3 <TITLE>Sequin help documentation</TITLE>
5 <!-- if you use the following meta tags, uncomment them.
6 <meta name="author" content="sequindoc">
7 <META NAME="keywords" CONTENT="national center for biotechnology information, ncbi, national library of medicine, nlm, national institutes of health, nih, database, archive, bookshelf, pubmed, pubmed central, bioinformatics, biomedicine, sequence submission, sequin, bankit, submitting sequences">
8 <META NAME="description" CONTENT="Sequin is a stand-alone software tool developed by the National Center for Biotechnology Information (NCBI) for submitting and updating entries to the GenBank, EMBL, or DDBJ sequence databases. "> -->
9 <link rel="stylesheet" href="ncbi_sequin.css">
13 <body bgcolor="#FFFFFF" text="#000000" link="#0033CC" vlink="#0033CC">
14 <!-- change the link and vlink colors from the original orange (link="#CC6600" vlink="#CC6600") -->
17 <table border="0" width="600" cellspacing="0" cellpadding="0">
19 <td width="140"><a href="http://www.ncbi.nlm.nih.gov"> <img src="http://www.ncbi.nlm.nih.gov/corehtml/left.GIF" width="130" height="45" border="0"></a></td>
20 <td width="360" class="head1" valign="BOTTOM"> <span class="H1">Sequin Help Documentation</span></td>
21 <!-- <td width="100" valign="BOTTOM">Your Logo</td> -->
25 <!-- the quicklinks bar -->
26 <table CLASS="TEXT" border="0" width="600" cellspacing="0" cellpadding="3" bgcolor="#000000">
27 <tr CLASS="TEXT" align="CENTER">
28 <td width="100"><a href="index.html" class="BAR">Sequin</a></td>
29 <td width="100"><a href="http://www.ncbi.nlm.nih.gov/Entrez/" class="BAR">Entrez</a></td>
30 <td width="100"><a href="http://www.ncbi.nlm.nih.gov/BLAST/" class="BAR">BLAST</a></td>
31 <td width="100"><a href="http://www.ncbi.nlm.nih.gov/omim/" class="BAR">OMIM</a></td>
32 <td width="100"><a href="http://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html" class="BAR">Taxonomy</a></td>
33 <td width="100"><a href="http://www.ncbi.nlm.nih.gov/Structure/" class="BAR">Structure</a></td>
40 <H2>Table of Contents</H2>
46 #Sequin is a program designed to aid in the submission of sequences to
47 the GenBank, EMBL, and DDBJ sequence databases. It was written at the
48 National Center for Biotechnology Information, part of the National
49 Library of Medicine at the National Institutes of Health. This section
50 of the help document provides a basic overview of how to submit
51 sequences using the Sequin forms. Subsequent sections provide detailed
52 instructions for entering information on each form.
54 *The Help Documentation
56 #The Sequin help documentation is available in both on-line and World
57 Wide Web (http://www.ncbi.nlm.nih.gov/Sequin/sequin.hlp.html) formats.
58 The text of the on-line version scrolls as you progress through the
59 Sequin forms. Specific words or phrases can be identified with the
60 "find" command at the top of the window. The on-line document can also
61 be saved as a text file, or printed directly to a printer. Click on the
62 window that contains the help documentation. Under the Sequin File
63 menu, choose Export Help... to save the documentation as a text file.
64 To print the documentation without saving it first, click on the help
65 window, and choose Print from the Sequin File menu.
67 *Organization of Forms
69 #Information is entered into Sequin on a number of different forms. Each
70 form is made up of pages, which are indicated by folder tabs at the top
71 of the form. You can move to the desired page by clicking on the
72 appropriate folder tab. You can also move between pages of a form by
73 clicking on the "Next page" or "Prev page" buttons at the bottom of the
74 screen. You can move to the previous form or the next form by clicking
75 on the "Prev form" or "Next form" buttons on the first or last pages of
78 #There are numerous ways to enter information onto a page of a form,
79 #including text fields, radio buttons, check boxes, scrolling boxes,
80 #pop-up menus and spreadsheets.
82 #You may also use tables to import annotation of source information.
83 #The formatting of these tables will be discussed below.
