X-Git-Url: http://source.jalview.org/gitweb/?p=jalview.git;a=blobdiff_plain;f=test%2Fjalview%2Fdatamodel%2Fxdb%2Fembl%2FEmblTestHelper.java;fp=test%2Fjalview%2Fdatamodel%2Fxdb%2Fembl%2FEmblTestHelper.java;h=0000000000000000000000000000000000000000;hp=0c7624f4b583a75b446176ed5cfd093328de63fa;hb=181cd6607ecd631aa5972582ff1d99c5bea75b23;hpb=c2763e1b13c4796b29b9d4c6deca52a769b42f79
diff --git a/test/jalview/datamodel/xdb/embl/EmblTestHelper.java b/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
deleted file mode 100644
index 0c7624f..0000000
--- a/test/jalview/datamodel/xdb/embl/EmblTestHelper.java
+++ /dev/null
@@ -1,81 +0,0 @@
-/*
- * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
- * Copyright (C) $$Year-Rel$$ The Jalview Authors
- *
- * This file is part of Jalview.
- *
- * Jalview is free software: you can redistribute it and/or
- * modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3
- * of the License, or (at your option) any later version.
- *
- * Jalview is distributed in the hope that it will be useful, but
- * WITHOUT ANY WARRANTY; without even the implied warranty
- * of MERCHANTABILITY or FITNESS FOR A PARTICULAR
- * PURPOSE. See the GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Jalview. If not, see .
- * The Jalview Authors are detailed in the 'AUTHORS' file.
- */
-package jalview.datamodel.xdb.embl;
-
-import java.io.StringReader;
-
-public class EmblTestHelper
-{
- // adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml
- // dna and translations truncated for convenience
- private static final String TESTDATA = ""
- + ""
- + ""
- + "X07574"
- + "C. trachomatis plasmid"
- + "plasmidunidentified reading frame"
- + ""
- + ""
- /*
- * first CDS (range and translation changed to keep test data manageable)
- */
- + ""
- // test the case of >1 cross-ref to the same database (JAL-2029)
- + ""
- + ""
- + "ORF 8 (AA 1-330)pickle"
- + "CAA30420.1"
- + "MLCFKeith"
- + ""
- /*
- * second CDS (range and translation changed to keep test data manageable)
- */
- + ""
- + ""
- + "CAA30421.1"
- + "MSSS"
- + ""
- /*
- * third CDS is made up - has no xref - code should synthesize
- * one to an assumed EMBLCDSPROTEIN accession
- */
- + ""
- + "CAA12345.6"
- + "MSS"
- + ""
- /*
- * sequence (modified for test purposes)
- * emulates EMBL XML 1.2 which splits sequence data every 60 characters
- * see EmblSequence.setSequence
- */
- + "GGTATGTCCTCTAGTACAAAC\n"
- + "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT"
- + "";
-
- static EmblFile getEmblFile()
- {
- return EmblFile.getEmblFile(new StringReader(TESTDATA));
- }
-}