X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Fws%2Fdbsources%2FEmblXmlSourceTest.java;fp=test%2Fjalview%2Fws%2Fdbsources%2FEmblSourceTest.java;h=a0991e546ed05edcd310088bfc89b813629f88be;hb=fe3cd724aecdeb06a130a502ce3a967ad643f458;hp=5bf215c74f13cdc9a5e39da0fca65e2b59315c06;hpb=0f8122860073f97741093ded66a4938a4082408d;p=jalview.git

diff --git a/test/jalview/ws/dbsources/EmblSourceTest.java b/test/jalview/ws/dbsources/EmblXmlSourceTest.java
similarity index 93%
rename from test/jalview/ws/dbsources/EmblSourceTest.java
rename to test/jalview/ws/dbsources/EmblXmlSourceTest.java
index 5bf215c..a0991e5 100644
--- a/test/jalview/ws/dbsources/EmblSourceTest.java
+++ b/test/jalview/ws/dbsources/EmblXmlSourceTest.java
@@ -26,6 +26,7 @@ import static org.testng.AssertJUnit.assertNull;
 import static org.testng.AssertJUnit.assertSame;
 import static org.testng.AssertJUnit.assertTrue;
 
+import jalview.datamodel.AlignmentI;
 import jalview.datamodel.DBRefEntry;
 import jalview.datamodel.DBRefSource;
 import jalview.datamodel.SequenceI;
@@ -40,9 +41,10 @@ import java.util.ArrayList;
 import java.util.Arrays;
 import java.util.List;
 
+import org.testng.annotations.BeforeClass;
 import org.testng.annotations.Test;
 
-public class EmblSourceTest
+public class EmblXmlSourceTest
 {
 
   // adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml
@@ -95,16 +97,49 @@ public class EmblSourceTest
           + "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT"
           + "</sequence></entry></ROOT>";
 
+  private EmblXmlSource testee;
+
+  @BeforeClass(alwaysRun = true)
+  public void setUp()
+  {
+    testee = new EmblXmlSource()
+    {
+
+      @Override
+      public String getDbSource()
+      {
+        return null;
+      }
+
+      @Override
+      public String getDbName()
+      {
+        return null;
+      }
+
+      @Override
+      public String getTestQuery()
+      {
+        return null;
+      }
+
+      @Override
+      public AlignmentI getSequenceRecords(String queries) throws Exception
+      {
+        return null;
+      }
+    };
+  }
+
   @Test(groups = "Functional")
   public void testGetCdsRanges()
   {
-    EmblSource testee = new EmblSource();
-
     /*
      * Make a (CDS) Feature with 5 locations
      */
     Feature cds = new Feature();
-    cds.setLocation("join(10..20,complement(30..40),50..60,70..80,complement(110..120))");
+    cds.setLocation(
+            "join(10..20,complement(30..40),50..60,70..80,complement(110..120))");
 
     int[] exons = testee.getCdsRanges("EMBL", cds);
     assertEquals("[10, 20, 40, 30, 50, 60, 70, 80, 120, 110]",
@@ -116,10 +151,9 @@ public class EmblSourceTest
   {
     // not the whole sequence but enough for this test...
     List<SequenceI> peptides = new ArrayList<>();
-    List<EntryType> entries = EmblSourceTest.getEmblEntries();
+    List<EntryType> entries = getEmblEntries();
     assertEquals(1, entries.size());
     EntryType entry = entries.get(0);
-    EmblSource testee = new EmblSource();
     String sourceDb = "EMBL";
     SequenceI dna = testee.getSequence(sourceDb, entry, peptides);
 
@@ -165,8 +199,9 @@ public class EmblSourceTest
             3, 1);
     MapList cds2Map = new MapList(new int[] { 4, 15 }, new int[] { 1, 4 },
             3, 1);
-    MapList cds3Map = new MapList(new int[] { 4, 6, 10, 15 }, new int[] {
-        1, 3 }, 3, 1);
+    MapList cds3Map = new MapList(new int[] { 4, 6, 10, 15 },
+            new int[]
+            { 1, 3 }, 3, 1);
 