87 #If you are using Sequin for the first time, you will be prompted to
88 fill out four forms: the Welcome to Sequin form, the Submitting
89 Authors Form, the Sequence Format form, and the Organism and Sequences
90 Form. After you have filled out these forms, a window will appear that
91 contains the Sequin record viewer. This viewer allows you to access
92 many other forms in which you can edit fields filled out in the three
93 initial forms, as well as add additional information. Detailed
94 instructions on how to fill out the forms and use the record viewer are
97 >Welcome to Sequin Form
99 #First, indicate with one of the three radio buttons whether you are
100 submitting the sequence to the GenBank, EMBL, or DDBJ database. If you
101 are working on a sequence submission for the first time, click on
102 "Start New Submission". If you are modifying an existing submission
103 record, click on "Read Existing Record". If you would like to quit from
104 Sequin, click on "Quit Program".
106 #You can also "Read Existing Record" to read in a FASTA-formatted
108 for analysis purposes. The sequence will be displayed in Sequin and
109 can be analyzed with tools such as CDD Search, but it should not be
110 submitted because it does not have the appropriate annotations.
112 #If you are running Sequin in its network-aware mode, you will see
113 another button labeled "Download from Entrez". This option allows you
114 to update an existing database record using Sequin. The record will be
115 downloaded from GenBank into Sequin using NCBI's Entrez retrieval
116 system. The contents of the record will appear in Sequin, and you can
117 edit them by updating the sequence or the annotations, as necessary. If
118 you do not see the button labeled "Download from Entrez" on the Welcome
119 to Sequin form, you are not running Sequin in its network-aware mode.
120 To make Sequin network-aware, see the
121 <A HREF="#NetConfigure">
124 later in the help documentation.
126 #You can update only those records that you have submitted, not those
127 submitted by others. To update an existing record, first select which
128 of the databases you will be sending the update to. This should be the
129 database to which the original record was submitted. If you do not
130 know which database to use, send the record to GenBank and the NCBI
131 staff will forward it to the appropriate database. Next, click on the
132 button "Download from Entrez". Enter the nucleotide Accession number or
133 GI of the sequence on the first form. Then enter "yes" if you are
134 planning to submit the record as an update to one of the databases.
135 Fill out the Submitting Authors form.
137 <A HREF="#EditSubmitterInfo">
141 for this form are found in the Sequin help documentation under "Edit
142 Submitter Info" under the Sequin File menu. The record will then open
143 in the record viewer. Explanations of how to add annotations or update
144 sequences are presented in the documentation entitled
146 <A HREF="#EditingtheRecord">
150 <A HREF="#SequenceEditor">
154 respectively. You will not see the Submitting Authors Form, the
155 Sequence Format Form, or the Organism and Sequences Form. Note that
156 updates, as well as new records, must be emailed to the appropriate
157 database. Sequin does not support direct submission of records over the
160 #Additional configuration options are available under the Misc menu.
161 You can toggle between the stand-alone and network-aware modes of
162 Sequin. The default mode of Sequin, which is sufficient for most
163 sequence submissions, is stand-alone. In its network-aware mode, Sequin
164 can exchange data with NCBI and, for example, retrieve sequences
165 from Entrez and perform Taxonomy searches. The network-aware mode of
166 Sequin is described in detail in the
167 <A HREF="#NetConfigure">
170 section below. You can also start the NCBI DeskTop, which is for
171 advanced Sequin users only.
173 >Submitting Authors Form
175 #Information from this form will be used as a citation for the sequence
176 entry itself. It can contain the same information found in citations
177 associated with the formal publication of the sequence.
179 #On the bottom of each form are two buttons. Click "Prev form" (first
180 page in a form) or "Prev page" (subsequent pages in a form) to go to the
181 previous form or page. Click "Next Form" (last page on a form) or "Next
182 Page" (earlier pages on a form) to move to the next form or page.
184 #Form pages can also be saved individually by using the "Export" function
185 under the File menu. If you are processing multiple submissions, you
186 can use the "Import" function under the File menu to paste previously
187 entered information directly on the page.
189 #The Contact, Authors, and Affiliation pages can be saved as a block so
190 that you can use this information for your next submission. For your
191 first Sequin submission, fill in the requested information on the
192 Submitting Authors form and proceed with the preparation of the
193 submission. Choose Export Submitter Info under the File menu to export
194 this to a file. You can then import this information in subsequent
195 submissions using the Import Submitter Info in the File menu. You will
196 need to fill in the manuscript title for each submission however.
200 **When May We Release Your Sequence Record?
202 #Please select one of the two radio buttons. If you select
203 #"Immediately After Processing", the
204 entry will be released to the public after the database staff has added
205 it to the database. If you select "Release Date", fields will appear in
206 which you can indicate the date on which the sequences should be
207 released to the public. The submission will then be held back until
208 formal publication of the sequence or GenBank Accession number, or
209 until the release date, whichever comes first.
211 **Tentative Title for Manuscript
213 #Please enter a title that appropriately describes the sequence entry.
214 Later in the submission process, you will have the
215 opportunity to change this information and add details for published
216 or in press references.
