From: Jim Procter Date: Wed, 5 Oct 2016 15:52:19 +0000 (+0100) Subject: JAL-2189 format help X-Git-Tag: Release_2_10_0~9^2~4 X-Git-Url: http://source.jalview.org/gitweb/?p=jalview.git;a=commitdiff_plain;h=dde303bc73617ab4eb3e681e67cf899e6a971318 JAL-2189 format help --- diff --git a/help/html/calculations/consensus.html b/help/html/calculations/consensus.html index 2ade2e0..c1b276d 100644 --- a/help/html/calculations/consensus.html +++ b/help/html/calculations/consensus.html @@ -55,10 +55,12 @@ Normalise Consensus Logo to scale all columns of the logo to the same height. -

- Group Consensus
- If sequence groups have been defined, then selecting option 'Group Consensus' in the Annotations menu will - result in Consensus being calculated for each group, as well as the alignment as a whole. +

+ Group Consensus
If sequence groups have + been defined, then selecting option 'Group Consensus' in the Annotations menu will + result in Consensus being calculated for each group, as well as the + alignment as a whole.

cDNA Consensus diff --git a/help/html/calculations/conservation.html b/help/html/calculations/conservation.html index 9cb8ce1..4535525 100755 --- a/help/html/calculations/conservation.html +++ b/help/html/calculations/conservation.html @@ -40,8 +40,8 @@ 9 No. 6 (745-756)). View an HTML version of the paper + href="http://www.compbio.dundee.ac.uk/papers/amas/amas3d.html">View + an HTML version of the paper

Conservation is measured as a numerical index reflecting the @@ -68,13 +68,15 @@ Colouring an alignment by conservation
Conservation scores can be used to colour an alignment. This is explained further in the help page for conservation colouring. + href="../colourSchemes/conservation.html">conservation + colouring.

- Group conservation
- If sequence groups have been defined, then selecting option 'Group Conservation' in the Annotations menu will - result in Conservation being calculated for each group, as well as the alignment as a whole. + Group conservation
If sequence groups have + been defined, then selecting option 'Group Conservation' in the Annotations menu will + result in Conservation being calculated for each group, as well as + the alignment as a whole.

diff --git a/help/html/calculations/pca.html b/help/html/calculations/pca.html index 071a2b5..c38d9ac 100755 --- a/help/html/calculations/pca.html +++ b/help/html/calculations/pca.html @@ -58,15 +58,15 @@ pair of sequences - computed with one of the available score matrices, such as BLOSUM62, PAM250, or the simple single nucleotide substitution matrix. The options - available for calculation are given in the Change + href="scorematrices.html#simplenucleotide">simple single + nucleotide substitution matrix. The options available for + calculation are given in the Change Parameters menu.

- PCA Calculation modes
The default Jalview calculation - mode (indicated when Jalview PCA - Calculation is ticked in the Change + PCA Calculation modes
The default Jalview + calculation mode (indicated when Jalview + PCA Calculation is ticked in the Change Parameters menu) is to perform a PCA on a matrix where elements in the upper diagonal give the sum of scores for mutating in one direction, and the lower diagonal is the sum of scores for mutating @@ -74,10 +74,10 @@ gives an asymmetric matrix, and a different PCA to a matrix produced with the method described in the paper by G. Casari, C. Sander and A. Valencia. Structural Biology volume 2, no. 2, February 1995 (pubmed) and implemented at the SeqSpace server at the EBI. This - method preconditions the matrix by multiplying it with its - transpose, and can be employed in the PCA viewer by unchecking the Jalview + href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=7749921">pubmed) + and implemented at the SeqSpace server at the EBI. This method + preconditions the matrix by multiplying it with its transpose, and + can be employed in the PCA viewer by unchecking the Jalview PCA Calculation option in the Change Parameters menu.
diff --git a/help/html/calculations/redundancy.html b/help/html/calculations/redundancy.html index 94cbc65..5b1badb 100755 --- a/help/html/calculations/redundancy.html +++ b/help/html/calculations/redundancy.html @@ -31,10 +31,10 @@ menu or pressing 'CONTROL+D' brings up a dialog box asking you to select a threshold. If the percentage identity between the aligned positions of any two sequences in the visible alignment - exceeds this value, the shorter sequence is discarded.
- Note: The redundancy calculation is done when the dialog - box is opened. For large numbers of sequences this can take a long - time as all pairs have to be compared. + exceeds this value, the shorter sequence is discarded.
Note: + The redundancy calculation is done when the dialog box is opened. + For large numbers of sequences this can take a long time as all + pairs have to be compared.
diff --git a/help/html/calculations/referenceseq.html b/help/html/calculations/referenceseq.html index 912be55..a79541b 100644 --- a/help/html/calculations/referenceseq.html +++ b/help/html/calculations/referenceseq.html @@ -31,12 +31,11 @@ organisms that are similar to a newly sequenced gene, or when searching for structurally similar sequences for use in homology modelling.
-
+
What happens when a reference sequence is defined ?
-
- The reference sequence for an alignment is indicated by its ID being - shown in bold. In addition:
+
The reference sequence for an alignment is indicated by its ID + being shown in bold. In addition:

Reference sequence numbering. Instead of column numbers, the alignment ruler shows the reference sequence @@ -61,8 +60,8 @@ sequence when importing analysis results, such as those returned from JPred4 . A reference sequence can also be assigned via the SET_REF command in - an alignment annotation file.
+ href="../features/annotationsFormat.html#refsandviews">SET_REF + command in an alignment annotation file.

Reference sequence based alignment visualisation was diff --git a/help/html/calculations/scorematrices.html b/help/html/calculations/scorematrices.html index f6bffb0..5fbbc19 100644 --- a/help/html/calculations/scorematrices.html +++ b/help/html/calculations/scorematrices.html @@ -33,7 +33,8 @@ matrix, and (since 2.8.1) is available for Tree and PCA calculations.
Simple Nucleotide - Substitution is a (fairly) arbitrary DNA/RNA substitution matrix.
+ Substitution is a (fairly) arbitrary DNA/RNA substitution + matrix. @@ -721,9 +722,10 @@ PAM250
Percentage Accepted Mutation matrix. PAM250 estimates substitutions after 250% of sites have changed (each - site can be mutated multple times).
Jalview 2.8.1 introduced - support for PAM250 based PCA - and tree calculations. + site can be mutated multple times).
Jalview 2.8.1 + introduced support for PAM250 based PCA and tree calculations. @@ -1559,8 +1561,8 @@

This nucleotide matrix was introduced in Jalview 2.8. If you'd like to improve it - please take a look at Issue JAL-1027 - introduce a nucleotide substitution matrix that + href="http://issues.jalview.org/browse/JAL-1027">Issue + JAL-1027 - introduce a nucleotide substitution matrix that supports RNA/DNA and ambiguity codes
diff --git a/help/html/calculations/sorting.html b/help/html/calculations/sorting.html index afee753..aeb461a 100755 --- a/help/html/calculations/sorting.html +++ b/help/html/calculations/sorting.html @@ -75,27 +75,28 @@

This menu appears if the alignment contains any sequence associated alignment annotation with associated - score values. Each entry is the label for a distinct group of - sequence associated annotation scores which can be used for - sorting. + href="../features/annotationsFormat.html">sequence + associated alignment annotation with associated score values. + Each entry is the label for a distinct group of sequence + associated annotation scores which can be used for sorting.
-
Sorting according to sequence features
- Additional sort operations for - alignments containing sequence features are provided in the - Feature +
+ Sorting according to sequence features
+ Additional sort operations for alignments containing sequence + features are provided in the Feature Settings dialog, opened via View→Feature - Settings...
+ Settings... +
Reversing the Order

Selecting any item from the Sort menu will sort sequences in an ascending order according to the property defining the sort. If the same sort is re-applied, the sequences will be sorted in the inverse - order. In both cases, for sequences which are equivalent under the sort - operation, their order will be preserved (since version 2.10). In - the case of trees and alignment orderings, Jalview will remember + order. In both cases, for sequences which are equivalent under the + sort operation, their order will be preserved (since version 2.10). + In the case of trees and alignment orderings, Jalview will remember your last choice for sorting the alignment and only apply the inverse ordering if you select the same tree or alignment ordering item again.
diff --git a/help/html/calculations/structureconsensus.html b/help/html/calculations/structureconsensus.html index c194a53..fd47dc0 100755 --- a/help/html/calculations/structureconsensus.html +++ b/help/html/calculations/structureconsensus.html @@ -27,12 +27,13 @@ Alignment RNA Structure Consensus Annotation
-
The RNA structure consensus displayed below the alignment gives the - percentage of valid base pairs per column for the first secondary - structure annotation shown on the annotation panel. These values are - shown as a histogram labeled "StrucConsensus", where a - symbol below each bar indicates whether the majority of base pairs - are:
+
The RNA structure consensus displayed below the alignment gives + the percentage of valid base pairs per column for the first + secondary structure annotation shown on the annotation panel. These + values are shown as a histogram labeled "StrucConsensus", + where a symbol below each bar indicates whether the majority of base + pairs are: +

'(' - Watson-Crick (C:G, A:U/T)

'[' - Non-canonical (a.ka. wobble) (G:U/T)

'{' - Invalid (a.k.a. tertiary) (the rest)
@@ -40,12 +41,11 @@
Mousing over the column gives the fraction of pairs classified as Watson-Crick, Canonical or Invalid.
-
By default - this calculation includes gaps in columns. You can choose to ignore - gaps in the calculation by right clicking on the label - "StrucConsensus" to the left of the structure consensus bar - chart.
- +
+ By default this calculation includes gaps in columns. You can choose + to ignore gaps in the calculation by right clicking on the label + "StrucConsensus" to the left of the structure consensus + bar chart.

RNA Structure logo
Right-clicking on the label allows you to enable the structure logo. It is very similar to diff --git a/help/html/calculations/tree.html b/help/html/calculations/tree.html index 7a8271e..59736ca 100755 --- a/help/html/calculations/tree.html +++ b/help/html/calculations/tree.html @@ -30,10 +30,10 @@ Trees are calculated on either the complete alignment, or just the currently selected group of sequences, using the functions in the Calculate→Calculate tree submenu. Once calculated, trees are displayed in a new tree viewing window. There are four different calculations, using - one of two distance measures and constructing the tree from one of - two algorithms : + href="../calculations/treeviewer.html">tree viewing + window. There are four different calculations, using one of two + distance measures and constructing the tree from one of two + algorithms :

Distance Measures @@ -56,8 +56,8 @@ scores for the residue pairs at each aligned position.

For details about each model, see the list of built-in score matrices. + href="scorematrices.html">list of built-in score + matrices.

Sequence Feature Similarity
Trees @@ -102,12 +102,12 @@

A newly calculated tree will be displayed in a new tree viewing window. In addition, a new entry with the same tree - viewer window name will be added in the Sort menu so that the - alignment can be reordered to reflect the ordering of the leafs of - the tree. If the tree was calculated on a selected region of the - alignment, then the title of the tree view will reflect this. + href="../calculations/treeviewer.html">tree viewing + window. In addition, a new entry with the same tree viewer window + name will be added in the Sort menu so that the alignment can be + reordered to reflect the ordering of the leafs of the tree. If the + tree was calculated on a selected region of the alignment, then the + title of the tree view will reflect this.

@@ -118,9 +118,9 @@ phylogenetic trees, which can cope with large numbers of sequences, use better distance methods and can perform bootstrapping. Jalview can read Newick format tree files using the 'Load Associated Tree' entry - of the alignment's File menu. Sequences in the alignment will be + href="http://evolution.genetics.washington.edu/phylip/newick_doc.html">Newick + format tree files using the 'Load Associated Tree' entry of the + alignment's File menu. Sequences in the alignment will be automatically associated to nodes in the tree, by matching Sequence IDs to the tree's leaf names.
diff --git a/help/html/calculations/treeviewer.html b/help/html/calculations/treeviewer.html index c91fe1b..3d6245e 100755 --- a/help/html/calculations/treeviewer.html +++ b/help/html/calculations/treeviewer.html @@ -28,12 +28,11 @@

The tree viewing window is opened when a tree has been calculated from an alignment, or imported via a file or web - service. It includes menus for controlling - layout and file and figure creation, and enables various selection - and colouring operations on the associated sequences in the - alignment. + href="tree.html">calculated from an alignment, or + imported via a file or web service. It includes menus + for controlling layout and file and figure creation, and enables + various selection and colouring operations on the associated + sequences in the alignment.

Selecting Sequence Leaf Nodes
@@ -95,23 +94,24 @@ tree is rendered and labeled:

Fit to Window -
The tree layout will be scaled to fit in the display window. - You may need to reduce the font size to minimise the leaf label - overlap when this option is selected.
+
The tree layout will be scaled to fit in the display + window. You may need to reduce the font size to minimise the + leaf label overlap when this option is selected.

Font Size ...n -
+
Brings up a dialog box to set the font size for the leaf names. n is the current font size.

Show Distances -
Labels each branch or leaf with its associated branch length.
+
Labels each branch or leaf with its associated branch + length.

Show Bootstrap values -
Labels each branch or leaf with its associated bootstrap +
Labels each branch or leaf with its associated bootstrap value.

Mark unlinked leaves -
Toggles the display of a '*' at the beginning of a leaf label - to indicate that there is no sequence corresponding to that leaf - in the associated alignment.
+
Toggles the display of a '*' at the beginning of a leaf + label to indicate that there is no sequence corresponding to + that leaf in the associated alignment.

Sort Alignment By Tree
Sorts any associated alignment views using the current tree. (Only @@ -120,10 +120,9 @@
Associate Leaves with ...
Only visible when there are multiple views of the same alignment to show and edit which - alignment views are associated with the leaves of the displayed - tree. + href="../features/multipleViews.html">multiple + views of the same alignment to show and edit which alignment + views are associated with the leaves of the displayed tree.

diff --git a/help/html/colourSchemes/annotationColouring.html b/help/html/colourSchemes/annotationColouring.html index ed0ab3f..2272503 100755 --- a/help/html/colourSchemes/annotationColouring.html +++ b/help/html/colourSchemes/annotationColouring.html @@ -77,9 +77,9 @@
Press the "Defaults" button to reset the minimum and maximum colours to their default settings (these are configured in the applet's parameters or the application's user preferences.).
Default min - and max colours were introduced in Jalview 2.7 + href="../features/preferences.html">application's + user preferences.).
Default min and max + colours were introduced in Jalview 2.7
diff --git a/help/html/colourSchemes/conservation.html b/help/html/colourSchemes/conservation.html index 19d276e..88ef6ba 100755 --- a/help/html/colourSchemes/conservation.html +++ b/help/html/colourSchemes/conservation.html @@ -33,9 +33,9 @@ alignment analysis (Livingstone C.D. and Barton G.J. (1993), Protein Sequence Alignments: A Strategy for the Hierarchical Analysis of Residue Conservation.CABIOS Vol. 9 No. 6 (745-756)). See the conservation calculation help page for a more thorough - explanation of the calculation. + href="../calculations/conservation.html">conservation + calculation help page for a more thorough explanation of the + calculation.

