JAL-3806 fix and test for one-to-many sequence mapping case

diff --git a/src/jalview/util/MappingUtils.java b/src/jalview/util/MappingUtils.java
index 177c54d..c9113ae 100644 (file)
--- a/src/jalview/util/MappingUtils.java
+++ b/src/jalview/util/MappingUtils.java
@@ -408,7 +408,6 @@ public final class MappingUtils
           int mappedEndCol = seq.findIndex(mappedEndResidue) - 1;
           maxEndCol = maxEndCol == -1 ? mappedEndCol
                   : Math.max(maxEndCol, mappedEndCol);
-          break;
         }
       }
     }

diff --git a/test/jalview/util/MappingUtilsTest.java b/test/jalview/util/MappingUtilsTest.java
index 08673ae..204d803 100644 (file)
--- a/test/jalview/util/MappingUtilsTest.java
+++ b/test/jalview/util/MappingUtilsTest.java
@@ -67,7 +67,7 @@ public class MappingUtilsTest
   {
     Cache.initLogger();
   }
-  
+
   @BeforeClass(alwaysRun = true)
   public void setUpJvOptionPane()
   {
@@ -277,7 +277,8 @@ public class MappingUtilsTest
     sg.addSequence(cdna.getSequenceAt(0), false);
     sg.setStartRes(0);
     sg.setEndRes(2);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, theProteinView);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
+            theProteinView);
     assertTrue(mappedGroup.getColourText());
     assertSame(sg.getIdColour(), mappedGroup.getIdColour());
     assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
@@ -573,7 +574,8 @@ public class MappingUtilsTest
     // select columns 2 and 3 in DNA which span protein columns 0 and 1
     sg.setStartRes(2);
     sg.setEndRes(3);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, theProteinView);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
+            theProteinView);
     assertTrue(mappedGroup.getColourText());
     assertSame(sg.getIdColour(), mappedGroup.getIdColour());
     assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
@@ -656,7 +658,8 @@ public class MappingUtilsTest
      */
     sg.setStartRes(2);
     sg.setEndRes(4);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theProteinView, theDnaView);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theProteinView,
+            theDnaView);
     assertEquals(1, mappedGroup.getStartRes());
     assertEquals(13, mappedGroup.getEndRes());
 
@@ -669,19 +672,22 @@ public class MappingUtilsTest
     // select columns 4,5 - includes Seq1:codon2 (A) only
     sg.setStartRes(4);
     sg.setEndRes(5);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, theProteinView);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
+            theProteinView);
     assertEquals(2, mappedGroup.getStartRes());
     assertEquals(2, mappedGroup.getEndRes());
 
     // add Seq2 to dna selection cols 4-5 include codons 1 and 2 (LQ)
     sg.addSequence(cdna.getSequenceAt(1), false);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, theProteinView);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
+            theProteinView);
     assertEquals(2, mappedGroup.getStartRes());
     assertEquals(4, mappedGroup.getEndRes());
 
