.get(2);
+    assertEquals(sf.getBegin(), 9);
+    assertEquals(sf.getEnd(), 11); // deletion over 3 positions
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.3f, DELTA);
+    assertEquals(sf.getValue("alleles"), "CGG,C");
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    sf = geneFeatures.get(3);
+    assertEquals(sf.getBegin(), 13);
+    assertEquals(sf.getEnd(), 13);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,T");
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    sf = geneFeatures.get(4);
+    assertEquals(sf.getBegin(), 13);
+    assertEquals(sf.getEnd(), 13);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,G");
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    sf = geneFeatures.get(5);
+    assertEquals(sf.getBegin(), 17);
+    assertEquals(sf.getEnd(), 17);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,G");
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    sf = geneFeatures.get(6);
+    assertEquals(sf.getBegin(), 17);
+    assertEquals(sf.getEnd(), 17); // insertion
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,AC");
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+
+    /*
+     * verify variant feature(s) added to transcript3
+     * at columns 5 (1), 17 (2), positions 3, 11
+     * note the deletion at columns 9-11 is not transferred since col 11
+     * has no mapping to transcript 3 
+     */
+    List<SequenceFeature> transcriptFeatures = al.findName("transcript3")
+            .getSequenceFeatures();
+    SequenceFeatures.sortFeatures(transcriptFeatures, true);
+    assertEquals(transcriptFeatures.size(), 3);
+    sf = transcriptFeatures.get(0);
+    assertEquals(sf.getBegin(), 3);
+    assertEquals(sf.getEnd(), 3);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,T");
+    // transcript features only have Consequence for that transcripts
+    map = (Map) sf.getValue("CSQ");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
+
+    sf = transcriptFeatures.get(1);
+    assertEquals(sf.getBegin(), 11);
+    assertEquals(sf.getEnd(), 11);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,G");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
+
+    sf = transcriptFeatures.get(2);
+    assertEquals(sf.getBegin(), 11);
+    assertEquals(sf.getEnd(), 11);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,AC");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
+
+    /*
+     * verify variants computed on protein product for transcript3
+     * peptide is SWRECD
+     * codon variants are AGC/AGT position 1 which is synonymous
+     * and GAG/GGG which is E/G in position 4
+     * the insertion variant is not transferred to the peptide
+     */
+    DBRefEntry[] dbRefs = al.findName("transcript3").getDBRefs();
+    SequenceI peptide = null;
+    for (DBRefEntry dbref : dbRefs)
+    {
+      if (dbref.getMap().getMap().getFromRatio() == 3)
+      {
+        peptide = dbref.getMap().getTo();
+      }
+    }
+    List<SequenceFeature> proteinFeatures = peptide.getSequenceFeatures();
+    SequenceFeatures.sortFeatures(proteinFeatures, true);
+    assertEquals(proteinFeatures.size(), 2);
+    sf = proteinFeatures.get(0);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 1);
+    assertEquals(sf.getEnd(), 1);
+    assertEquals(sf.getType(), SequenceOntologyI.SYNONYMOUS_VARIANT);
+    assertEquals(sf.getDescription(), "agC/agT");
+    sf = proteinFeatures.get(1);
+    assertEquals(sf.getFeatureGroup(), "VCF");
+    assertEquals(sf.getBegin(), 4);
+    assertEquals(sf.getEnd(), 4);
+    assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
+    assertEquals(sf.getDescription(), "p.Glu4Gly");
+
+    /*
+     * verify variant feature(s) added to transcript4
+     * at columns 13 (2) and 17 (2), positions 7 and 11
+     */
+    transcriptFeatures = al.findName("transcript4").getSequenceFeatures();
+    SequenceFeatures.sortFeatures(transcriptFeatures, true);
+    assertEquals(transcriptFeatures.size(), 4);
+    sf = transcriptFeatures.get(0);
+    assertEquals(sf.getBegin(), 7);
+    assertEquals(sf.getEnd(), 7);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,T");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
+
+    sf = transcriptFeatures.get(1);
+    assertEquals(sf.getBegin(), 7);
+    assertEquals(sf.getEnd(), 7);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA);
+    assertEquals(sf.getValue("alleles"), "C,G");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
+
+    sf = transcriptFeatures.get(2);
+    assertEquals(sf.getBegin(), 11);
+    assertEquals(sf.getEnd(), 11);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,G");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
+
+    sf = transcriptFeatures.get(3);
+    assertEquals(sf.getBegin(), 11);
+    assertEquals(sf.getEnd(), 11);
+    assertEquals(sf.getScore(), 0f);
+    assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
+    assertEquals(sf.getValue("alleles"), "A,AC");
+    assertEquals(map.size(), 9);
+    assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
+  }
+
+  /**
+   * A test that demonstrates loading a contig sequence from an indexed sequence
+   * database which is the reference for a VCF file
+   * 
+   * @throws IOException
+   */
+  @Test(groups = "Functional")
+  public void testLoadVCFContig() throws IOException
+  {
+    VCFLoader loader = new VCFLoader(
+            "test/jalview/io/vcf/testVcf2.vcf");
+
+    SequenceI seq = loader.loadVCFContig("contig123");
+    assertEquals(seq.getLength(), 15);
+    assertEquals(seq.getSequenceAsString(), "AAAAACCCCCGGGGG");
+    List<SequenceFeature> features = seq.getSequenceFeatures();
+    SequenceFeatures.sortFeatures(features, true);
+    assertEquals(features.size(), 2);
+    SequenceFeature sf = features.get(0);
+    assertEquals(sf.getBegin(), 8);
+    assertEquals(sf.getEnd(), 8);
+    assertEquals(sf.getDescription(), "C,A");
+    sf = features.get(1);
+    assertEquals(sf.getBegin(), 12);
+    assertEquals(sf.getEnd(), 12);
+    assertEquals(sf.getDescription(), "G,T");
+
+    seq = loader.loadVCFContig("contig789");
+    assertEquals(seq.getLength(), 25);
+    assertEquals(seq.getSequenceAsString(), "GGGGGTTTTTAAAAACCCCCGGGGG");
+    features = seq.getSequenceFeatures();
+    SequenceFeatures.sortFeatures(features, true);
+    assertEquals(features.size(), 2);
+    sf = features.get(0);
+    assertEquals(sf.getBegin(), 2);
+    assertEquals(sf.getEnd(), 2);
+    assertEquals(sf.getDescription(), "G,T");
+    sf = features.get(1);
+    assertEquals(sf.getBegin(), 21);
+    assertEquals(sf.getEnd(), 21);
+    assertEquals(sf.getDescription(), "G,A");
+
+    seq = loader.loadVCFContig("contig456");
+    assertEquals(seq.getLength(), 20);
+    assertEquals(seq.getSequenceAsString(), "CCCCCGGGGGTTTTTAAAAA");
+    features = seq.getSequenceFeatures();
+    SequenceFeatures.sortFeatures(features, true);
+    assertEquals(features.size(), 1);
+    sf = features.get(0);
+    assertEquals(sf.getBegin(), 15);
+    assertEquals(sf.getEnd(), 15);
+    assertEquals(sf.getDescription(), "T,C");
+  }
+}
\ No newline at end of file