For an already coloured alignment, the conservation index at each alignment position is used to modify the shading intensity of @@ -46,11 +46,10 @@
Conservation can be calculated over all sequences in an alignment, or just within specific groups (such as those defined by phylogenetic tree partitioning). The option 'apply to all groups' - controls whether the contrast slider value will be applied to the - indices for the currently selected group, or all groups defined over - the alignment. + href="../calculations/tree.html">phylogenetic tree + partitioning). The option 'apply to all groups' controls whether + the contrast slider value will be applied to the indices for the + currently selected group, or all groups defined over the alignment.
diff --git a/help/html/colourSchemes/index.html b/help/html/colourSchemes/index.html index 3f01bdf..7664101 100755 --- a/help/html/colourSchemes/index.html +++ b/help/html/colourSchemes/index.html @@ -49,8 +49,7 @@ td { the background colour.

The "Colour→Colour Text..." + href="../colourSchemes/textcolour.html">Colour Text..." entry opens a dialog box to set a different text colour for light and dark background, and the intensity threshold for transition between them. diff --git a/help/html/colourSchemes/rnahelicesColouring.html b/help/html/colourSchemes/rnahelicesColouring.html index a7d0898..9b9d41a 100644 --- a/help/html/colourSchemes/rnahelicesColouring.html +++ b/help/html/colourSchemes/rnahelicesColouring.html @@ -32,10 +32,10 @@ on its helices. The helices are determined from the secondary structure line in the Stockholm file (#GC SS_cons) written in WUSS notation that specifies base pairing. See Wikipedia or Jalview RNA Support Blog for more information about Stockholm + href="http://en.wikipedia.org/wiki/Stockholm_format"> + Wikipedia or + Jalview RNA Support Blog for more information about Stockholm files and WUSS notation.
Select "Colour" diff --git a/help/html/editing/index.html b/help/html/editing/index.html index 5d83d00..471e520 100755 --- a/help/html/editing/index.html +++ b/help/html/editing/index.html @@ -32,12 +32,11 @@ clicking the left mouse button and pressing a combination of either shift and control (or the alt, option or apple key on Macs) and dragging the mouse. Pressing F2 toggles the alternative 'Cursor mode' keyboard editing facility, where the space bar and - delete keys add and remove gaps at the current editing position. The - key strokes for both these modes are summarised in the keystrokes table. + href="../features/cursorMode.html">'Cursor mode' keyboard + editing facility, where the space bar and delete keys add and remove + gaps at the current editing position. The key strokes for both these + modes are summarised in the keystrokes + table.

Tip: For large alignments, deselect "Calculate diff --git a/help/html/features/annotation.html b/help/html/features/annotation.html index d13afe4..b63d20b 100755 --- a/help/html/features/annotation.html +++ b/help/html/features/annotation.html @@ -39,31 +39,31 @@ Types of annotation

Sequence - associated annotation.
Data displayed on sequence annotation - rows are associated with the positions of a sequence. Often this - is 'Reference annotation' such as secondary structure information - derived from 3D structure data, or from the results of sequence - based prediction of secondary + associated annotation.
Data displayed on sequence + annotation rows are associated with the positions of a sequence. + Often this is 'Reference annotation' such as secondary structure + information derived from 3D structure data, or from the results of + sequence based prediction of secondary structure and disorder. If reference annotation is available for a the currently selected sequences, it can be shown by selecting the Add Reference Annotation option in the sequence or selection popup menu.
-
Group associated annotation.
Data can be associated with - groups defined on the alignment. If sequence groups are defined, Conservation and Consensus annotation can - be enabled for each group from the Group associated annotation.
Data can + be associated with groups defined on the alignment. If sequence + groups are defined, Conservation + and Consensus + annotation can be enabled for each group from the Annotations menu, or can be - imported from a Jalview Annotations - file.
-
Alignment associated annotation.
Annotation rows - associated with columns on the alignment are simply 'alignment - annotation'. Controls allow you to interactively create - alignment annotation to add labels and symbols to alignment columns. - Jalview's consensus, conservation and quality calculations also - create histogram and sequence logo annotations on the alignment. -
+ imported from a Jalview Annotations + file. +
Alignment associated annotation.
Annotation + rows associated with columns on the alignment are simply + 'alignment annotation'. Controls allow you to interactively + create alignment annotation to add labels and symbols to + alignment columns. Jalview's consensus, conservation and quality + calculations also create histogram and sequence logo annotations + on the alignment.

Importing and exporting annotation
@@ -78,17 +78,15 @@ groups of annotation rows can be shown or hidden using the pop-up menu obtained by right-clicking the label. You can also reorder them by dragging the label to a new position with the left mouse button. - The - Annotations menu provides settings controlling the - ordering and display of sequence, group and alignment associated - annotation. The - Colour by annotation option in the colour menu - allows annotation to be used to - shade the - alignment. Annotations can also be used to - select or - hide columns via the dialog opened from the - Selection menu. + The Annotations menu provides settings controlling + the ordering and display of sequence, group and alignment associated + annotation. The Colour by annotation option in the + colour menu allows annotation to be used to shade the + alignment. Annotations can also be used to select or + hide columns via the dialog opened from the Selection + menu.

Sequence Highlighting and Selection from Annotation @@ -148,32 +146,32 @@ using the view's standard font size.
- Editing labels and secondary structure annotation rows + Editing labels and secondary structure annotation + rows

Use the left mouse button to select a position along the row that are to be annotated - these regions will be - coloured red. Press Control or shift in - combination with the left-click to either select an additional position, - or a range of positions on the alignment. + coloured red. Press Control or shift + in combination with the left-click to either select an additional + position, or a range of positions on the alignment.

Once positions have been selected, use the right - mouse button and select one of the following from the annotation menu: + mouse button and select one of the following from the annotation + menu:

-
Helix
- Marks selected positions with a helix glyph (a red oval), - and optional text label (see below). A dialog box will open for - you to enter the text. Consecutive ovals will be rendered as an - unbroken red line. +
Helix
Marks selected positions with a + helix glyph (a red oval), and optional text label (see below). A + dialog box will open for you to enter the text. Consecutive + ovals will be rendered as an unbroken red line.
-
Sheet
- Marks selected positions with a sheet glyph (a green arrow - oriented from left to right), and optional text label (see - below). A dialog box will open for you to enter the text. - Consecutive arrows will be joined together to form a single - green arrow. +
Sheet
Marks selected positions with a + sheet glyph (a green arrow oriented from left to right), and + optional text label (see below). A dialog box will open for you + to enter the text. Consecutive arrows will be joined together to + form a single green arrow.

RNA Helix (only shown when working with nucleotide sequences)
Marks selected positions @@ -183,23 +181,22 @@ region pairs with bases to the left of the highlighted columns. Other kinds of base-pair annotation are also supported (e.g. 'A' and 'a', or '<' and '>'), and Jalview will suggest an - appropriate symbol based on the closest unmatched - parenthesis to the left.
If any brackets do not match up, then an - orange square will highlight the first position where a bracket - was found not to match. + appropriate symbol based on the closest unmatched parenthesis to + the left.
If any brackets do not match up, then an orange + square will highlight the first position where a bracket was + found not to match.
-
Label
- Set the text label at the selected positions. A dialog box - will open for you to enter the text. If more than one - consecutive position is marked with the same label, only the - first position's label will be rendered. +
Label
Set the text label at the selected + positions. A dialog box will open for you to enter the text. If + more than one consecutive position is marked with the same + label, only the first position's label will be rendered.
-
Colour
- Changes the colour of the annotation text label. +
Colour
Changes the colour of the + annotation text label.
-
Remove Annotation
- Blanks any annotation at the selected positions on the row. - Note: This cannot be undone +
Remove Annotation
Blanks any annotation + at the selected positions on the row. Note: This + cannot be undone

@@ -211,14 +208,14 @@ Current Limitations

- The Jalview user interface does not support interactive - creation and editing of quantitative annotation (histograms and line - graphs), or to create annotation associated with a specific - sequence or group. It is also incapable of annotation grouping or changing - the style of existing annotation (e.g. to change between line or bar - charts, or to make multiple line graphs). These annotation - capabilities are only possible by the import of an Annotation file.
+ The Jalview user interface does not support interactive creation and + editing of quantitative annotation (histograms and line graphs), or + to create annotation associated with a specific sequence or group. + It is also incapable of annotation grouping or changing the style of + existing annotation (e.g. to change between line or bar charts, or + to make multiple line graphs). These annotation capabilities are + only possible by the import of an Annotation + file.

diff --git a/help/html/features/annotationsFormat.html b/help/html/features/annotationsFormat.html index 744370b..fcdb908 100755 --- a/help/html/features/annotationsFormat.html +++ b/help/html/features/annotationsFormat.html @@ -31,9 +31,8 @@ Alignment annotations can be imported onto an alignment since version 2.08 of Jalview, via an annotations file. It is a simple ASCII text file consisting of tab delimited records similar to the Sequence Features File, and introduced primarily for use with the - Jalview applet. + href="featuresFormat.html">Sequence Features File, and + introduced primarily for use with the Jalview applet.

@@ -55,8 +54,8 @@ alignment window.

- THE ANNOTATION FILE FORMAT
An annotation file - consists of lines containing an instruction followed by tab + THE ANNOTATION FILE FORMAT
An annotation + file consists of lines containing an instruction followed by tab delimited fields. Any lines starting with "#" are considered comments, and ignored. The sections below describe the structure of an annotation file. @@ -83,11 +82,10 @@
At the end of this document, you can also find notes on compatibility of annotation files across different versions of - Jalview. An example annotation file is - also provided along with instructions on how to import it to - Jalview. + href="#compatibility">compatibility of annotation files + across different versions of Jalview. An example + annotation file is also provided along with instructions on how to + import it to Jalview.

@@ -110,8 +108,9 @@ followed by a description for the row, which is shown in a tooltip when the user mouses over the annotation row's label. Since Jalview 2.7, the description field may also contain HTML tags (in - the same way as a sequence feature's - label), providing the text is enclosed in an <html/> tag. + the same way as a sequence + feature's label), providing the text is enclosed in an + <html/> tag.
Please note: URL links embedded in HTML descriptions are not yet supported. @@ -124,6 +123,7 @@ GRAPH_TYPE. The allowed values of GRAPH_TYPE and corresponding interpretation of each Value are shown below: +

BAR_GRAPH
Plots a histogram with @@ -190,9 +190,9 @@ GRAPHLINE graph_name value label colo

- SEQUENCE_GROUP
Groups - of sequences and column ranges can be defined using a tab delimited - statement like: + SEQUENCE_GROUP
+ Groups of sequences and column ranges can be defined using a tab + delimited statement like:

SEQUENCE_GROUP Group_Name Group_Start Group_End Sequences
@@ -296,8 +296,8 @@ GRAPHLINE graph_name value label colo hide Boolean (default false) indicating whether the rows in - this group should be marked as hidden.
- Note: if the group is sequence associated (specified by + this group should be marked as hidden.
Note: + if the group is sequence associated (specified by SEQUENCE_REF), then all members will be hidden and marked as represented by the reference sequence. diff --git a/help/html/features/bioJsonFormat.html b/help/html/features/bioJsonFormat.html index cb7ccc0..59b4936 100644 --- a/help/html/features/bioJsonFormat.html +++ b/help/html/features/bioJsonFormat.html @@ -40,8 +40,7 @@

The BioJSON specification is published at http://jalview.github.io/biojson/. + href="http://jalview.github.io/biojson/">http://jalview.github.io/biojson/.

Import of BioJSON data from HTML pages diff --git a/help/html/features/chimera.html b/help/html/features/chimera.html index 98d8966..1b0b9c1 100644 --- a/help/html/features/chimera.html +++ b/help/html/features/chimera.html @@ -36,9 +36,9 @@ You can set a default choice of Jmol or Chimera structure viewer in Preferences. You can also optionally specify the path to the Chimera program here (if it - differs from the standard paths searched by Jalview).
- Please make sure your version of Chimera is up to - date. Jalview requires at least Chimera version 1.11.1 + differs from the standard paths searched by Jalview).
Please + make sure your version of Chimera is up to date. Jalview requires + at least Chimera version 1.11.1

If you save your Jalview session as a project file, the state of any @@ -70,8 +70,8 @@ Help menu.
Basic screen operations (see Chimera help at + href="http://www.cgl.ucsf.edu/chimera/current/docs/UsersGuide/mouse.html">Chimera + help at http://www.cgl.ucsf.edu/chimera/current/docs/UsersGuide/mouse.html for full details). @@ -185,8 +185,8 @@ colourschemes.
The remaining entries apply the colourschemes available from the standard and user defined amino acid colours. + href="../colourSchemes/index.html">amino acid + colours.
Chimera
@@ -217,8 +217,8 @@
Jalview and Chimera communicate using Chimera's REST service + href="http://www.cgl.ucsf.edu/chimera/current/docs/ContributedSoftware/restserver/restserver.html">REST + service (http://www.cgl.ucsf.edu/chimera/current/docs/ContributedSoftware/restserver/restserver.html).
Technically this requires both Chimera and Jalview to open ports on the local network, and this may be blocked by Windows diff --git a/help/html/features/clarguments.html b/help/html/features/clarguments.html index 1d6f62d..4b4aab9 100644 --- a/help/html/features/clarguments.html +++ b/help/html/features/clarguments.html @@ -67,8 +67,8 @@
-annotations FILE/URL

@@ -98,7 +98,11 @@ diff --git a/help/html/features/columnFilterByAnnotation.html b/help/html/features/columnFilterByAnnotation.html index c53844b..b260cee 100644 --- a/help/html/features/columnFilterByAnnotation.html +++ b/help/html/features/columnFilterByAnnotation.html @@ -31,8 +31,8 @@ The 'Select/Hide by Annotation' window allows columns to be selected or hidden according to annotation rows on the alignment. The dialog box is opened via "Select→Select/Hide - Columns by Annotation...", and different filters are - then presented for filtering data according to the selected annotation + Columns by Annotation...", and different filters are then + presented for filtering data according to the selected annotation row.