     List<DBRefEntry> dbrefs = dna.getDBRefs();
     assertEquals(7, dbrefs.size());
@@ -222,10 +257,12 @@ public class EmblSourceTest
      * - to EMBLCDS (with 1:3 mapping)
      * - direct (no mapping) to other protein accessions
      */
-    MapList proteinToCdsMap1 = new MapList(new int[] { 1, 4 }, new int[] {
-        1, 12 }, 1, 3);
-    MapList proteinToCdsMap2 = new MapList(new int[] { 1, 3 }, new int[] {
-        1, 9 }, 1, 3);
+    MapList proteinToCdsMap1 = new MapList(new int[] { 1, 4 },
+            new int[]
+            { 1, 12 }, 1, 3);
+    MapList proteinToCdsMap2 = new MapList(new int[] { 1, 3 },
+            new int[]
+            { 1, 9 }, 1, 3);
 
     // dbrefs for first CDS EMBL product CAA30420.1
     dbrefs = peptides.get(0).getDBRefs();
@@ -339,10 +376,10 @@ public class EmblSourceTest
   @Test(groups = { "Functional" })
   public void testGetEmblEntries()
   {
-    List<EntryType> entries = EmblSourceTest.getEmblEntries();
+    List<EntryType> entries = getEmblEntries();
     assertEquals(1, entries.size());
     EntryType entry = entries.get(0);
-  
+
     assertEquals("X07547", entry.getAccession());
     assertEquals("C. trachomatis plasmid", entry.getDescription());
     assertEquals("STD", entry.getDataClass());
@@ -359,7 +396,7 @@ public class EmblSourceTest
     assertEquals(2, entry.getKeyword().size());
     assertEquals("plasmid", entry.getKeyword().get(0));
     assertEquals("unidentified reading frame", entry.getKeyword().get(1));
-  
+
     /*
      * dbrefs
      */
@@ -372,7 +409,7 @@ public class EmblSourceTest
     assertEquals("MD5", dbref.getDb());
     assertEquals("ac73317", dbref.getId());
     assertNull(dbref.getSecondaryId());
-  
+
     /*
      * three sequence features for CDS
      */
@@ -403,7 +440,7 @@ public class EmblSourceTest
     q = ef.getQualifier().get(2);
     assertEquals("translation", q.getName());
     assertEquals("MLCF", q.getValue());
-  
+
     /*
      * second CDS
      */
@@ -422,7 +459,7 @@ public class EmblSourceTest
     q = ef.getQualifier().get(1);
     assertEquals("translation", q.getName());
     assertEquals("MSSS", q.getValue());
-  
+
     /*
      * third CDS
      */
@@ -438,16 +475,14 @@ public class EmblSourceTest
     q = ef.getQualifier().get(1);
     assertEquals("translation", q.getName());
     assertEquals("MSS", q.getValue());
-  
+
     /*
      * Sequence - raw data before removal of newlines
      */
     String seq = entry.getSequence();
-    assertEquals(
-            "GGTATGTCCTCTAGTACAAAC\n"
-                    + "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT",
-            seq);
-  
+    assertEquals("GGTATGTCCTCTAGTACAAAC\n"
+            + "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT", seq);
+
     /*
      * getSequence() converts empty DBRefEntry.version to "0"
      */
@@ -455,9 +490,9 @@ public class EmblSourceTest
     assertNull(entry.getFeature().get(0).getXref().get(1).getSecondaryId());
   }
 
-  static List<EntryType> getEmblEntries()
+  List<EntryType> getEmblEntries()
   {
-    return new EmblSource()
+    return testee
             .getEmblEntries(new ByteArrayInputStream(TESTDATA.getBytes()));
   }
 }