220 #Please enter the name, telephone and fax numbers, and email address of
221 the person who is submitting the sequence. This is the person who will
222 be contacted regarding the sequence submission. The phone, fax, and
223 email address will not be visible in the database record, but are
224 essential for contact by the database staff.
228 #Please enter the names of the people who should receive scientific
229 credit for the generation of sequences in this entry. The person on
230 the Contact page is automatically listed as the first author. This
231 information can be changed if necessary. The author names should be
232 entered in the order first name, middle initial, surname. You can add
233 as many authors to this page as you wish. After you type in the name
234 of the third author, the box becomes a spreadsheet, and you can scroll
235 down to the next line by using the space bar. The consortium box
236 should only be used for consortium names, not institute or department
241 #Please enter information about the principal institution where the
242 sequencing was performed. This is not necessarily the same as the
243 workplace of the person described on the Contact page. This information
244 will show up in the reference section of the record, with the title
247 >Sequence Format Form
249 #Use this form to indicate the type, format and category of sequence
252 #Sequin can process single nucleotide sequences, gapped sequences and
253 sets of related sequences. If the sequences are related in terms of
254 coming from the same publication, or the same organism, they may be
255 candidates for a Batch submission. Biologically related sequences may
256 be classified as environmental samples, population, phylogenetic,
257 mutation, or segmented sets as appropriate. Segmented sets consist of
258 a collection of non-overlapping sequences covering a specific genetic
259 region. In all cases, although the sequences are handled as a single
260 submission, each sequence in a set will receive its own database
261 Accession number and can be annotated independently.
263 #Sequin can display the alignments of sequences that are submitted as
264 part of an aligned phylogenetic, population, mutation set, or
265 environmental samples. Such sequences can be submitted in FASTA,
266 Contiguous (FASTA+GAP, NEXUS, MACAW), or Interleaved (PHYLIP, NEXUS)
267 formats. If the sequences are in FASTA format, Sequin can generate an
268 alignment. If the sequences have already been aligned in FASTA+GAP,
269 PHYLIP, MACAW, or NEXUS, Sequin will not change the alignment. If one
270 of the sequences in your alignment is already present in the
271 GenBank/EMBL/DDBJ database, you must mark that sequence so that it does
272 not receive a new Accession number. Instead of supplying that sequence
273 with a new Sequence Identifier, give it the identifier accU12345, where
274 U12345 is the Accession number of the sequence.
276 #Single sequences, gapped sequences, segmented sequences, and batch
277 submissions must be submitted in FASTA format.
281 #Use the radio buttons to indicate which of the following types of
282 submissions you are creating:
284 #-Single sequence: a single mRNA or genomic DNA sequence. If you are
285 submitting multiple sequences from the same publication, consider a
286 Batch Submission. If you decide to submit multiple Sequin files, each
287 with one or more sequences, please send each file in a separate email
290 #-Segmented sequence: a collection of non-overlapping, non-contiguous
291 sequences that cover a specified genetic region. A standard example is
292 a set of genomic DNA sequences that encode exons from a gene along with
293 fragments of their flanking introns. If the segmented set is part of
294 an alignment, however, select the appropriate Population, Phylogenetic,
295 or Mutation study button.
297 #-Gapped sequence: a single, non-contiguous mRNA or genomic DNA sequence.
298 A gapped sequence contains specified gaps of know or unknown length
299 where the exact nucleotide sequence has not been determined. The FASTA
300 format for gapped sequences is slightly different and is explained
303 #-Population study: a set of sequences that were derived by sequencing
304 the same gene from different isolates of the same organism.
306 #-Phylogenetic study: a set of sequences that were derived by sequencing
307 the same gene from different organisms.
309 #-Mutation study: a set of sequences that were derived by sequencing
310 multiple mutations of a single gene.
312 #-Environmental samples: a set of sequences that were derived by
313 sequencing the same gene from a population of unclassified or unknown
316 #-Batch submission: a set of related sequences that are not part of a
317 population, mutation, or phylogenetic study. The sequences should be
318 related in some way, such as coming from the same publication or
319 organism. You should plan that all sequences will be released to the
320 public on the same date.
322 *Sequence Data Format
324 #If you are submitting a single, gapped, or segmented sequence, or a
325 batch submission, your sequence must be in FASTA format, described
326 below. If you are submitting a set of sequences as part of a
327 population, phylogenetic, or mutation study, you have a choice of
328 sequence formats. You may submit the set as individual sequences in
329 FASTA format. Alternatively, you can submit the sequences as part of
330 an alignment. Sequin currently accepts the alignment formats
331 FASTA+GAP, PHYLIP, MACAW, NEXUS Interleaved, and NEXUS Contiguous.
335 #Use the radio buttons to indicate whether your sequence corresponds to
336 an original submission or a third-party annotation submission. If you
337 have directly sequenced the nucleotide sequence in your laboratory,
338 your submission would be considered an original submission.