Add precalculated annotations to the alignment. See Annotation File description. + href="annotationsFormat.html" target="NEW">Annotation + File description.

-nonews
-
Disable check for Jalview news on startup (not recommended other than for classroom / demo usage)
+
+ Disable check for Jalview + news on startup (not recommended other than for classroom / + demo usage) +

diff --git a/help/html/features/commandline.html b/help/html/features/commandline.html index 0e1f109..9cffc51 100644 --- a/help/html/features/commandline.html +++ b/help/html/features/commandline.html @@ -56,8 +56,8 @@
java -Djava.ext.dirs=$INSTALL_DIR$/lib -cp $INSTALL_DIR$/jalview.jar jalview.bin.Jalview -open [FILE]
Use '-help' to get more information on the command line arguments that Jalview accepts. + href="clarguments.html">command line arguments that + Jalview accepts.

diff --git a/help/html/features/creatinFeatures.html b/help/html/features/creatinFeatures.html index a6a17a5..68a594a 100644 --- a/help/html/features/creatinFeatures.html +++ b/help/html/features/creatinFeatures.html @@ -26,12 +26,12 @@ Creating Sequence Features
Jalview can create sequence features from the matches of a regular expression search, or from the currently selected area - via the "selection→Create sequence - feature" entry in the selection - area popup menu. In both cases, the Create - Features dialog box will then be opened: + href="search.html">regular expression search, or from the + currently selected area via the "selection→Create + sequence feature" entry in the selection area popup menu. In + both cases, the Create Features dialog box will + then be opened:
diff --git a/help/html/features/dasfeatures.html b/help/html/features/dasfeatures.html index 32408ee..1965e70 100644 --- a/help/html/features/dasfeatures.html +++ b/help/html/features/dasfeatures.html @@ -27,10 +27,8 @@
DAS Sequence Feature Retrieval
-
- Jalview includes a client for retrieving sequences and their - features via the Distributed Annotation System. -
+
Jalview includes a client for retrieving sequences and their + features via the Distributed Annotation System.

Open the Feature Settings panel by selecting "View -> Feature Settings..."
@@ -55,10 +53,10 @@ Accession ids for the given sequence names. It is important to realise that many DAS sources only use UniProt accession ids, rather than Swissprot/UniProt sequence names.
The database reference fetcher documentation describes how Jalview - discovers what database references are appropriate for the sequences - in the alignment. + href="../webServices/dbreffetcher.html">database + reference fetcher documentation describes how Jalview discovers + what database references are appropriate for the sequences in the + alignment.

Note
Please remember to save your alignment if either the start/end numbering, or the sequence IDs @@ -68,9 +66,11 @@
DAS support was introduced in Jalview Version 2.1.
-
+

- The DAS registry at http://www.dasregistry.org was decommissioned early in 2015. An unmaintained mirror is currently hosted at http://www.ebi.ac.uk/das-srv/registry/. + The DAS registry at http://www.dasregistry.org was + decommissioned early in 2015. An unmaintained mirror is currently + hosted at http://www.ebi.ac.uk/das-srv/registry/.

diff --git a/help/html/features/dassettings.html b/help/html/features/dassettings.html index a86d37f..9600070 100644 --- a/help/html/features/dassettings.html +++ b/help/html/features/dassettings.html @@ -29,14 +29,13 @@

Jalview can retrieve sequences and features from many DAS sources. The DAS sources that it uses are discovered and - selected via the DAS settings panel, opened either from the - View→Feature Settings - dialog box from the alignment window's menu bar, or the Tools→Preferences dialog box opened from the Desktop menu - bar. + href="http://biodas.org/">DAS sources. The DAS sources + that it uses are discovered and selected via the DAS + settings panel, opened either from the View→Feature Settings dialog + box from the alignment window's menu bar, or the Tools→Preferences + dialog box opened from the Desktop menu bar.

diff --git a/help/html/features/editingFeatures.html b/help/html/features/editingFeatures.html index 748eeba..14e98e5 100644 --- a/help/html/features/editingFeatures.html +++ b/help/html/features/editingFeatures.html @@ -41,10 +41,9 @@ pull down menu. In addition to the Name, group, colour and description attributes described for the new feature dialog box, a feature's start and end position can be - changed either by entering a new position directly or by using the - adjacent up and down buttons. + href="creatinFeatures.html">new feature dialog box, a + feature's start and end position can be changed either by entering a + new position directly or by using the adjacent up and down buttons.

Select Amend to update the feature, Delete diff --git a/help/html/features/ensemblsequencefetcher.html b/help/html/features/ensemblsequencefetcher.html index 54b57a3..c842a42 100644 --- a/help/html/features/ensemblsequencefetcher.html +++ b/help/html/features/ensemblsequencefetcher.html @@ -36,13 +36,12 @@ Two types of ENSEMBL source are provided. ENSEMBL queries the main ENSEMBL warehouse containing data for higher eukaryotes, and EnsemblGenomes, which queries Ensembl Pathogens, and other - warehouses.
- Ensembl support is new in Jalview, and we expect to merge - these sources in a future release. + warehouses.
Ensembl support is new in Jalview, and + we expect to merge these sources in a future release.

- General Use
If you have a set of Ensembl gene - or transcript IDs, then you can retrieve them via the + General Use
If you have a set of Ensembl + gene or transcript IDs, then you can retrieve them via the sequence fetcher dialog opened after selecting the most appropriate source (either 'ENSEMBL', or Ensembl Genomes). However, Jalview's Ensembl client has a couple of additional capabilities: diff --git a/help/html/features/featuresFormat.html b/help/html/features/featuresFormat.html index 9f33b7b..ec1e093 100755 --- a/help/html/features/featuresFormat.html +++ b/help/html/features/featuresFormat.html @@ -122,9 +122,9 @@
If your sequence annotation is already available in GFF Format (see - gmod.org/wiki/GFF2), - then you can leave it as is, after first adding a line containing - only 'GFF' after any Jalview feature colour definitions (this + gmod.org/wiki/GFF2), then + you can leave it as is, after first adding a line containing only + 'GFF' after any Jalview feature colour definitions (this mixed format capability was added in Jalview 2.6). Alternately, you can use Jalview's own sequence feature annotation format, which additionally allows HTML and URLs to be directly attached to each @@ -141,13 +141,13 @@ This format allows two alternate ways of referring to a sequence, - either by its text ID, or its index (base 0) in an associated alignment. - Normally, sequence features are associated with sequences rather than - alignments, and the sequenceIndex field is given as "-1". In - order to specify a sequence by its index in a particular alignment, - the sequenceId should be given as "ID_NOT_SPECIFIED", - otherwise the sequenceId field will be used in preference to the - sequenceIndex field. + either by its text ID, or its index (base 0) in an associated + alignment. Normally, sequence features are associated with sequences + rather than alignments, and the sequenceIndex field is given as + "-1". In order to specify a sequence by its index in a + particular alignment, the sequenceId should be given as + "ID_NOT_SPECIFIED", otherwise the sequenceId field will be + used in preference to the sequenceIndex field.
@@ -161,14 +161,14 @@ description line will be translated into URL links. A link symbol will be displayed adjacent to any feature which includes links, and these are made available from the links submenu of the popup menu which is obtained by - right-clicking when a link symbol is displayed in the tooltip.
- Non-positional features
Specify the start - and end for a feature to be 0 in order to - attach it to the whole sequence. Non-positional features are shown - in a tooltip when the mouse hovers over the sequence ID panel, and - any embedded links can be accessed from the popup menu.
Scores
+ href="../menus/popupMenu.html#sqid.popup">links submenu + of the popup menu which is obtained by right-clicking when a link + symbol is displayed in the tooltip.
Non-positional + features
Specify the start and end for + a feature to be 0 in order to attach it to the + whole sequence. Non-positional features are shown in a tooltip when + the mouse hovers over the sequence ID panel, and any embedded links + can be accessed from the popup menu.
Scores
Scores can be associated with sequence features, and used to sort sequences or shade the alignment (this was added in Jalview 2.5). The score field is optional, and malformed scores will be ignored. diff --git a/help/html/features/featuresettings.html b/help/html/features/featuresettings.html index dba62cc..3d7c944 100755 --- a/help/html/features/featuresettings.html +++ b/help/html/features/featuresettings.html @@ -72,23 +72,29 @@

Feature settings pop-up menu
Right-click - on a feature to open a pop-up menu that allows you to
Hide, show and - select columns containing that feature
Sort the alignment or - current selection using that feature type (see below)
Toggle the - type of colouring used for the feature
Features may be highlighted - with either a single colour or a feature - colourscheme based on either the scores associated with that - feature or from the feature's description (e.g. to distinguish - different names associated with a DOMAIN feature). + on a feature to open a pop-up menu that allows you to +
+
Hide, show and select columns containing that feature
+
Sort the alignment or current selection using that feature + type (see below)
+
Toggle the type of colouring used for the feature
+
+
+ Features may be highlighted with either a single colour or a feature colourscheme based on + either the scores associated with that feature or from the feature's + description (e.g. to distinguish different names associated with a + DOMAIN feature).

- Ordering alignment by features
The 'Seq - Sort by Score' and 'Seq Sort by Density' buttons will sort the - alignment based on the average score or total number of currently - active features and groups on each sequence. To order the alignment - using a specific feature type, use the sort by .. entries - in the pop-up menu for that type.
Feature sorting - and graduated feature colouring were introduced in Jalview 2.5 + Ordering alignment by + features
The 'Seq Sort by Score' and 'Seq Sort by + Density' buttons will sort the alignment based on the average score + or total number of currently active features and groups on each + sequence. To order the alignment using a specific feature type, use + the sort by .. entries in the pop-up menu for that type.
+ Feature sorting and graduated feature colouring were + introduced in Jalview 2.5

@@ -112,11 +118,11 @@ ordering based on the average length of each feature type.

- The transparency slider setting controls the visibility - of features rendered below other features. Reducing the transparency - will mean that features at the top of the list can obscure features - lower down, and increasing it allows the user to 'see through' the - upper layers of a set of features. + The transparency slider setting controls + the visibility of features rendered below other features. Reducing + the transparency will mean that features at the top of the list can + obscure features lower down, and increasing it allows the user to + 'see through' the upper layers of a set of features.

You can save all features, with their diff --git a/help/html/features/groovy.html b/help/html/features/groovy.html index 079cf9e..254f92e 100644 --- a/help/html/features/groovy.html +++ b/help/html/features/groovy.html @@ -64,6 +64,7 @@ public methods of the jalview class hierarchy can be called from Groovy scripts. In addition, the following objects are also defined: +

Jalview - this is bound to jalview.bin.Jalview.
Useful @@ -90,9 +91,9 @@ def alignment = alf[0].viewport.alignment; def seq = alignment.getSequenceAt(0);
-
If you wanted to do the same thing from the command line, you can refer to - alignment that was just loaded with currentAlFrame:
-
+
If you wanted to do the same thing from the command line, + you can refer to alignment that was just loaded with + currentAlFrame:

print currentAlFrame.getTitle();

diff --git a/help/html/features/hiddenRegions.html b/help/html/features/hiddenRegions.html index ac9b8b1..d69f877 100644 --- a/help/html/features/hiddenRegions.html +++ b/help/html/features/hiddenRegions.html @@ -86,9 +86,9 @@
Tree, pairwise alignment and PCA calculations will only be performed using the visible - parts of the alignment.
+ href="../calculations/pca.html">PCA calculations will + only be performed using the visible parts of the + alignment.
Multiple Sequence Alignments are performed locally on on each visible chunk of the input, and concatenated with the hidden regions to diff --git a/help/html/features/jmol.html b/help/html/features/jmol.html index 3141aae..2f10196 100644 --- a/help/html/features/jmol.html +++ b/help/html/features/jmol.html @@ -32,12 +32,12 @@ structures opened by entries in the "Structure" submenu in the sequence id pop-up menu (if you can't see this, then you need to associate a PDB structure with the sequence). Jmol is available - from the Jalview desktop and should also run in the JalviewLite - applet, providing the browser supports Java 1.5. If Jmol is not - available, then the original internal - pdb viewer will be used as a fallback. + href="viewingpdbs.html">associate a PDB structure with + the sequence). Jmol is available from the Jalview desktop and should + also run in the JalviewLite applet, providing the browser supports + Java 1.5. If Jmol is not available, then the original internal pdb viewer will be used as a + fallback.
+
+
A new feature in Jalview 2.3 is the ability to map between sequences in different domains, based on alignment, or by the use of explicit mappings provided by databases.
diff --git a/help/html/features/siftsmapping.html b/help/html/features/siftsmapping.html index 9492d70..3f4f002 100644 --- a/help/html/features/siftsmapping.html +++ b/help/html/features/siftsmapping.html @@ -24,7 +24,8 @@ will generate a mapping using the built-in Needleman and Wunsch global alignment algorithm. This is how sequence-structure mappings were created before version 2.10.
-
Controlling and troubleshooting SIFTS mappings
+
+ Controlling and troubleshooting SIFTS mappings
Configuration options controlling whether SIFTS mappings are used can be found in the Tools → Preferences → Structure tab, under 'Sequence ↔ Structure method'.
Note: @@ -37,11 +38,12 @@ Multi-Chain Mappings
SIFTS gives Jalview the ability to display multi-chain mappings between UniProt sequences and PDB structure data. This is important when working with - multimeric proteins, when the biological assembly can contain several - structures for the same protein sequence. Multi-chain mapping allows - all residues in a structure to be located in the alignment, and - also, when shading the structure by sequence colours, enables - conservation patterns between oligomer interfaces to be explored. + multimeric proteins, when the biological assembly can contain + several structures for the same protein sequence. Multi-chain + mapping allows all residues in a structure to be located in the + alignment, and also, when shading the structure by sequence colours, + enables conservation patterns between oligomer interfaces to be + explored.