     // add Seq3 to dna selection cols 4-5 include codon 1 (Q)
     sg.addSequence(cdna.getSequenceAt(2), false);
-    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, theProteinView);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
+            theProteinView);
     assertEquals(0, mappedGroup.getStartRes());
     assertEquals(4, mappedGroup.getEndRes());
   }
@@ -1330,20 +1336,20 @@ public class MappingUtilsTest
     assertEquals(1, ranges.size());
     assertEquals(9, ranges.get(0)[1]);
   }
-  
+
   @Test(groups = "Functional")
   public void testListToArray()
   {
     List<int[]> ranges = new ArrayList<>();
-    
+
     int[] result = MappingUtils.listToArray(ranges);
     assertEquals(result.length, 0);
-    ranges.add(new int[] {24, 12});
+    ranges.add(new int[] { 24, 12 });
     result = MappingUtils.listToArray(ranges);
     assertEquals(result.length, 2);
     assertEquals(result[0], 24);
     assertEquals(result[1], 12);
-    ranges.add(new int[] {-7, 30});
+    ranges.add(new int[] { -7, 30 });
     result = MappingUtils.listToArray(ranges);
     assertEquals(result.length, 4);
     assertEquals(result[0], 24);
@@ -1364,7 +1370,9 @@ public class MappingUtilsTest
    * Test mapping a sequence group where sequences in and outside the group
    * share a dataset sequence (e.g. alternative CDS for the same gene)
    * <p>
-   * This scenario doesn't arise after JAL-3763 changes, but test left as still valid
+   * This scenario doesn't arise after JAL-3763 changes, but test left as still
+   * valid
+   * 
    * @throws IOException
    */
   @Test(groups = { "Functional" })
@@ -1465,17 +1473,100 @@ public class MappingUtilsTest
   public void testFindOverlap()
   {
     List<int[]> ranges = new ArrayList<>();
-    ranges.add(new int[] {4, 8});
-    ranges.add(new int[] {10, 12});
-    ranges.add(new int[] {16, 19});
-    
-    int[] overlap = MappingUtils.findOverlap(ranges, 5,  13);
-    assertArrayEquals(overlap, new int[] {5, 12});
+    ranges.add(new int[] { 4, 8 });
+    ranges.add(new int[] { 10, 12 });
+    ranges.add(new int[] { 16, 19 });
+
+    int[] overlap = MappingUtils.findOverlap(ranges, 5, 13);
+    assertArrayEquals(overlap, new int[] { 5, 12 });
     overlap = MappingUtils.findOverlap(ranges, -100, 100);
-    assertArrayEquals(overlap, new int[] {4, 19});
+    assertArrayEquals(overlap, new int[] { 4, 19 });
     overlap = MappingUtils.findOverlap(ranges, 7, 17);
-    assertArrayEquals(overlap, new int[] {7, 17});
+    assertArrayEquals(overlap, new int[] { 7, 17 });
     overlap = MappingUtils.findOverlap(ranges, 13, 15);
     assertNull(overlap);
   }
+
+  /**
+   * Test mapping a sequence group including a sequence which maps to more than
+   * one other sequence
+   * 
+   * @throws IOException
+   */
+  @Test(groups = { "Functional" })
+  public void testMapSequenceGroup_oneToMany() throws IOException
+  {
+    /*
+     * Uniprot:FER2_ARATH has cross-refs to 10 EMBLCDS sequences;
+     * we'll just mimic 3 of them here (abbreviated)
+     * From EMBLCDS|BAE98526 [ [1, 444] ] 3:1 to [ [1, 148] ] FER2_ARATH
+     * From EMBLCDS|AAM91336 same
+     * From EMBLCDS|AAM13033 same
+     */
+    String coding = "atggcttccactgctctctca";
+    AlignmentI cds = loadAlignment(">BAE98526\n" + coding + "\n>AAM91336\n"
+            + coding + "\n>AAM13033\n" + coding + "\n",
+            FileFormat.Fasta);
+    cds.setDataset(null);
+    AlignmentI protein = loadAlignment(">FER2_ARATH\nMASTALS\n",
+            FileFormat.Fasta);
+    protein.setDataset(null);
+    AlignedCodonFrame acf = new AlignedCodonFrame();
+    MapList map = new MapList(new int[] { 1, 21 }, new int[] { 1, 7 }, 3, 1);
+    for (int seq = 0; seq < 3; seq++)
+    {
+      acf.addMap(cds.getSequenceAt(seq).getDatasetSequence(),
+              protein.getSequenceAt(0).getDatasetSequence(), map);
+    }
+    List<AlignedCodonFrame> acfList = Arrays
+            .asList(new AlignedCodonFrame[]
+            { acf });
+
+    AlignViewportI theDnaView = new AlignViewport(cds);
+    AlignViewportI theProteinView = new AlignViewport(protein);
+    protein.setCodonFrames(acfList);
+
+    /*
+     * Select FER2_ARATH in the protein
+     */
+    SequenceGroup sg = new SequenceGroup();
+    sg.setColourText(true);
+    sg.setIdColour(Color.GREEN);
+    sg.setOutlineColour(Color.LIGHT_GRAY);
+    sg.addSequence(protein.getSequenceAt(0), false);
+    sg.setEndRes(protein.getWidth() - 1);
+
+    /*
+     * Verify the mapped sequence group in dna
+     */
+    SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg,
+            theProteinView, theDnaView);
+    assertTrue(mappedGroup.getColourText());
+    assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+    assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+    assertEquals(3, mappedGroup.getSequences().size());
+    assertSame(cds.getSequenceAt(0), mappedGroup.getSequences().get(0));
+    assertSame(cds.getSequenceAt(1), mappedGroup.getSequences().get(1));
+    assertSame(cds.getSequenceAt(2), mappedGroup.getSequences().get(2));
+    assertEquals(0, mappedGroup.getStartRes());
+    assertEquals(20, mappedGroup.getEndRes()); // 21 columns (7 codons)
+
+    /*
+     * Select 2 CDS, verify peptide is mapped
+     */
+    sg.clear();
+    sg.addSequence(cds.getSequenceAt(1), false);
+    sg.addSequence(cds.getSequenceAt(0), false);
+    sg.setStartRes(0);
+    sg.setEndRes(20);
+    mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView,
+            theProteinView);
+    assertTrue(mappedGroup.getColourText());
+    assertSame(sg.getIdColour(), mappedGroup.getIdColour());
+    assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour());
+    assertEquals(1, mappedGroup.getSequences().size());
+    assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(0));
+    assertEquals(0, mappedGroup.getStartRes());
+    assertEquals(6, mappedGroup.getEndRes());
+  }
 }