340 #If you have downloaded the sequence from GenBank and added to it your
341 own annotations, your entry may be eligible for submission to the
342 Third-Party Annotation Database
344 <A HREF="http://www.ncbi.nlm.nih.gov/Genbank/tpa.html">
349 #In order to be released into the TPA database, the sequence must appear
350 in a peer-reviewed publication in a biological journal. If you select
351 this option, a pop-up box will appear upon the completion of the
352 Sequence Format form. You must provide some description of the
353 biological experiments used as evidence for the annotation of your TPA
354 submission in this box.
356 #You will be asked later in the submission process to provide the GenBank
357 Accession number(s) of the primary sequence(s) from which your TPA
358 submission was derived.
360 >Organism and Sequences Form
362 #This form is made up of four pages. If your sequences are imported as
363 properly formatted FASTA files, there will be minimum input necessary
366 >FASTA Format for Nucleotide Sequences
368 #In FASTA format the line before the nucleotide sequence, called the
369 FASTA definition line, must begin with a carat (">"), followed by a
370 unique SeqID (sequence identifier). The SeqID must be unique for each
371 nucleotide sequence and should not contain any spaces. Use of brackets
372 ("[]") in the SeqID is also prohibited. The identifier will be
373 replaced with an Accession number by the database staff when your
374 submission is processed.
376 #Information about the source organism from which the sequence was
377 obtained follows the SeqID and must be in the format [modifier=text].
378 Do not put spaces around the "=". At minimum, the scientific name of
379 the organism should be included. Optional modifiers can be added to
380 provide additional information. A complete list of available source
381 <A HREF="http://www.ncbi.nlm.nih.gov/Sequin/modifiers.html">
384 and their format is available.
386 #The final optional component of the FASTA definition line is the
387 sequence title, which will be used as the DEFINITION field in the final
388 flatfile. The title should contain a brief description of the
389 sequence. There is a preferred format for nucleotide and protein
390 titles and Sequin can generate them automatically using the Generate
391 Definition Line function under the Annotate menu in the record viewer.
393 #Note in all cases, the FASTA definition line must not contain any hard
394 returns. All information must be on a single line of text. If you
395 have trouble importing your FASTA sequences, please double check that
396 no returns were added to the FASTA definition line by your editing
399 #Examples of properly formatted FASTA definition lines for nucleotide
402 <KBD><PRE>>Seq1 [organism=Mus musculus] [strain=C57BL/6] Mus musculus neuropilin 1 (Nrp1) mRNA, complete cds.
404 <KBD><PRE>>ABCD [organism=Plasmodium falciparum] [isolate=ABCD] Plasmodium falciparum isolate ABCD merozoite surface protein 2 (msp2) gene, partial cds.
406 <KBD><PRE>>DNA.new [organism=Homo sapiens] [chromosome=17] [map=17q21] [moltype=mRNA] Homo sapiens breast and ovarian cancer susceptibility protein (BRCA1) mRNA, complete cds.
408 #The line after the FASTA definition line begins the nucleotide
409 sequence. Unlike the FASTA definition line, the nucleotide sequence
410 itself can contain returns. It is recommended that each line of
411 sequence be no longer than 80 characters. Please only use IUPAC
412 symbols within the nucleotide sequence. For sequences that are not
413 contained within an alignment, do not use "?" or "-" characters. These
414 will be stripped from the sequence. Use the IUPAC approved symbol "N"
415 for ambiguous characters instead.
417 #A single file containing multiple FASTA sequences can be imported into
418 Sequin. Make sure that the FASTA definition line for each sequence is
421 #If the FASTA definition line is not properly formatted a pop-up box
422 will appear upon importing the nucleotide FASTA. The top box in this
423 pop-up will list any errors in the FASTA definition lines, including
424 missing SeqIDs, duplicate SeqIDs for different sequences, or improperly
425 formatted modifiers. You can add or edit this information in the
426 spreadsheet provided. The toggle at the bottom of the pop-up allows
427 you to select whether all sequences or only those with errors are
428 listed in the spreadsheet above. After making changes, click on Refresh
429 Error List to ensure that all errors have been corrected. You must
430 correct any errors involving the SeqID in order to proceed with your
433 *FASTA Format for Segmented Sequence
435 #Each segment of a segmented sequence must have its own SeqID, but the
436 organism name and other modifiers are only indicated in the FASTA
437 definition line of the first segment. Square brackets are used to
438 delimit the members of the segmented set. For example,
441 !>A-0V-1-Apart1 [organism=Gallus gallus] [clone=C]
444 !GACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
445 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
448 *FASTA Format for Gapped Sequence
450 #The FASTA definition line for a gapped sequence follows the same format
451 as above. To indicate a gap within the sequence, enter a hard return
452 within the sequence at the point of the gap, then insert an extra line
453 starting with a carat (">") and a question mark ("?"). If the gap size
454 is unknown, enter "unk100" after the question mark. If the gap size is
455 known, enter the length of the gap after the question mark. For
458 !>Dobi [organism=Canis familiaris] [breed=Doberman pinscher]
459 !AAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTTAGCCCAGAAGTAATACCCATGTTTTCAGCATTA
462 !TGGATGACAGAAACCTTGTTGGTCCAAAATGCAAACCCAGATKGTAAGACCATTTTAAAAGCATTGGGTC
463 !TTAGAAATAGGGCAACACAGAACAAAAAT
465 !AAAAATAAAAGCATTAGTAGAAATTTGTACAGAACTGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCT
466 !GAAAACCCATACAATACTCCGGG
468 will generate a sequence containing two gaps. The first gap is of
469 unknown length, the second is 234 nucleotides long.