To see this in action, Retrieve the UniProt sequence FER1_MAIZE, and then view one of its structures: 3B2F. Mousing over @@ -53,13 +55,13 @@ Viewing Mapping Output
The mapping provided by the SIFTS record is accessible via File → View mapping menu of the structure viewers. The screenshot below - shows the mapping created between UniProt sequence FER1_MAIZE and proteins in PDB 3B2F, which reports thattwo chains - were mapped. The mapping method is also reported (highlighted with red border). + shows the mapping created between UniProt sequence FER1_MAIZE and + proteins in PDB 3B2F, which reports thattwo chains were mapped. The + mapping method is also reported (highlighted with red border).
-
+ alt="SIFTS mapping output" />

SIFTS Mapping integration was added in Jalview 2.10
diff --git a/help/html/features/splitView.html b/help/html/features/splitView.html index 1c36abd..03b993c 100644 --- a/help/html/features/splitView.html +++ b/help/html/features/splitView.html @@ -47,21 +47,21 @@

Mouseover or scrolling of either alignment is followed by the other (unless you turn off "View→Automatic Scrolling") + href="../menus/alwview.html">"View→Automatic + Scrolling")

On selecting rows, columns or regions in one alignment, the corresponding selection is made in the other

Sequence ordering in one alignment (using the cursor, or "Calculate→Sort") is also applied to the other + href="../calculations/sorting.html">"Calculate→Sort") + is also applied to the other

Editing (gap insertion / deletion) in the protein alignment is reflected in the cDNA (but not vice versa)

Any trees imported or created with "Calculate Tree" on one of the views allow both cDNA and - Protein views to be grouped, coloured or sorted. + href="../calculations/tree.html">"Calculate Tree" on + one of the views allow both cDNA and Protein views to be grouped, + coloured or sorted.

To allow for the different widths in cDNA and Protein alignments, the "Format→Font" @@ -81,10 +81,9 @@

An alignment annotation row on the protein alignment shows the cDNA consensus for each peptide column.
This consensus may - reveal variation in nucleotides coding for conserved protein - residues. + href="../calculations/consensus.html">cDNA consensus for + each peptide column.
This consensus may reveal variation in + nucleotides coding for conserved protein residues.
diff --git a/help/html/features/structurechooser.html b/help/html/features/structurechooser.html index c9600bb..daa1ac3 100644 --- a/help/html/features/structurechooser.html +++ b/help/html/features/structurechooser.html @@ -86,18 +86,15 @@ sample alignment. Note however that if no structures were auto-discovered, a different interface for manual association will be invoked as seen in the screenshot below. -
-
Manual selection/association of PDB files with Sequences

To manually associate PDB files with a sequence, select 'From File', or 'Enter PDB Id' from the drop-down menu: -

From File - allows you to load a PDB file from the local machine or network and associate it with the diff --git a/help/html/features/uniprotqueryfields.html b/help/html/features/uniprotqueryfields.html index eaee308..182b206 100644 --- a/help/html/features/uniprotqueryfields.html +++ b/help/html/features/uniprotqueryfields.html @@ -33,571 +33,359 @@ syntax).
-

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
Field Example Description
accession - accession:P62988 - - Lists all entries with the primary or secondary - accession number P62988. -
active - active:no - - Lists all obsolete entries. -
annotation - - annotation:(type:non-positional) - - annotation:(type:positional) - - annotation:(type:mod_res "Pyrrolidone carboxylic acid" evidence:experimental) - - - Lists all entries with: -
-
any general annotation (comments [CC])
-
any sequence annotation (features [FT])
-
at least one amino acid modified with a Pyrrolidone carboxylic acid group
-
-
author - - author:ashburner - - - Lists all entries with at least one reference co-authored by Michael Ashburner. -
cdantigen - - cdantigen:CD233 - - - Lists all entries whose cluster of differentiation number is CD233. -
citation - - citation:("intracellular structural proteins") - - citation:(author:ashburner journal:nature) - citation:9169874 - - - Lists all entries with a literature citation: -
-
containing the phrase "intracellular structural proteins" in either title or abstract
-
co-authored by Michael Ashburner and published in Nature
-
with the PubMed identifier 9169874
-
-
cluster - - cluster:UniRef90_A5YMT3 - - - Lists all entries in the UniRef 90% identity cluster whose - representative sequence is UniProtKB entry A5YMT3. -
count - - annotation:(type:transmem count:5) - annotation:(type:transmem count:[5 TO *]) - annotation:(type:cofactor count:[3 TO *]) - - Lists all entries with: -
-
exactly 5 transmembrane regions
-
5 or more transmembrane regions
-
3 or more Cofactor comments
-
-
created - - created:[20121001 TO *] - reviewed:yes AND created:[current TO *] - - - Lists all entries created since October 1st 2012.
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - + + + + + + - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
Field Example Description
accession accession:P62988 Lists all entries with the primary or secondary accession + number P62988.
active active:no Lists all obsolete entries.
annotation + annotation:(type:non-positional) + annotation:(type:positional) annotation:(type:mod_res + "Pyrrolidone carboxylic acid" evidence:experimental) + Lists all entries with: +
+
any general annotation (comments [CC])
+
any sequence annotation (features [FT])
+
at least one amino acid modified with a Pyrrolidone + carboxylic acid group
+
+
author author:ashburner Lists all entries with at least one reference co-authored + by Michael Ashburner.
cdantigen cdantigen:CD233 Lists all entries whose cluster of differentiation number + is CD233.
citation + citation:("intracellular structural proteins") + citation:(author:ashburner journal:nature) citation:9169874 + Lists all entries with a literature citation: +
+
containing the phrase "intracellular structural + proteins" in either title or abstract
+
co-authored by Michael Ashburner and published in + Nature
+
with the PubMed identifier 9169874
+
+
cluster cluster:UniRef90_A5YMT3 Lists all entries in the UniRef 90% identity cluster + whose representative sequence is UniProtKB entry A5YMT3.
count + annotation:(type:transmem count:5) + annotation:(type:transmem count:[5 TO *]) + annotation:(type:cofactor count:[3 TO *]) + Lists all entries with: +
+
exactly 5 transmembrane regions
+
5 or more transmembrane regions
+
3 or more Cofactor comments
+
+
created + created:[20121001 TO *] reviewed:yes AND + created:[current TO *] + Lists all entries created since October 1st 2012.
Lists all new UniProtKB/Swiss-Prot entries in the last release. -
database - - database:(type:pfam) - - database:(type:pdb 1aut) - - - Lists all entries with: -
-
a cross-reference to the Pfam database
-
a cross-reference to the PDB database entry 1aut
-
- -
domain - - domain:VWFA - - - Lists all entries with a Von Willebrand factor type A domain described - in the 'Family and Domains' section. -
ec - - ec:3.2.1.23 - - - Lists all beta-galactosidases. -
evidence - - annotation:(type:signal evidence:ECO_0000269) - (type:mod_res phosphoserine evidence:ECO_0000269) - annotation:(type:function AND evidence:ECO_0000255) - - Lists all entries with: -
-
a signal sequence whose positions have been experimentally proven
-
experimentally proven phosphoserine sites
-
a function manually asserted according to rules
-
-
family - - family:serpin - - - Lists all entries belonging to the Serpin family of proteins. -
fragment - - fragment:yes - - - Lists all entries with an incomplete sequence. -
database + database:(type:pfam) database:(type:pdb 1aut) + Lists all entries with: +
+
a cross-reference to the Pfam database
+
a cross-reference to the PDB database entry 1aut
+
-
gene - - gene:HSPC233 - - - Lists all entries for proteins encoded by gene HSPC233. -
go - - go:cytoskeleton - - go:0015629 - - - Lists all entries associated with: -
-
a GO term containing the word "cytoskeleton"
-
the GO term Actin cytoskeleton and any subclasses
-
-
host - - host:mouse - - host:10090 - - host:40674 - - - Lists all entries for viruses infecting: -
-
organisms with a name containing the word "mouse"
-
Mus musculus (Mouse)
-
all mammals (all taxa classified under the taxonomy node for Mammalia)
-
-
id - id:P00750 - - Returns the entry with the primary - accession number P00750. -
inn - - inn:Anakinra - - - Lists all entries whose "International Nonproprietary Name" is Anakinra. -
interactor - - interactor:P00520 - - - Lists all entries describing interactions with the protein described by - entry P00520. -
keyword - - keyword:toxin - - - Lists all entries associated with the keyword Toxin. -
length - - length:[500 TO 700] - - - Lists all entries describing sequences of length between 500 and 700 residues. -
lineage - - This field is a synonym for the field taxonomy. -
mass - - mass:[500000 TO *] - - - Lists all entries describing sequences with a mass of at least 500,000 Da. -
method - - method:maldi - - method:xray - - - Lists all entries for proteins identified by: matrix-assisted laser - desorption/ionization (MALDI), crystallography (X-Ray). The - method field searches names of physico-chemical - identification methods in the 'Biophysicochemical properties' subsection of the 'Function' section, the 'Publications' and - 'Cross-references' sections. -
mnemonic - - mnemonic:ATP6_HUMAN - - - Lists all entries with entry name (ID) ATP6_HUMAN. Searches also - obsolete entry names. -
modified - - modified:[20120101 TO 20120301] - reviewed:yes AND modified:[current TO *] - - - Lists all entries that were last modified between January and March 2012.
- Lists all UniProtKB/Swiss-Prot entries modified in the last release. -
name - - name:"prion protein" - - - Lists all entries for prion proteins. -
organelle - - organelle:Mitochondrion - - - Lists all entries for proteins encoded by a gene of the mitochondrial - chromosome. -
organism - - organism:"Ovis aries" - - organism:9940 - - organism:sheep - - - - Lists all entries for proteins expressed in sheep (first 2 examples) and - organisms whose name contains the term "sheep". -
plasmid - - plasmid:ColE1 - - - Lists all entries for proteins encoded by a gene of plasmid ColE1. -
proteome - - proteome:UP000005640 - - - Lists all entries from the human proteome. -
proteomecomponent - - proteomecomponent:"chromosome 1" and organism:9606 - - - Lists all entries from the human chromosome 1. -
replaces - - replaces:P02023 - - - Lists all entries that were created from a merge with entry P02023. -
reviewed - - reviewed:yes - - - Lists all UniProtKB/Swiss-Prot entries. -
scope - - scope:mutagenesis - - - Lists all entries containing a reference that was used to gather - information about mutagenesis. -
sequence - - sequence:P05067-9 - - - Lists all entries containing a link to isoform 9 of the sequence - described in entry P05067. Allows searching by specific sequence - identifier. -
sequence_modified - - sequence_modified:[20120101 TO 20120301] - reviewed:yes AND sequence_modified:[current TO *] - - - Lists all entries whose sequences were last modified between January and March 2012.
- Lists all UniProtKB/Swiss-Prot entries whose sequences were modified in the last release. -
source - - source:intact - - - Lists all entries containing a GO term whose annotation source is the - IntAct database. -
strain - - strain:wistar - - - Lists all entries containing a reference relevant to strain wistar. -
taxonomy - - taxonomy:40674 - - - Lists all entries for proteins expressed in Mammals. This field is used to retrieve - entries for all organisms classified below a given taxonomic node taxonomy classification). -
tissue - - tissue:liver - - - Lists all entries containing a reference describing the protein sequence - obtained from a clone isolated from liver. -
web - - web:wikipedia - - - Lists all entries for proteins that are described in Wikipedia. -
+
domain domain:VWFA Lists all entries with a Von Willebrand factor type A + domain described in the 'Family and Domains' section.
ec ec:3.2.1.23 Lists all beta-galactosidases.
evidence + annotation:(type:signal evidence:ECO_0000269) + (type:mod_res phosphoserine evidence:ECO_0000269) + annotation:(type:function AND evidence:ECO_0000255) + Lists all entries with: +
+
a signal sequence whose positions have been + experimentally proven
+
experimentally proven phosphoserine sites
+
a function manually asserted according to rules
+
+
family family:serpin Lists all entries belonging to the Serpin family of + proteins.
fragment fragment:yes Lists all entries with an incomplete sequence.
gene gene:HSPC233 Lists all entries for proteins encoded by gene HSPC233.
go + go:cytoskeleton go:0015629 + Lists all entries associated with: +
+
a GO term containing the word "cytoskeleton"
+
the GO term Actin cytoskeleton and any subclasses
+
+
host + host:mouse host:10090 host:40674 + Lists all entries for viruses infecting: +
+
organisms with a name containing the word "mouse"
+
Mus musculus (Mouse)
+
all mammals (all taxa classified under the taxonomy + node for Mammalia)
+
+
id id:P00750 Returns the entry with the primary accession number + P00750.
inn inn:Anakinra Lists all entries whose "International Nonproprietary + Name" is Anakinra.
interactor interactor:P00520 Lists all entries describing interactions with the + protein described by entry P00520.
keyword keyword:toxin Lists all entries associated with the keyword Toxin.
length length:[500 TO 700] Lists all entries describing sequences of length between + 500 and 700 residues.
lineage + This field is a synonym for the field taxonomy. +
mass mass:[500000 TO *] Lists all entries describing sequences with a mass of at + least 500,000 Da.
method + method:maldi method:xray + Lists all entries for proteins identified by: + matrix-assisted laser desorption/ionization (MALDI), + crystallography (X-Ray). The method field searches + names of physico-chemical identification methods in the + 'Biophysicochemical properties' subsection of the 'Function' + section, the 'Publications' and 'Cross-references' sections. +
mnemonic mnemonic:ATP6_HUMAN Lists all entries with entry name (ID) ATP6_HUMAN. + Searches also obsolete entry names.
modified + modified:[20120101 TO 20120301] reviewed:yes AND + modified:[current TO *] + Lists all entries that were last modified between January + and March 2012.
Lists all UniProtKB/Swiss-Prot entries + modified in the last release. +
name name:"prion protein" Lists all entries for prion proteins.
organelle organelle:Mitochondrion Lists all entries for proteins encoded by a gene of the + mitochondrial chromosome.
organism + organism:"Ovis aries" organism:9940 + organism:sheep + Lists all entries for proteins expressed in sheep (first + 2 examples) and organisms whose name contains the term "sheep". +
plasmid plasmid:ColE1 Lists all entries for proteins encoded by a gene of + plasmid ColE1.
proteome proteome:UP000005640 Lists all entries from the human proteome.
proteomecomponent proteomecomponent:"chromosome 1" and + organism:9606 Lists all entries from the human chromosome 1.
replaces replaces:P02023 Lists all entries that were created from a merge with + entry P02023.
reviewed reviewed:yes Lists all UniProtKB/Swiss-Prot entries.
scope scope:mutagenesis Lists all entries containing a reference that was used to + gather information about mutagenesis.
sequence sequence:P05067-9 Lists all entries containing a link to isoform 9 of the + sequence described in entry P05067. Allows searching by specific + sequence identifier.
sequence_modified + sequence_modified:[20120101 TO 20120301] reviewed:yes + AND sequence_modified:[current TO *] + Lists all entries whose sequences were last modified + between January and March 2012.
Lists all + UniProtKB/Swiss-Prot entries whose sequences were modified in + the last release. +
source source:intact Lists all entries containing a GO term whose annotation + source is the IntAct database.
strain strain:wistar Lists all entries containing a reference relevant to + strain wistar.
taxonomy taxonomy:40674 Lists all entries for proteins expressed in Mammals. This + field is used to retrieve entries for all organisms classified + below a given taxonomic node taxonomy classification).
tissue tissue:liver Lists all entries containing a reference describing the + protein sequence obtained from a clone isolated from liver.
web web:wikipedia Lists all entries for proteins that are described in + Wikipedia.
\ No newline at end of file diff --git a/help/html/features/uniprotsequencefetcher.html b/help/html/features/uniprotsequencefetcher.html index b4b1d86..13c84db 100644 --- a/help/html/features/uniprotsequencefetcher.html +++ b/help/html/features/uniprotsequencefetcher.html @@ -67,11 +67,11 @@ mnt_mouse).
Hitting Return or OK will automatically fetch those IDs, like the default Sequence Fetcher interface. -
Complex queries with the UniProt query - Syntax The text box also allows complex queries to be entered. - The table below provides a brief overview of the supported syntax - (see query fields for - UniProtKB): +
Complex queries + with the UniProt query Syntax The text box also allows complex + queries to be entered. The table below provides a brief overview + of the supported syntax (see query + fields for UniProtKB): diff --git a/help/html/features/varna.html b/help/html/features/varna.html index ce446f3..77f56dc 100644 --- a/help/html/features/varna.html +++ b/help/html/features/varna.html @@ -27,9 +27,9 @@ The VARNA RNA Viewer
- VARNA was integrated - into Jalview 2.8 to allow interactive viewing of RNA secondary - structure annotation. It is opened by selecting the "Structure→View + VARNA was integrated into Jalview + 2.8 to allow interactive viewing of RNA secondary structure + annotation. It is opened by selecting the "Structure→View Structure:" option in the sequence id pop-up menu (if you can't see this, then no RNA structure is associated with your sequence or alignment). In the pop-up menu all @@ -86,8 +86,8 @@
VARNA is a very powerful RNA viewer on its own. Only the essentials have been described here - the interested reader is referred to VARNA's own comprehensive online documentation. + href="http://varna.lri.fr/index.php?page=manual&css=varna">VARNA's + own comprehensive online documentation.
diff --git a/help/html/features/viewingpdbs.html b/help/html/features/viewingpdbs.html index 9cead2d..21caca1 100755 --- a/help/html/features/viewingpdbs.html +++ b/help/html/features/viewingpdbs.html @@ -46,8 +46,8 @@
Selecting Structures
You can select - the structures that you want to open and view by selecting them with - the mouse and keyboard.
By default, if structures were + the structures that you want to open and view by selecting them + with the mouse and keyboard.
By default, if structures were discovered, then some will already be selected according to the criteria shown in the drop-down menu. The default criteria is 'highest resolution', simply choose another to pick structures in @@ -60,7 +60,8 @@ dialog box.

To view selected structures, click the "View" - button.
+ button. +

Additional structure data will be downloaded with the EMBL-EBI's dbfetch service
@@ -118,12 +119,12 @@ retrieved with this service are derived directly from the PDB 3D structure data, which can be viewed in the same way above. Secondary structure and temperature factor annotation can also be added.
- -
Jalview - will also read PDB files directly - either in PDB format, or mmCIF. Simply load in the file as you would - an alignment file. The sequences of any protein or nucleotide chains - will be extracted from the file and viewed in the alignment window. + +
Jalview will also read PDB files directly - either in PDB + format, or mmCIF. Simply load in the file + as you would an alignment file. The sequences of any protein or + nucleotide chains will be extracted from the file and viewed in the + alignment window.

@@ -156,7 +157,7 @@ Features" menu item and the Feature Settings dialog box.
-
+

Switching between mmCIF and PDB format for diff --git a/help/html/features/xsspannotation.html b/help/html/features/xsspannotation.html index 1c6ab7b..870b005 100644 --- a/help/html/features/xsspannotation.html +++ b/help/html/features/xsspannotation.html @@ -74,22 +74,20 @@ tab in the Tools→Preferences dialog allow the processing of structure data to be disabled, or selectively enabled. For more information, take a look at the documentation for the structure panel. + href="preferences.html#structure">documentation for the + structure panel.

The display of secondary structure data was introduced in Jalview 2.8.2, and is made possible by Jalview's use of Jmol's DSSP implementation, based on the original Kabsch and Sander algorithm ported by Robbie P. Joosten and colleagues, and a client for Fabrice Jossinet's pyRNA services that was developed by Anne - Menard, Jim Procter and Yann Ponty as part of the Jalview Summer - of Code 2012. + href="jmol.html">Jmol's DSSP implementation, based on the + original Kabsch + and Sander algorithm ported by Robbie P. Joosten + and colleagues, and a client for Fabrice + Jossinet's pyRNA services that was developed by Anne Menard, Jim + Procter and Yann Ponty as part of the Jalview Summer of Code 2012.
diff --git a/help/html/groovy/featureCounter.html b/help/html/groovy/featureCounter.html index fe848a9..2ebaf45 100644 --- a/help/html/groovy/featureCounter.html +++ b/help/html/groovy/featureCounter.html @@ -25,18 +25,25 @@
Extending Jalview with Groovy - A customisable - feature counter
-
The groovy script below shows how to add a new calculation - track to a Jalview alignment window.
As currently written, it will - add two tracks to a protein alignment view which count Pfam features - in each column, and ones where a charge residue also occur.
To try - it for yourself:
Copy and paste it into the groovy script - console
Load the example Feredoxin project (the one that opens - by default when you first launched Jalview)
Select Calculations→Execute - Groovy Script from the alignment window's menu bar to run the script on - the current view.
+ feature counter

The groovy script below shows how to + add a new calculation track to a Jalview alignment window. +
+
As currently written, it will add two tracks to a protein + alignment view which count Pfam features in each column, and ones + where a charge residue also occur.
+
To try it for yourself:
+
+
Copy and paste it into the groovy script console
+
Load the example Feredoxin project (the one that opens by + default when you first launched Jalview)
+
Select Calculations→Execute Groovy + Script from the alignment window's menu bar to run the script on + the current view. +
+
http://www.jalview.org/examples/groovy/featureCounter.groovy - rendered with hilite.me + href="http://www.jalview.org/examples/groovy/featureCounter.groovy">http://www.jalview.org/examples/groovy/featureCounter.groovy + - rendered with hilite.me
diff --git a/help/html/index.html b/help/html/index.html index 5bb9020..62b46a9 100755 --- a/help/html/index.html +++ b/help/html/index.html @@ -45,8 +45,7 @@
For more information, you might also want to take a look at the documentation section of the Jalview website (http://www.jalview.org/about/documentation). + href="http://www-test.jalview.org/about/documentation">http://www.jalview.org/about/documentation).

If you are using the Jalview Desktop application and are looking for @@ -55,8 +54,7 @@ google the online version of these pages. If you don't find what you are looking for, or want to report a bug or make a feature request, then get in contact over at http://www.jalview.org/community + href="http://www.jalview.org/community">http://www.jalview.org/community

@@ -70,8 +68,8 @@ 25 (9) 1189-1191 doi: 10.1093/bioinformatics/btp033

- The Jalview Authors
The following people have - contributed to Jalview's development: + The Jalview Authors
The following people + have contributed to Jalview's development:

Jalview 1
diff --git a/help/html/io/export.html b/help/html/io/export.html index 46e7fe4..8a554aa 100755 --- a/help/html/io/export.html +++ b/help/html/io/export.html @@ -25,8 +25,7 @@
Exporting alignments as graphics and lineart + name="export">

The alignment view can be printed using File→Print, diff --git a/help/html/io/exportseqreport.html b/help/html/io/exportseqreport.html index 46e2189..ba97557 100644 --- a/help/html/io/exportseqreport.html +++ b/help/html/io/exportseqreport.html @@ -43,8 +43,7 @@ menu.
+ alt="Sequence Annotation is displayed as HTML in a report window" />
Copying and pasting annotation to other programs
The File→Save option in the sequence diff --git a/help/html/io/fileformats.html b/help/html/io/fileformats.html index d887f18..af4e2c4 100755 --- a/help/html/io/fileformats.html +++ b/help/html/io/fileformats.html @@ -95,9 +95,9 @@ td {
+ '}'

See BioJSON for more + infomation about the Jalview JSON format
diff --git a/help/html/io/index.html b/help/html/io/index.html index d2196c1..b0d6b04 100755 --- a/help/html/io/index.html +++ b/help/html/io/index.html @@ -59,10 +59,9 @@
Jalview can also read Jalview specific files for sequence features and alignment annotation. + href="../features/featuresFormat.html">sequence features + and alignment + annotation.
Output diff --git a/help/html/io/modellerpir.html b/help/html/io/modellerpir.html index 1fc5f39..d6157fb 100755 --- a/help/html/io/modellerpir.html +++ b/help/html/io/modellerpir.html @@ -28,11 +28,10 @@
The homology modelling program, Modeller uses a special form of the PIR format where information - about sequence numbering and chain codes are written into the - 'description' line between the PIR protein tag and the protein - alignment entry: + href="http://salilab.org/modeller/">Modeller uses a + special form of the PIR format where information about sequence + numbering and chain codes are written into the 'description' line + between the PIR protein tag and the protein alignment entry:
>P1;Q93Z60_ARATH sequence:Q93Z60_ARATH:1:.:118:.:. @@ -52,12 +51,12 @@ KDPLPDAEDWDGVKGKLQHLE* no information is lost if this parsing process fails.

The 'Modeller Output' flag in the 'Output' tab of the Jalview Preferences dialog box controls whether Jalview will also output - MODELLER style PIR files. In this case, any existing 'non-modeller - PIR' header information in the description string of an alignment is - appended to an automatically generated modeller description line for - that sequence. + href="../features/preferences.html">Preferences dialog + box controls whether Jalview will also output MODELLER style PIR + files. In this case, any existing 'non-modeller PIR' header + information in the description string of an alignment is appended to + an automatically generated modeller description line for that + sequence.

The general format used for generating the Modeller/PIR sequence description line is shown below : diff --git a/help/html/io/tcoffeescores.html b/help/html/io/tcoffeescores.html index c8e5aec..08d1889 100644 --- a/help/html/io/tcoffeescores.html +++ b/help/html/io/tcoffeescores.html @@ -30,8 +30,8 @@ T-COFFEE score files like the one below can be displayed on the alignment using the Colours→T-COFFEE Scores or Colour → Colour by Annotation options. + href="../colourSchemes/annotationColouring.html">Colour + by Annotation options.

diff --git a/help/html/keys.html b/help/html/keys.html index f129551..2ba9a49 100755 --- a/help/html/keys.html +++ b/help/html/keys.html @@ -30,10 +30,10 @@ Jalview has two distinct modes of keyboard operation - in 'Normal' mode, single keystrokes (including those shown next to menu items) provide short cuts to common commands. In 'Cursor' mode (enabled by F2), some of these are - disabled and more complex 'Compound Keystrokes' can be entered to - perform precise navigation, selection and editing operations. + href="features/cursorMode.html">'Cursor' mode (enabled by + F2), some of these are disabled and more complex 'Compound + Keystrokes' can be entered to perform precise navigation, selection + and editing operations.

human antigen
JSON Data starts with '{'
Data ends with - '}'
-
See BioJSON - for more infomation about the Jalview JSON format
.json

@@ -279,7 +279,7 @@ columns are selected, you should use the H @@ -317,25 +317,22 @@ columns are selected, you should use the H + gaps at the current position.
Hold down + Control or Shift to insert gaps over a sequence group + gaps at the cursor position.
Hold down Control + or Shift to insert gaps over a sequence group + gaps at the cursor position.
Hold down Control + or Shift to insert gaps over a sequence group

Cursor Move cursor to a particular column (p1) and row (p2) in the alignment.
- e.g. '5,6<Return>' moves the cursor to the 5th + e.g. '5,6<Return>' moves the cursor to the 5th column in the 6th sequence.

[p]
Space Cursor Inserts one (or optionally p) - gaps at the current position.
- Hold down Control or Shift to insert gaps over a sequence - group

[p]
Delete
Cursor Removes one (or optionally p) - gaps at the cursor position.
- Hold down Control or Shift to insert gaps over a sequence - group

[p]
Backspace
Cursor Removes one (or optionally p) - gaps at the cursor position.
- Hold down Control or Shift to insert gaps over a sequence - group

diff --git a/help/html/memory.html b/help/html/memory.html index 9c856a9..2142f98 100755 --- a/help/html/memory.html +++ b/help/html/memory.html @@ -63,15 +63,13 @@ file. You can obtain a JNLP file with modified memory settings from our service with the following link (replace 2G with desired memory in G or M):
http://www.jalview.org/services/launchApp?jvm-max-heap=2G + href="http://www.jalview.org/services/launchApp?jvm-max-heap=2G">http://www.jalview.org/services/launchApp?jvm-max-heap=2G

Alternatively, if you want to create your own JNLP file then please download the latest JNLP file from http://www.jalview.org/webstart/jalview.jnlp and modify the - max-heap-size parameter for the j2se tag in the + href="http://www.jalview.org/webstart/jalview.jnlp">http://www.jalview.org/webstart/jalview.jnlp + and modify the max-heap-size parameter for the j2se tag in the <resources> element. e.g.
<j2se version="1.7+" initial-heap-size="500M" max-heap-size="1000M"/> @@ -109,6 +107,7 @@ lax.nl.java.option.java.heap.size.initial=500m The lines you need to change are in the Info.plist file inside the Jalview.app/Contents directory (which is where the installAnywhere installation was made) : +
<key&ht;VMOptions</key&ht; diff --git a/help/html/menus/alignmentMenu.html b/help/html/menus/alignmentMenu.html index 5739797..c8b2270 100755 --- a/help/html/menus/alignmentMenu.html +++ b/help/html/menus/alignmentMenu.html @@ -133,10 +133,9 @@

Load Features / Annotations
Load files describing precalculated sequence features or alignment annotations. + href="../features/featuresFormat.html">sequence + features or alignment + annotations.