471 *FASTA+GAP Format for Aligned Nucleotide Sequences
473 #A number of programs output sets of aligned sequences in FASTA format.
474 Frequently, to align these sequences, gaps must be inserted. Specify
475 relevant gap and ambiguous characters in the appropriate box on the
477 <A HREF="#NucleotidePage">
481 form. Each sequence, including gaps, must be the same length. The
482 gaps will only show up in the alignment, not in the individual sequence
485 #Sequences in FASTA+GAP format resemble FASTA sequences. The previous
488 <A HREF="#FASTAFormatforNucleotideSequences">
489 FASTA Format for Nucleotide Sequences
492 has instructions for formatting FASTA sequences. If one of the
493 sequences in your alignment is already present in the GenBank/EMBL/DDBJ
494 database, you must mark that sequence so that it does not receive a new
495 Accession number. To do this, use a SeqID in the format accU12345,
496 where U12345 is the Accession number of the pre-existing sequence. All
497 sequences in FASTA+GAP format should be in the same file.
499 #The following is an example of FASTA+GAP format:
501 !>A-0V-1-A [organism=Gallus gallus] [clone=C]
502 !TCACTCTTTGGCAACGACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
503 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
505 !>A-0V-2-A [organism=Drosophila melanogaster] [strain=D]
506 !TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
507 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
509 !>A-0V-3-A [organism=Caenorhabditis elegans] [strain=E]
510 !TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
511 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
513 !>A-0V-4-A [organism=Rattus norvegicus] [strain=F]
514 !TCACTCTTTGGCAACGACCCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
515 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
517 !>A-0V-7-A [organism=Aspergillus nidulans] [strain=G]
518 !TCACTCTTTGGCAACGACCAGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
519 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
521 *PHYLIP Format for Aligned Nucleotide Sequences
523 #A number of programs output sets of aligned sequences in PHYLIP format.
525 #The following is an example of PHYLIP format.
528 !A-0V-1-A TCACTCTTTG GCAACGACCC GTCGTCATAA TAAAGATAGA GGGGCAACTA
529 !A-0V-2-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
530 !A-0V-3-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
531 !A-0V-4-A TCACTCTTTG GCAACGACCC GTCGTCACAA TAAAGATAGA GGGGCAACTA
532 !A-0V-7-A TCACTCTTTG GCAACGACCA GTCGTCACAA TAAAGATAGA GGGGCAACTA
535 ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
536 ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
537 ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
538 ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
539 ! AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
541 #In this example, the first line indicates that there are 5 sequences,
542 each with 100 nt of sequence. The following five lines contain the
543 Sequence IDs, followed by the sequences. Specifically, the sequence
544 identifier for the first sequence is A-0V-1-A. Note that subsequent
545 blocks of sequence do not contain the Sequence ID. If one of the
546 sequences in your alignment is already present in the GenBank/EMBL/DDBJ
547 database, you must mark that sequence so that it does not receive a new
548 Accession number. To do this, use a SeqID in the format accU12345,
549 where U12345 is the Accession number of the pre-existing sequence.
551 #Specify relevant gap and ambiguous characters in the appropriate box on the
552 <A HREF="#NucleotidePage">
557 #You can modify the PHYLIP format so that Sequin can
558 determine the correct organism and any other modifiers for each
559 sequence. An example of such modifications are below in the section on
560 <A HREF="#SourceModifiersforPHYLIPandNEXUS">
561 Source Modifiers for PHYLIP and NEXUS
564 #Alternatively, you can leave your sequence alignment in
565 standard PHYLIP format and enter the organism, strain, chromosome, etc.