Close (Control W)
Close the alignment window. Make sure you have saved your @@ -204,16 +203,14 @@ All columns which only contain gap characters ("-", ".") will be deleted.
You may set the default gap character in preferences. + href="../features/preferences.html">preferences.

Remove All Gaps (Control Shift E)
Gap characters ("-", ".") will be deleted from the selected area of the alignment. If no selection is made, ALL the gaps in the alignment will be removed.
You may set the default gap character in preferences. + href="../features/preferences.html">preferences.

Remove Redundancy (Control D)
Selecting this option brings up a window asking you to @@ -233,8 +230,7 @@ with alignment analysis programs which require 'properly aligned sequences' to be all the same length.
You may set the default for Pad Gaps in the preferences. + href="../features/preferences.html">preferences.

Select @@ -278,11 +274,10 @@ WARNING: This cannot be undone.

Select/Hide Columns by Annotation
Select - or Hide columns in the alignment according to secondary - structure, labels and values shown in alignment annotation - rows.
+ href="../features/columnFilterByAnnotation.html">Select/Hide + Columns by Annotation
Select or Hide + columns in the alignment according to secondary structure, + labels and values shown in alignment annotation rows.
View
@@ -310,11 +305,11 @@
Show Sequence Features
Show or hide sequence features on this alignment.

Sequence Feature Settings...
Opens - the Sequence Feature Settings dialog box to control the - colour and display of sequence features on the alignment, - and configure and retrieve features from DAS annotation + href="../features/featuresettings.html">Sequence + Feature Settings...
Opens the + Sequence Feature Settings dialog box to control the colour + and display of sequence features on the alignment, and + configure and retrieve features from DAS annotation servers.

Sequence ID Tooltip (application only)
This submenu's options allow the @@ -403,22 +398,21 @@ rendering.

Wrap
When ticked, the alignment display is "wrapped" to the width of the alignment window. This is - useful if your alignment has only a few sequences to view - its full width at once. + href="../features/wrap.html">wrapped" to + the width of the alignment window. This is useful if your + alignment has only a few sequences to view its full width at + once.
Additional options for display of sequence numbering and scales are also visible in wrapped layout mode:

-
Scale Above
- Show the alignment column position scale.
-
Scale Left
- Show the sequence position for the first aligned - residue in each row in the left column of the alignment.
-
Scale Right
- Show the sequence position for the last aligned - residue in each row in the right-most column of the - alignment.
+
Scale Above
+ Show the alignment column position scale.
+
Scale Left
Show + the sequence position for the first aligned residue in + each row in the left column of the alignment.
+
Scale Right
+ Show the sequence position for the last aligned residue + in each row in the right-most column of the alignment.

Show Sequence Limits
If this box is selected the sequence name will have the start and end position of the sequence appended to @@ -474,11 +468,10 @@ colour will be applied to all currently defined groups.

Colour Text...
Opens the Colour Text - dialog box to set a different text colour for light and dark - background, and the intensity threshold for transition between - them.
+ href="../colourSchemes/textcolour.html">Colour + Text...
Opens the Colour Text dialog box + to set a different text colour for light and dark background, + and the intensity threshold for transition between them.
Colour Scheme options: None, ClustalX, Blosum62 Score, Percentage Identity, Zappo, Taylor, Hydrophobicity, Helix Propensity, Strand Propensity, Turn @@ -507,8 +500,8 @@
By Annotation
Colours the alignment on a per-column value from a specified annotation. See Annotation Colouring. + href="../colourSchemes/annotationColouring.html">Annotation + Colouring.

By RNA Helices
Colours the helices of an RNA alignment loaded from a Stockholm file. @@ -563,14 +556,14 @@ provided in this menu.

Pairwise Alignments
Applies Smith and Waterman algorithm to selected sequences. See pairwise alignments. + href="../calculations/pairwise.html">pairwise + alignments.

Principal Component Analysis
Shows a spatial clustering of the sequences based on similarity scores calculated with the alignment. See Principal Component Analysis. + href="../calculations/pca.html">Principal + Component Analysis.

Extract Scores ... (optional)
This option is only visible if Jalview detects one or more @@ -626,15 +619,14 @@ or elsewhere. You need a continuous network connection in order to use these services through Jalview.

-
Alignment
- Align the currently selected sequences or all sequences - in the alignment, or re-align unaligned sequences to the - aligned sequences. Entries in this menu provide access to the - various alignment programs supported by JABAWS. See the Multiple - Sequence Alignment webservice client entry for more - information. +
Alignment
Align the + currently selected sequences or all sequences in the + alignment, or re-align unaligned sequences to the aligned + sequences. Entries in this menu provide access to the various + alignment programs supported by JABAWS. See the + Multiple Sequence + Alignment webservice client entry for more information.

Secondary Structure Prediction
@@ -667,8 +659,8 @@
Multi-Harmony
Performs functional residue analysis on a protein family alignment with sub-families defined on it. See the Multi-Harmony service entry for more information. + href="../webServices/shmr.html">Multi-Harmony + service entry for more information.

diff --git a/help/html/menus/alwannotation.html b/help/html/menus/alwannotation.html index 6f91d2f..8ac116b 100755 --- a/help/html/menus/alwannotation.html +++ b/help/html/menus/alwannotation.html @@ -25,8 +25,8 @@
- Alignment Window Annotations Menu Since Jalview - 2.8.2 + Alignment Window Annotations Menu Since + Jalview 2.8.2

Show Alignment Related
@@ -44,8 +44,7 @@ example, Consensus).

You can also selectively show or hide annotations from the Popup or Annotation menus. + href="../features/annotation.html">Annotation menus.

Sort by Sequence
Sort sequence-specific annotations by sequence order in the alignment diff --git a/help/html/menus/alwannotationpanel.html b/help/html/menus/alwannotationpanel.html index 7d07595..cd09693 100755 --- a/help/html/menus/alwannotationpanel.html +++ b/help/html/menus/alwannotationpanel.html @@ -29,11 +29,11 @@

Annotation Label Popup Menu
This menu is opened by clicking anywhere on the annotation row labels - area (below the sequence ID area). -
Mac Users: pressing CTRL whilst clicking - the mouse/track pad is the same as a right-click. See your - system's settings to configure your track-pad's corners to - generate right-clicks. + area (below the sequence ID area).
+ Mac Users: pressing CTRL whilst clicking + the mouse/track pad is the same as a right-click. See your + system's settings to configure your track-pad's corners to + generate right-clicks.

Add New Row
Adds a new, named annotation row (a dialog box will pop up for you diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html index 34e8d75..8032348 100755 --- a/help/html/menus/alwcalculate.html +++ b/help/html/menus/alwcalculate.html @@ -75,14 +75,14 @@

Pairwise Alignments
Applies Smith and Waterman algorithm to selected sequences. See pairwise alignments. + href="../calculations/pairwise.html">pairwise + alignments.

Principal Component Analysis
Shows a spatial clustering of the sequences based on similarity scores calculated over the alignment.. See Principal Component Analysis. + href="../calculations/pca.html">Principal Component + Analysis.

Extract Scores ... (optional)
This option is only visible if Jalview detects one or more @@ -91,27 +91,28 @@ parsed into sequence associated annotation which can then be used to sort the alignment via the Sort by→Score menu.
-
Translate as cDNA (not applet)
- This option is visible for nucleotide alignments. Selecting - this option shows the DNA's calculated protein product in a new - split frame window. - Note that the translation is not frame- or intron-aware; it - simply translates all codons in each sequence, using the - standard genetic code - (any incomplete final codon is discarded). You can perform this - action on the whole alignment, or selected rows, columns, or - regions. +
Translate as cDNA (not applet)
This + option is visible for nucleotide alignments. Selecting this + option shows the DNA's calculated protein product in a new split frame window. Note + that the translation is not frame- or intron-aware; it simply + translates all codons in each sequence, using the standard genetic code (any incomplete + final codon is discarded). You can perform this action on the + whole alignment, or selected rows, columns, or regions.

Reverse, Reverse Complement (not applet)
- These options are visible for nucleotide alignments. Selecting them adds the reverse (or reverse complement) - of the sequences (or selected region) as new sequences in the alignment. To try this out, add this sequence and - perform 'Reverse Complement' followed by 'Translate as cDNA': -
- Seq GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC - TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG + These options are visible for nucleotide alignments. + Selecting them adds the reverse (or reverse complement) of the + sequences (or selected region) as new sequences in the + alignment. To try this out, add this sequence and perform + 'Reverse Complement' followed by 'Translate as cDNA':
+ Seq + GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC + TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG

Get Cross-References (not applet)
- This option is visible where sequences have + This option is visible where sequences have cross-references to other standard databases; for example, an EMBL entry may have cross-references to one or more UNIPROT entries. Select the database to view all cross-referenced diff --git a/help/html/menus/alwedit.html b/help/html/menus/alwedit.html index 846a1bd..eb8e839 100755 --- a/help/html/menus/alwedit.html +++ b/help/html/menus/alwedit.html @@ -83,16 +83,14 @@ All columns which only contain gap characters ("-", ".") will be deleted.
You may set the default gap character in preferences. + href="../features/preferences.html">preferences.

Remove All Gaps (Control Shift E)
Gap characters ("-", ".") will be deleted from the selected area of the alignment. If no selection is made, ALL the gaps in the alignment will be removed.
You may set the default gap character in preferences. + href="../features/preferences.html">preferences.

Remove Redundancy (Control D)
Selecting this option brings up a window asking you to diff --git a/help/html/menus/alwfile.html b/help/html/menus/alwfile.html index bf1ba90..b8445af 100755 --- a/help/html/menus/alwfile.html +++ b/help/html/menus/alwfile.html @@ -32,8 +32,7 @@ dialog window in which you can select known ids from UniProt, EMBL, EMBLCDS, PDB, PFAM, or RFAM databases using Web Services provided by the European Bioinformatics Institute. See Sequence Fetcher + href="../features/seqfetch.html">Sequence Fetcher .

Add Sequences
Add sequences to the visible alignment from file, URL, or cut & @@ -86,9 +85,9 @@
Export Image
Creates an alignment graphic with the current view's annotation, alignment background colours and group colours. If the alignment is wrapped, the output will also be wrapped and will have the same - visible residue width as the open alignment. + href="../features/wrap.html">wrapped, the output will + also be wrapped and will have the same visible residue width as + the open alignment.

HTML
Create a web page from @@ -126,10 +125,9 @@

Load Features / Annotations
Load files describing precalculated sequence features or alignment annotations. + href="../features/featuresFormat.html">sequence + features or alignment + annotations.

Close (Control W)
Close the alignment window. Make sure you have saved your alignment diff --git a/help/html/menus/alwformat.html b/help/html/menus/alwformat.html index a7cee0b..092e623 100644 --- a/help/html/menus/alwformat.html +++ b/help/html/menus/alwformat.html @@ -30,11 +30,11 @@ for faster alignment rendering.

Wrap
When ticked, the alignment display is "wrapped" to the width of the alignment window. This is - useful if your alignment has only a few sequences to view its full - width at once.
Additional options for display of sequence - numbering and scales are also visible in wrapped layout mode: + href="../features/wrap.html">wrapped" to the width + of the alignment window. This is useful if your alignment has only + a few sequences to view its full width at once.
+ Additional options for display of sequence numbering and scales + are also visible in wrapped layout mode:

Scale Left
Show the diff --git a/help/html/menus/alwselect.html b/help/html/menus/alwselect.html index a80f239..b93f85b 100644 --- a/help/html/menus/alwselect.html +++ b/help/html/menus/alwselect.html @@ -63,10 +63,10 @@ WARNING: This cannot be undone.

Select/Hide Columns by Annotation
Select or - Hide columns in the alignment according to secondary structure, - labels and values shown in alignment annotation rows.
+ href="../features/columnFilterByAnnotation.html">Select/Hide + Columns by Annotation
Select or Hide columns + in the alignment according to secondary structure, labels and + values shown in alignment annotation rows.
diff --git a/help/html/menus/desktopMenu.html b/help/html/menus/desktopMenu.html index 1ccbbcf..20e784b 100755 --- a/help/html/menus/desktopMenu.html +++ b/help/html/menus/desktopMenu.html @@ -48,8 +48,8 @@
Save Project
Saves all currently open alignment windows with their current view settings and any associated trees, as a Jalview Archive (which has a .jar extension). + href="../features/jalarchive.html">Jalview + Archive (which has a .jar extension).

Load Project
Loads Jalview archives only. @@ -129,9 +129,9 @@ window to the top of the pile when it is selected.

Close All
Close all - alignment and analysis windows.
- Note: This will erase all alignments from - memory, and cannot be undone!
+ alignment and analysis windows.
Note: + This will erase all alignments from memory, and cannot be + undone!
Raise Associated Windows
Bring all windows associated with the current alignment to the top of the pile.
diff --git a/help/html/menus/index.html b/help/html/menus/index.html index fcfcdae..d799378 100755 --- a/help/html/menus/index.html +++ b/help/html/menus/index.html @@ -41,11 +41,10 @@
The Popup Menus are opened by clicking with the right mouse button in the alignment display area or on a - sequence label in the alignment window.
- Mac Users: pressing CTRL whilst clicking - the mouse/track pad is the same as a right-click. See your - system's settings to configure your track-pad's corners to - generate right-clicks. + sequence label in the alignment window.
Mac + Users: pressing CTRL whilst clicking the mouse/track pad is the + same as a right-click. See your system's settings to configure + your track-pad's corners to generate right-clicks.

The Annotations Menu is opened diff --git a/help/html/menus/popupMenu.html b/help/html/menus/popupMenu.html index 79e7ada..d42f854 100755 --- a/help/html/menus/popupMenu.html +++ b/help/html/menus/popupMenu.html @@ -25,13 +25,13 @@
- Popup Menu
This menu is visible when - right clicking either within a selected region on the alignment or - on a selected sequence name. It may not be accessible when in - 'Cursor Mode' (toggled with the F2 key).
Mac Users: pressing CTRL whilst clicking - the mouse/track pad is the same as a right-click. See your - system's settings to configure your track-pad's corners to - generate right-clicks. + Popup Menu
This menu is visible + when right clicking either within a selected region on the + alignment or on a selected sequence name. It may not be accessible + when in 'Cursor Mode' (toggled with the F2 key).
Mac + Users: pressing CTRL whilst clicking the mouse/track pad is the + same as a right-click. See your system's settings to configure + your track-pad's corners to generate right-clicks.

Selection @@ -39,9 +39,9 @@
Sequence Details...
(Since Jalview 2.8)
Open an HTML report containing the annotation and database cross - references normally shown in the sequence's tooltip. + href="../io/exportseqreport.html">HTML report + containing the annotation and database cross references normally + shown in the sequence's tooltip.

Show Annotations...
Choose to show (unhide) either All or a selected type @@ -81,10 +81,10 @@ The selection area will be output to a a text window in the selected alignment format.

Create Sequence Feature...
Opens the - dialog box for creating sequence features over the currently - selected region on each selected sequence.
+ href="../features/creatinFeatures.html">Create + Sequence Feature...
Opens the dialog box + for creating sequence features over the currently selected + region on each selected sequence.
Create Group
This will define a new group from the current selection.
@@ -137,9 +137,9 @@
Sequence Details ...
(Since Jalview 2.8)
Open an HTML report containing the annotation and database cross - references normally shown in the sequence's tooltip. + href="../io/exportseqreport.html">HTML report + containing the annotation and database cross references + normally shown in the sequence's tooltip.

Edit Name/Description
You may edit the name and description of each sequence. @@ -147,12 +147,14 @@ and sequence description to be entered. Press OK to accept your edit. To save sequence descriptions, you must save in Fasta, PIR or Jalview File format.
-
Add Reference Annotations
- When enabled, copies any available alignment - annotation for this sequence to the current view.
+
Add Reference + Annotations
When enabled, copies any + available alignment annotation for this sequence to the + current view.

Set as Reference or Unmark - as Reference
Sets or unsets the reference sequence for - the the alignment.
+ as Reference
Sets or unsets the reference sequence + for the the alignment.
Represent Group With (Sequence Id)
All sequences in the current selection group will be @@ -165,27 +167,26 @@ Connections tab.
Since Jalview 2.4, links will also be made for database cross references (where the database name exactly matches the link name set up in Preferences).
Since Jalview 2.5, links are also - shown for non-positional sequence features attached to the - sequence, and any regular-expression based URL links that - matched the description line. + href="../features/preferences.html">Preferences). +
Since Jalview 2.5, links are also shown for + non-positional sequence features attached to the sequence, + and any regular-expression based URL links that matched + the description line.

3D Structure Data... This menu is visible when you right-click on a sequence name. When this option is clicked, Jalview will open the 'Structure - Chooser' , which allows you to discover and view 3D structures - for the current selection. For more info, see 'Structure Chooser' + , which allows you to discover and view 3D structures for the + current selection. For more info, see viewing PDB structures.
-
VARNA 2D Structure
- If the sequence or alignment has RNA structure, then VARNA +
VARNA 2D Structure
If the + sequence or alignment has RNA structure, then VARNA 2D Structure entries will also be present enabling you to open a linked view of the RNA structure in VARNA. + href="../features/varna.html">VARNA.

Hide Insertions
Hides columns containing gaps in the current sequence or diff --git a/help/html/menus/wsmenu.html b/help/html/menus/wsmenu.html index ee44c91..33282e9 100755 --- a/help/html/menus/wsmenu.html +++ b/help/html/menus/wsmenu.html @@ -55,13 +55,12 @@ elsewhere. You need a continuous network connection in order to use these services through Jalview.

-
Alignment
- Align the currently selected sequences or all sequences in - the alignment, or re-align unaligned sequences to the aligned - sequences. Entries in this menu provide access to the various - alignment programs supported by JABAWS. See the Multiple +
Alignment
Align the + currently selected sequences or all sequences in the alignment, + or re-align unaligned sequences to the aligned sequences. + Entries in this menu provide access to the various alignment + programs supported by JABAWS. + See the Multiple Sequence Alignment webservice client entry for more information.
@@ -96,8 +95,8 @@
Multi-Harmony
Performs functional residue analysis on a protein family alignment with sub-families defined on it. See the Multi-Harmony service entry for more information. + href="../webServices/shmr.html">Multi-Harmony + service entry for more information.

diff --git a/help/html/na/index.html b/help/html/na/index.html index 1d17058..2d5aa08 100644 --- a/help/html/na/index.html +++ b/help/html/na/index.html @@ -57,17 +57,16 @@ td { way:

RFAM - Sequences can be fetched from the RFAM database by accession number or ID.
+ href="../features/seqfetch.html">fetched from the RFAM + database by accession number or ID.
Stockholm files - WUSS (or VIENNA) dot-bracket notation found in the secondary structure annotation line will be imported as sequence or alignment associated secondary structure annotation.

Clustal files - certain RNA alignment programs, - such as LocaRNA output consensus RNA secondary structure lines in the - line normally reserved for the Clustal consensus line in a clustal + such as LocaRNA + output consensus RNA secondary structure lines in the line + normally reserved for the Clustal consensus line in a clustal file.

RNAML Jalview can import RNAML files containing sequences and extended secondary structure annotation derived from @@ -103,9 +102,9 @@ td { per-sequence secondary structure is available).

- Pseudo-knots
Jalview 2.8.2 introduced limited - support for working with structures including pseudoknots. Where - possible, extended WUSS symbols (e.g. different types of + Pseudo-knots
Jalview 2.8.2 introduced + limited support for working with structures including pseudoknots. + Where possible, extended WUSS symbols (e.g. different types of parentheses, or upper and lower case letters) are preserved when parsing RNA structure annotation and will be shaded differently when displayed in the structure.
Extended WUSS annotation is also diff --git a/help/html/privacy.html b/help/html/privacy.html index 5c6939a..37ae169 100644 --- a/help/html/privacy.html +++ b/help/html/privacy.html @@ -38,8 +38,7 @@
HTTP logs on the Jalview website
We record IP addresses of machines which access the web site, either via the browser when downloading the application, or when the - Jalview Desktop user interface is launched.
-
+ Jalview Desktop user interface is launched.

The JNLP file at www.jalview.org/webstart/jalview.jnlp is retrieved to @@ -53,8 +52,7 @@ interactions with the public Jalview web services are logged, but we delete all job data (input data and results) after about two weeks.
-
-
+

Google Analytics
Since Jalview 2.4.0b2, the Jalview Desktop records usage data with Google Analytics via the JGoogleAnalytics @@ -70,12 +68,11 @@ run Jalview in 'headless mode' via the command line, then the program shouldn't try to contact any of the web servers mentioned above (if it does, then it's a bug!). You can also specify some command line options to disable the questionnaire and usage - statistics check. Finally, the Connections Tab of the Jalview preferences contains options for - controlling the submission of usage statistics. + href="features/commandline.html">command line options to + disable the questionnaire and usage statistics check. Finally, the Connections + Tab of the Jalview preferences contains options for controlling + the submission of usage statistics.
Other Web Clients in Jalview
The Jalview desktop is intended to make it easier to interact with web-based diff --git a/help/html/vamsas/index.html b/help/html/vamsas/index.html index 73090d0..72a336a 100644 --- a/help/html/vamsas/index.html +++ b/help/html/vamsas/index.html @@ -33,15 +33,14 @@ and Analysis of Molecular Sequences, Alignements and Structures). Currently, the only other VAMSAS enabled application is TOPALi - a user friendly program for phylogenetics and - evolutionary analysis. + href="http://www.topali.org">TOPALi - a user friendly + program for phylogenetics and evolutionary analysis.
VAMSAS enabled applications access a shared bioinformatics dataset containing sequences, alignments, annotation and trees, which can be represented by an XML document analogous to a Jalview Project Archive. + href="../features/jalarchive.html">Jalview Project + Archive.

Connecting to a VAMSAS session diff --git a/help/html/webServices/AACon.html b/help/html/webServices/AACon.html index 6d4a461..5cec67d 100644 --- a/help/html/webServices/AACon.html +++ b/help/html/webServices/AACon.html @@ -30,13 +30,13 @@ The majority of these scores were described by Valdar in 2002 (Scoring residue conservation. Proteins: Structure, Function, and Genetics 43(2): 227-241. PubMed or available on the Valdar Group publications page), but the SMERFs score was - developed later and described by Manning et al. in 2008 (BMC Bioinformatics 2008, 9:51 doi:10.1186/1471-2105-9-51). + href="http://www.ncbi.nlm.nih.gov/pubmed/12112692">PubMed + or available on the Valdar + Group publications page), but the SMERFs score was developed later + and described by Manning et al. in 2008 (BMC + Bioinformatics 2008, 9:51 doi:10.1186/1471-2105-9-51).

Enabling and disabling AACon calculations
@@ -49,14 +49,13 @@ Configuring which AACon calculations are performed
The Web Services→Conservation→Change AACon Settings ... menu entry will open a web services parameter dialog for the currently configured AACon - server. Standard presets are provided for quick and more expensive - conservation calculations, and parameters are also provided to - change the way that SMERFS calculations are performed.
AACon - settings for an alignment are saved in Jalview projects along with the latest calculation results. + href="webServicesParams.html">web services parameter + dialog for the currently configured AACon server. Standard presets + are provided for quick and more expensive conservation calculations, + and parameters are also provided to change the way that SMERFS + calculations are performed.
AACon settings for an + alignment are saved in Jalview + projects along with the latest calculation results.

diff --git a/help/html/webServices/JABAWS.html b/help/html/webServices/JABAWS.html index 6750b55..f74e4c4 100644 --- a/help/html/webServices/JABAWS.html +++ b/help/html/webServices/JABAWS.html @@ -42,8 +42,7 @@ the Web Services Preferences Panel, and detailed information about a particular service is available from the help text and web pages accessible from its job parameters dialog box. + href="webServicesParams.html">job parameters dialog box.

Obtaining JABAWS
One of the aims of JABAWS @@ -53,21 +52,21 @@ stand-alone execution of analysis programs, or as a job submission engine - enabling larger numbers of jobs to be handled. If you would like to download and install JABAWS for your own use, please go to http://www.compbio.dundee.ac.uk/jabaws for more information. + href="http://www.compbio.dundee.ac.uk/jabaws">http://www.compbio.dundee.ac.uk/jabaws + for more information.

Configuring your own JABAWS services for use by Jalview
Once you have downloaded and installed JABAWS, and verified it is working, all that is needed is to add the URL for your JABAWS server(s) to the list in the Web Services Preferences Panel. After adding your service and - saving your preferences or hitting the 'refresh web services' - button, you should be able to submit jobs to the server via the - alignment window's web services menu. Your JABAWS servers list is - stored in your Jalview preferences, so you will only have to - configure Jalview once for each new server. + href="webServicesPrefs.html">Web Services Preferences + Panel. After adding your service and saving your preferences or + hitting the 'refresh web services' button, you should be able to + submit jobs to the server via the alignment window's web services + menu. Your JABAWS servers list is stored in your Jalview + preferences, so you will only have to configure Jalview once for + each new server.

Support for accessing JABAWS servers was introduced in diff --git a/help/html/webServices/RNAalifold.html b/help/html/webServices/RNAalifold.html index 432e0a6..36e43aa 100644 --- a/help/html/webServices/RNAalifold.html +++ b/help/html/webServices/RNAalifold.html @@ -36,8 +36,7 @@ Gruber, and Peter F. Stadler, RNAalifold: Improved consensus structure prediction for RNA alignments (BMC Bioinformatics, 9:474, 2008). Download the paper at http://www.biomedcentral.com/1471-2105/9/474. + href="http://www.biomedcentral.com/1471-2105/9/474">http://www.biomedcentral.com/1471-2105/9/474.

Running RNAalifold from Jalview
@@ -54,8 +53,7 @@ RNAalifold prediction parameters
JABAWS and Jalview only provide access to a selection of the RNAalifold arguments. For a full description, see the documentation at http://www.tbi.univie.ac.at/RNA/RNAalifold.html. + href="http://www.tbi.univie.ac.at/RNA/RNAalifold.html">http://www.tbi.univie.ac.at/RNA/RNAalifold.html.

Supported Arguments which give alternate structures @@ -75,8 +73,7 @@ Calculate an MEA structure where the expected Accuracy is computed from the base pair probabilities. A more detailed description can be found in the RNAfold program documentation at http://www.tbi.univie.ac.at/RNA/RNAfold.html. + href="http://www.tbi.univie.ac.at/RNA/RNAfold.html">http://www.tbi.univie.ac.at/RNA/RNAfold.html.

Example RNAalifold Structure Annotation rows diff --git a/help/html/webServices/dbreffetcher.html b/help/html/webServices/dbreffetcher.html index 632e993..52220d2 100644 --- a/help/html/webServices/dbreffetcher.html +++ b/help/html/webServices/dbreffetcher.html @@ -28,10 +28,10 @@ Database references are associated with a sequence are displayed as a list in the tooltip shown when mousing over its sequence ID. Jalview uses references for the retrieval of PDB structures and DAS - features, and for retrieving sequence cross-references such as the - protein products of a DNA sequence. + href="../features/viewingpdbs.html">PDB structures and DAS features, and for + retrieving sequence cross-references such as the protein products of a + DNA sequence.

Initiating reference retrieval
The @@ -68,9 +68,9 @@ and was originally restricted to the identification of valid UniProt accessions.
Essentially, Jalview will try to retrieve records from a subset of the databases accessible by the sequence fetcher using each sequence's ID string (or each string in - the ID separated by the '∣' symbol). + href="../features/seqfetch.html">sequence fetcher using each + sequence's ID string (or each string in the ID separated by the + '∣' symbol).

If a record (or set of records) is retrieved by any query derived from the ID string of a sequence, then the sequence is aligned to the diff --git a/help/html/webServices/index.html b/help/html/webServices/index.html index 1463554..d0b497c 100755 --- a/help/html/webServices/index.html +++ b/help/html/webServices/index.html @@ -49,15 +49,14 @@

Programs for multiple sequence alignment, made available via Java Bioinformatic Analysis Web Service (JABAWS) servers. + href="JABAWS.html">Java Bioinformatic Analysis + Web Service (JABAWS) servers.

Jalview SOAP Web Services for secondary structure prediction based at the University of Dundee.

Services for alignment analysis, such as Multi-Harmony. + href="shmr.html">Multi-Harmony.

Web Service Dialog Box @@ -67,10 +66,9 @@ citation information, and monitors the progress of the calculation. The cancel button will permanently cancel the job, but this is only possible for some services.
The Web Services Preference panel controls the display and appearance - of the submission and analysis services in the Web - Services menu. + href="webServicesPrefs.html">Web Services Preference + panel controls the display and appearance of the submission and + analysis services in the Web Services menu.