566 information on the following
568 <A HREF="#SourceModifiersForm">
573 *NEXUS Format for Aligned Nucleotide Sequences
575 #A number of programs output sets of aligned sequences in one of two
576 NEXUS formats, NEXUS Interleaved and NEXUS Contiguous.
578 #NEXUS files can contain ? for "missing" at the 5' and 3' ends of
579 sequences, as long as this parameter is properly defined within the
580 header of the NEXUS file.
582 #The following is an example of NEXUS Interleaved format.
587 ! dimensions ntax=5 nchar=100;
588 ! format datatype=dna missing=? gap=- interleave;
591 !A-0V-1-A TCACTCTTTG GCAACGACCC GTCGTCATAA TAAAGATAGA GGGGCAACTA
592 !A-0V-2-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
593 !A-0V-3-A TCACTCTTTG GCAAC---GC GTCGTCACAA TAAAGATAGA GGGGCAACTA
594 !A-0V-4-A TCACTCTTTG GCAACGACCC GTCGTCACAA T????ATAGA GGGGCAACTA
595 !A-0V-7-A TCACTCTTTG GCAACGACCA GTCGTCACAA TAAAGATAGA GGGGCAACTA
598 !A-0V-1-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
599 !A-0V-2-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
600 !A-0V-3-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
601 !A-0V-4-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
602 !A-0V-7-A AAGGAAGCTC TATTAGATAC AGGAGCAGAT GATACAGTAT TAGAAGAAAT
604 #In this example, the first few lines provide information about the data
605 in the sequence alignment. The following five lines contain the
606 Sequence IDs, followed by the sequences. Specifically, the sequence
607 identifier for the first sequence is A-0V-1-A. Note that subsequent
608 blocks of sequence also contain the Sequence ID. If one of the
609 sequences in your alignment is already present in the GenBank/EMBL/DDBJ
610 database, you must mark that sequence so that it does not receive a new
611 Accession number. To do this, use a SeqID in the format accU12345,
612 where U12345 is the Accession number of the pre-existing sequence.
613 Also, Sequin will replace the "?" characters in the sequences with "N"s
614 since they are defined as "missing" data in the header. You should
615 specify relevant gap and ambiguous characters in the appropriate box on
618 <A HREF="#NucleotidePage">
625 #The following is an example of NEXUS Contiguous format.
629 !DIMENSIONS NTAX=5 NCHAR=100;
630 !FORMAT MISSING=? GAP=- DATATYPE=DNA ;
634 !TCACTCTTTGGCAACGACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
635 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
638 !TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
639 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
642 !TCACTCTTTGGCAAC---GCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
643 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
646 !TCACTCTTTGGCAACGACCCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
647 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
650 !TCACTCTTTGGCAACGACCAGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
651 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
653 #In this example, the first few lines provide information about the data
654 in the sequence alignment. The following five lines contain the
655 Sequence IDs, followed by the sequences. Specifically, the sequence
656 identifier for the first sequence is A-0V-1-A. Note that subsequent
657 blocks of sequence also contain the Sequence ID. If one of the
658 sequences in your alignment is already present in the GenBank/EMBL/D
659 DBJ database, you must mark that sequence so that it does not receive a
660 new Accession number. To do this, use a SeqID in the format accU12345,
661 where U12345 is the Accession number of the pre-existing sequence.
663 #You can modify either NEXUS format so that Sequin can
664 determine the correct organism and any other modifiers for each
665 sequence. An example of such modifications are below in the section on
666 <A HREF="#SourceModifiersforPHYLIPandNEXUS">
667 Source Modifiers for PHYLIP and NEXUS
670 Alternatively, you can leave your sequence alignment in
671 standard NEXUS format and enter the organism, strain, chromosome, etc.
672 information on the following
674 <A HREF="#SourceModifiersForm">
679 **Source Modifiers for PHYLIP and NEXUS
681 #You can modify the PHYLIP or NEXUS formats so that Sequin can determine
682 the correct organism and any other modifiers for each sequence by
683 adding lines at the end of the file. The first line applies to the
684 first sequence, the second line to the second sequence, and so on. You
685 must have one line for each sequence. These inserted lines contain
686 modifiers formatted like in the FASTA definition line, but do not begin
687 with a SeqID. Instead, the SeqID is present at the beginning of the
688 sequence lines as shown above.
690 #Each of the initial lines starts with the character ">". The
691 scientific organism name follows in brackets. Optional modifiers also
692 follow in brackets. For further information on the data that can go in
693 the lines preceding the sequences, see the instructions entitled "FASTA
694 Format for Nucleotide Sequences",
696 <A HREF="#FASTAFormatforNucleotideSequences">
700 #The following lines indicating the organisms and strain of each sequence
701 would follow immediately after the sequence in the PHYLIP and NEXUS
704 !>[organism=Gallus gallus] [clone=C]
705 !>[organism=Drosophila melanogaster] [strain=D]
706 !>[organism=Caenorhabditis elegans] [strain=E]
707 !>[organism=Rattus norvegicus] [strain=F]
708 !>[organism=Aspergillus nidulans] [strain=G]
710 #The number of lines of source information must exactly match the number
711 of sequences provided.
713 #Alternatively, you can leave your sequence alignment in
714 standard NEXUS or PHYLIP format and enter the organism, strain, chromosome, etc.
715 information on the following
717 <A HREF="#OrganismPage">
722 *Importing Aligned Sets of Segmented Sequences
724 #Sequin can also read segmented sets that are part of an alignment if
725 the sequences are in FASTA or FASTA+GAP format. Each segment should
726 have its own Sequence ID, but organism name and source modifiers should
727 only be indicated for the first segment from each sequence. Square
728 brackets are used to delimit the members of a set. For example,
731 !>A-0V-1-Apart1 [organism=Gallus gallus] [strain=C]
734 !GACCCGTCGTCATAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
735 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
738 !>A-0V-2-Apart1 [organism=Drosophila melanogaster] [strain=D]
741 !GAAGCGTCGTCACAATAAAGATAGAGGGGCAACTAAAGGAAGCTCTA
742 !TTAGATACAGGAGCAGATGATACAGTATTAGAAGAAAT
747 #The options on this page will vary depending on the
748 <A HREF="#SubmissionType">
752 <A HREF="#SequenceDataFormat">
755 selected earlier. Segmented sets and gapped sequences mut be imported
756 as properly formatted FASTA files. Details about importing alignment
758 <A HREF="#NucleotidePageforAlignedDataFormats">
763 *Nucleotide Page for FASTA Data Format
767 #If you have selected a Population study, Phylogenetic study, Mutation
768 study, or Environmental samples set as a
769 <A HREF="#SubmissionType">
772 a check box will appear at the top of the Nucleotide Page. If you
773 check 'Create Alignment', Sequin will attempt to generate an alignment
774 of the seqeunces within your submission.
776 **Import Nucleotide FASTA
778 #Use this button to import your properly formatted
779 <A HREF="#FASTAFormatforNucleotideSequences">
782 . You will see a window containing information about the imported
783 sequence(s). Please check the number of sequences, Sequence IDs
784 (SeqIDs) and length of each sequence to make sure they are correct. If
785 you have included source information within the FASTA definition line,
786 this will also be listed.
788 **Add/Modify Sequences
790 #This option allows you to add or modify sequences without using a
791 previously formatted FASTA file, but is not available if you have
792 selected a Segmented sequence or Gapped sequence as a
793 <A HREF="#SubmissionType">
796 . On the Specify Sequences box you can either import a nucleotide FASTA
797 or add a new sequence. If you choose Add New Sequence, a new box will
798 pop-up where you can either import an existing sequence file or
799 directly paste or type the nucleotide sequence.
801 #If you add a sequence where the FASTA definition line is not properly
802 formatted a pop-up box will appear. The top box in this pop-up will
803 list any errors in the FASTA definition lines, including missing
804 SeqIDs, duplicate SeqIDs for different sequences, or improperly
805 formatted modifiers. You can add or edit this information in the
806 spreadsheet provided. The toggle at the bottom of the pop-up allows
807 you to select whether all sequences or only those with errors are
808 listed in the spreadsheet above. After making changes, click on
809 Refresh Error List to ensure that all errors have been corrected. You
810 must correct any errors involving the SeqID in order to proceed with
811 your submission. Click on Accept to save your sequences and return to
812 the Specify Sequences box.
814 #In the Specify Sequences box, you can choose to add another sequence or
815 select a sequence from the list and choose to edit or delete it. You
816 can also delete all sequences at this point. You will need to click on
817 Done to save your sequences and return to the Nucleotide Page.
821 #This option will remove all imported nucleotide sequences.
825 #A database sequence can represent one of several different molecule
826 types. The default molecule is genomic DNA. If the sequence was not
827 derived from genomic DNA, you can edit that information here. If you
828 are submitting multiple sequences you can apply one molecule type to
829 all sequences or apply the molecule type to each sequence individually.
830 Enter in the Molecule pop-up menu the type of molecule that was
833 #-Genomic DNA: Sequence derived directly from the DNA of an organism.
834 Note: The DNA sequence of an rRNA gene has this molecule type, as does
835 that from a naturally-occurring plasmid.
837 #-Genomic RNA: Sequence derived directly from the genomic RNA of certain
838 organisms, such as viruses.