If Jalview encounters problems accessing any services, it may display a warning @@ -82,17 +80,14 @@
More about Jalview's Web Services
Jalview's distributed computations utilise SOAP and REST web services exposing sequence alignment, analysis, and - secondary structure prediction programs. Originally, Jalview 2's - services were maintained by the Barton group at the University of - Dundee, and ran programs on the Life Sciences High-performance - Computing Cluster. With the advent of JABAWS, however, it is possible for anyone to host Jalview web - services. + href="http://en.wikipedia.org/wiki/SOAP">SOAP and REST + web services exposing sequence alignment, analysis, and secondary + structure prediction programs. Originally, Jalview 2's services were + maintained by the Barton group at the University of Dundee, and ran + programs on the Life Sciences High-performance Computing Cluster. + With the advent of JABAWS, + however, it is possible for anyone to host Jalview web services.
diff --git a/help/html/webServices/jnet.html b/help/html/webServices/jnet.html index 0dfbd10..396a3a7 100755 --- a/help/html/webServices/jnet.html +++ b/help/html/webServices/jnet.html @@ -38,8 +38,7 @@ JPred4: a protein secondary structure prediction server
Nucleic Acids Research, Web Server issue (first published 15th April 2015)
http://dx.doi.org/10.1093/nar/gkv332 + href="http://dx.doi.org/10.1093/nar/gkv332">http://dx.doi.org/10.1093/nar/gkv332

Cole C., Barber J.D. and Barton G.J. (2008) The Jpred 3 secondary structure prediction server Nucleic Acids @@ -127,8 +126,8 @@
JNet annotation created in Jalview 2.8.2 and later versions can be displayed on other alignments via the Add reference annotation Sequence ID popup menu option. + href="../features/annotation.html#seqannots">Add reference + annotation Sequence ID popup menu option. As of Jalview 2.6, the Jnet service accessed accessed via the 'Secondary structure prediction' submenu should be considered a diff --git a/help/html/webServices/msaclient.html b/help/html/webServices/msaclient.html index 6266036..2fbbdbc 100644 --- a/help/html/webServices/msaclient.html +++ b/help/html/webServices/msaclient.html @@ -63,8 +63,8 @@
Muscle (version 3.8.31)

Tcoffee (version 8.99)
+ href="http://www.tcoffee.org/Projects_home_page/t_coffee_home_page.html">Tcoffee + (version 8.99)
Probcons (version 1.12)

@@ -74,12 +74,11 @@ Multiple Alignments of Sequences with hidden columns
Multiple alignment services are 'column separable' analysis operations. If the input contains hidden columns then each visible segment of the input sequence - set will be submitted for alignment separately, and the results - concatenated (with the hidden regions preserved) once all alignment - functions have completed. Each sub-job's state is reported in its - own tab: + href="../features/hiddenRegions.html">hidden columns then + each visible segment of the input sequence set will be submitted for + alignment separately, and the results concatenated (with the hidden + regions preserved) once all alignment functions have completed. Each + sub-job's state is reported in its own tab:

Multiple Multiple Sequence Alignment sub jobs diff --git a/help/html/webServices/newsreader.html b/help/html/webServices/newsreader.html index 1f2b7c9..c3c1d3f 100644 --- a/help/html/webServices/newsreader.html +++ b/help/html/webServices/newsreader.html @@ -25,26 +25,32 @@
The Jalview Desktop RSS News Reader
The Jalview Desktop includes a built in news reader for the Jalview Desktop News Channel. + href="http://www.jalview.org/feeds/desktop/rss">Jalview + Desktop News Channel.

We will use the desktop news channel to keep you informed of important updates relevant to users of the Jalview desktop, such as web service outages and user community events.
-
The news reader will be launched automatically when you start - the Desktop if new items are available. Should you want to browse - older items, however, you can open it manually from the 'Jalview - news reader' option in the Desktop's 'Tools' menu.

-
+
+ The news reader will be launched automatically when you start the + Desktop if new items are available. Should you want to browse older + items, however, you can open it manually from the 'Jalview news + reader' option in the Desktop's 'Tools' + menu. +
+
+
+ +
-
+
+
The Jalview news reader was introduced in Jalview version 2.7. Its implementation is based on JSwingReader. + href="http://www.jalview.org/releaseHistory.html#Jalview2.7">Jalview + version 2.7. Its implementation is based on JSwingReader.

If you need to prevent the news-reader opening, then add the diff --git a/help/html/webServices/proteinDisorder.html b/help/html/webServices/proteinDisorder.html index 2c98139..1c35bf3 100644 --- a/help/html/webServices/proteinDisorder.html +++ b/help/html/webServices/proteinDisorder.html @@ -28,26 +28,25 @@ The Web Services→Disorder menu in the alignment window allows access to protein disorder prediction services provided by the configured JABAWS servers. Each service operates on sequences in the - alignment or currently selected region (since Jalview - 2.8.0b1) to identify regions likely to be unstructured or - flexible, or alternately, fold to form globular domains. + href="http://www.compbio.dundee.ac.uk/jabaws">JABAWS + servers. Each service operates on sequences in the alignment or + currently selected region (since Jalview 2.8.0b1) to + identify regions likely to be unstructured or flexible, or + alternately, fold to form globular domains.

Predictor results include both sequence features and sequence associated alignment annotation rows. Features display is controlled from - the Feature Settings + href="../features/seqfeatures.html">sequence features and + sequence associated alignment + annotation rows. Features display is controlled from the Feature Settings dialog box. Clicking on the ID for a disorder prediction annotation row will highlight or select (if double clicked) the associated sequence for that row. You can also use the Sequence Associated option in the Colour By Annotation dialog box to colour sequences according to - the results of predictors shown as annotation rows. + href="../colourSchemes/annotationColouring.html">Colour + By Annotation dialog box to colour sequences according to the + results of predictors shown as annotation rows.

JABAWS 2.0 provides four disorder predictors which are described below:
@@ -74,10 +73,10 @@ Sequence Feature &
Annotation Row Predicts loops/coils according to DSSP definition[1].
Features mark range(s) of residues predicted as - loops/coils, and annotation row gives raw value for each - residue. Value over 0.516 indicates loop/coil. + href="#dsspstates">[1].
Features mark range(s) + of residues predicted as loops/coils, and annotation row gives + raw value for each residue. Value over 0.516 indicates + loop/coil. @@ -117,13 +116,13 @@ RONN a.k.a. Regional Order Neural Network
This - predictor employs an approach known as the 'bio-basis' method to - predict regions of disorder in sequences based on their local - similarity with a gold-standard set of disordered protein sequences. - It yields a set of disorder prediction scores, which are shown as - sequence annotation below the alignment. + href="http://www.strubi.ox.ac.uk/RONN">RONN a.k.a. + Regional Order Neural Network
This predictor employs an + approach known as the 'bio-basis' method to predict regions of + disorder in sequences based on their local similarity with a + gold-standard set of disordered protein sequences. It yields a set + of disorder prediction scores, which are shown as sequence + annotation below the alignment.
@@ -147,14 +146,13 @@
IUPred
IUPred employs an empirical model to estimate - likely regions of disorder. There are three different prediction - types offered, each using different parameters optimized for - slightly different applications. It provides raw scores based on two - models for predicting regions of 'long disorder' and 'short - disorder'. A third predictor identifies regions likely to form - structured domains. + href="http://iupred.enzim.hu/Help.php">IUPred
+ IUPred employs an empirical model to estimate likely regions of + disorder. There are three different prediction types offered, each + using different parameters optimized for slightly different + applications. It provides raw scores based on two models for + predicting regions of 'long disorder' and 'short disorder'. A third + predictor identifies regions likely to form structured domains.

@@ -196,17 +194,16 @@

GLOBPLOT
Defines regions of globularity or natively - unstructured regions based on a running sum of the propensity of - residues to be structured or unstructured. The propensity is - calculated based on the probability of each amino acid being - observed within well defined regions of secondary structure or - within regions of random coil. The initial signal is smoothed with a - Savitzky-Golay filter, and its first order derivative computed. - Residues for which the first order derivative is positive are - designated as natively unstructured, whereas those with negative - values are structured.
+ href="http://globplot.embl.de/">GLOBPLOT
Defines + regions of globularity or natively unstructured regions based on a + running sum of the propensity of residues to be structured or + unstructured. The propensity is calculated based on the probability + of each amino acid being observed within well defined regions of + secondary structure or within regions of random coil. The initial + signal is smoothed with a Savitzky-Golay filter, and its first order + derivative computed. Residues for which the first order derivative + is positive are designated as natively unstructured, whereas those + with negative values are structured.
diff --git a/help/html/webServices/shmr.html b/help/html/webServices/shmr.html index 29e2c1e..7f2091a 100755 --- a/help/html/webServices/shmr.html +++ b/help/html/webServices/shmr.html @@ -38,31 +38,29 @@ a protein sequence multiple alignment that has been sub-divided into groups containing at least two non-identical protein sequences. An easy way to create groups is to use the built-in neighbour-joining or UPGMA tree routines to calculate a tree for - the alignment, and then click on the tree to subdivide the - alignment. + href="../calculations/tree.html">neighbour-joining or + UPGMA tree routines to calculate a tree for the alignment, and + then click on the tree to subdivide the alignment.
The SHMR service operates on the currently selected visible region(s) of the alignment. Once submitted, a job progress window will display status information about your job, including a URL which allows you to visit the status page on the IBIVU SHMR server. + href="http://zeus.few.vu.nl/programs/shmrwww/">IBIVU SHMR + server.
When the job is complete, Jalview will automatically open a new window containing the alignment and groups that were submitted for analysis, with additional histograms added portraying the SHMR scores for each column of the sub-grouped alignment.
- If you use this service in your work, please cite :
- Brandt, B.W.*, Feenstra, K.A*. and Heringa, J. + If you use this service in your work, please cite :
Brandt, B.W.*, Feenstra, K.A*. and Heringa, J. (2010) Multi-Harmony: detecting functional specificity from sequence alignment. Nucleic Acids Res. 38: W35-W40. (* joint first authors) - + href="http://nar.oxfordjournals.org/cgi/content/abstract/gkq415">Nucleic + Acids Res. 38: W35-W40. (* joint first authors)
Note: The Multi-Harmony service is implemented with a prototype of Jalview's RESTful web service client diff --git a/help/html/webServices/urllinks.html b/help/html/webServices/urllinks.html index 7a23d58..0a4c650 100644 --- a/help/html/webServices/urllinks.html +++ b/help/html/webServices/urllinks.html @@ -29,8 +29,7 @@ your web browser.
Double-clicking on the ID of a sequence will open the first URL that can be generated from its sequence ID. This is often the SRS site, but you can easily configure your own sequence URL links. + href="#urllinks">sequence URL links.
Other links for a sequence either derived from any other configured @@ -41,12 +40,12 @@
Configuring URL Links
URL links are defined in the "Connections" tab of the Jalview desktop preferences, or specified as applet parameters.
By default the item "SRS" - is added to this link menu. This link will show a web page in your - default browser with the selected sequence id as part of the URL.
+ href="../features/preferences.html">Jalview desktop + preferences, or specified as applet + parameters.
By default the item "SRS" is added + to this link menu. This link will show a web page in your default + browser with the selected sequence id as part of the URL.
In the preferences dialog box, click new to add a new link, and edit to modify an existing link, or delete to remove it.
You can name the link, this will be displayed diff --git a/help/html/webServices/webServicesParams.html b/help/html/webServices/webServicesParams.html index 585cdfb..84eccc3 100644 --- a/help/html/webServices/webServicesParams.html +++ b/help/html/webServices/webServicesParams.html @@ -29,13 +29,12 @@
Some Jalview services, including those provided by JABAWS, support a range of parameters and options, enabling you - to employ the most appropriate settings for the input data. In - addition to any preset combinations provided by services themselves, - the Web services parameters dialog box also allows you to create and - store your own parameter sets, so they can be accessed quickly from - the presets menu. + href="JABAWS.html">JABAWS, support a range of parameters + and options, enabling you to employ the most appropriate settings + for the input data. In addition to any preset combinations provided + by services themselves, the Web services parameters dialog box also + allows you to create and store your own parameter sets, so they can + be accessed quickly from the presets menu.
Accessing the parameter dialog box
The @@ -61,8 +60,8 @@

Parameter settings dialog box for JABAWS MAFFT Service + alt="Analysis Parameters Dialog Box for JABAWS Services"> +
Parameter settings dialog box for JABAWS MAFFT Service
The menu and text box at the top of the dialog box displays the @@ -73,6 +72,7 @@ this), allowing you to provide notes to accompany the parameter set. The modification of these or any of the option or parameter settings will enable one or more of the following buttons, that allow you to: +

Revert the changes you have made. This will undo diff --git a/help/html/webServices/webServicesPrefs.html b/help/html/webServices/webServicesPrefs.html index 1950058..0ebeea5 100644 --- a/help/html/webServices/webServicesPrefs.html +++ b/help/html/webServices/webServicesPrefs.html @@ -38,8 +38,8 @@

Web Services Preference Panel + alt="Web Services Preferences Panel" width="571" height="461">
+ Web Services Preference Panel

@@ -85,8 +85,8 @@

Web Services Invalid URL Warning dialog box + height="258">
Web Services Invalid URL Warning + dialog box
Note: this warning will be shown if you are

Name

Add precalculated annotations to the alignment. See Annotation File description. + href="annotationsFormat.html" target="NEW">Annotation + File description.
-nonews	- Disable check for Jalview news on startup (not recommended other than for classroom / demo usage) + + Disable check for Jalview + news on startup (not recommended other than for classroom / + demo usage) +

`human antigen`
JSON	Data starts with '{' Data ends with - '}' - See BioJSON - for more infomation about the Jalview JSON format	.json

Cursor	Move cursor to a particular column (p1) and row (p2) in the alignment. - e.g. '5,6<Return>' moves the cursor to the 5th + e.g. '5,6<Return>' moves the cursor to the 5th column in the 6th sequence.
[p] Space	Cursor	Inserts one (or optionally p) - gaps at the current position. - Hold down Control or Shift to insert gaps over a sequence - group
[p] Delete	Cursor	Removes one (or optionally p) - gaps at the cursor position. - Hold down Control or Shift to insert gaps over a sequence - group
[p] Backspace	Cursor	Removes one (or optionally p) - gaps at the cursor position. - Hold down Control or Shift to insert gaps over a sequence - group