840 #-Precursor RNA: An RNA transcript before it is processed into mRNA,
841 rRNA, tRNA, or other cellular RNA species.
843 #-mRNA[cDNA]: A cDNA sequence derived from mRNA.
845 #-Ribosomal RNA: A sequence derived from the RNA in ribosomes. This
846 should only be selected if the RNA itself was isolated and sequenced.
847 If the gene for the ribosomal RNA was sequence, select Genomic DNA.
849 #-Transfer RNA: A sequence derived from the RNA in a transfer RNA, for
850 example, the sequence of a cDNA derived from tRNA.
852 #-Small nuclear RNA: A sequence derived from small nuclear RNA, for
853 example, the sequence of a cDNA derived from snRNA.
855 #-Small cytoplasmic RNA: A sequence derived from small cytoplasmic RNA,
856 for example, the sequence of a cDNA derived from small cytoplasmic RNA.
858 #-Other-Genetic: A synthetically derived sequence including cloning
859 vectors and tagged fusion constructs.
861 #-cRNA: A sequence derived from complementary RNA transcribed from DNA,
862 mainly used for viral submissions.
864 #-Small nucleolar RNA: A sequence derived from small nucleolar RNA, for
865 example, the sequence of a cDNA derived from snoRNA.
869 #Most sequences have a Linear topology and this is the default. You
870 should change this setting to Circular only if the sequence is complete
871 and it has a circular topology. For example, a complete plasmid or a
872 complete mitochondrial genome would have a Circular topology, but a
873 single gene from a plasmid or mitochondrion would have a Linear
874 topology. If you are submitting multiple sequences you can apply one
875 topology to all sequences or set the topology for each sequence
878 *Nucleotide Page for Aligned Data Formats
880 **Sequence Characters
882 #If you are submitting a set of aligned sequences, you can specify sequence
883 characters used in your alignment here. Sequin requires that you
884 define any non-IUPAC nucleotide characters in your alignment file. The
885 five types of variable characters are listed under Sequence Characters.
887 #Every sequence within an alignment file must contain the same number of
888 characters (nucleotides + gaps). Gap characters are used to represent the
889 spaces between contiguous nucleotides in an alignment. Gaps that appear at
890 the beginning or end of a sequence are treated differently than gaps that
891 appear between nucleotides and each must be defined. GenBank prefers to
892 use a hyphen (-) to represent gaps. If you use a different character to
893 represent a gap, you will need to add this character to the list in the
894 Beginning Gap, Middle Gap, or End Gap boxes.
896 #Ambiguous characters represent nucleotides that are known to exist, but
897 whose identity has not been experimentally validated. GenBank prefers to
898 use 'n' to represent any ambiguous nucleotides. If you are using a
899 different character to represent an ambiguous base, you will need to add
900 this character to the list in the Ambiguous/Unknown box. Sequin will
901 convert these characters to 'n's when your file is imported.
903 #Match characters denote nucleotides that are identical in every member of
904 an alignment. GenBank prefers the use of a colon (:) to represent match
905 characters. If you are using a different character to represent a match
906 character, you will need to add this character to the list in the Match box.
908 **Import Nucleotide Alignment
910 #Once you have imported the alignment using the Import Nucleotide
911 Alignment button, you can edit the molecule information using the
912 <A HREF="#SpecifyMolecule">
916 <A HREF="#SpecifyTopology">
919 buttons explained above. Note that you can not access the
920 <A HREF="#Add/ModifySequences">
923 dialog for submissions of aligned sequences.
927 #Information about the organism from which the sequence was derived
928 should be entered or edited on this page. If there are any potential
929 problems with the organism information previously provided in either
931 <A HREF="#FASTAFormatforNucleotideSequences">
932 FASTA definition line
935 <A HREF="#Add/ModifySequences">
938 dialog, a window listing these problems will appear at the top of the
939 form. Please review these problems and edit using the
941 <A HREF="#AddSourceModifiers">
943 Add Source Modifiers button as necessary. At minimum, you must supply
944 the scientific name of the organism from which the sequence was
945 obtained in order to proceed with your submission.
947 #The second window is a summary of the organism information provided so
948 far. Double clicking on a line of text within this window will launch a
949 modifier-specific editing window. In each of these windows, you can
950 edit the available information for the specific modifier. In most
951 cases, you have the choice to edit the modifier for each sequence
952 separately, or to enter text and select Apply above value to all
953 sequences. These changes will be reflected in the windows of the
954 Organism page immediately upon closing the modifier-specific editor.
956 *Add Organisms, Locations, and Genetic Codes
958 #If you have not added organism information using either the
959 <A HREF="#FASTAFormatforNucleotideSequences">
960 FASTA definition line
963 <A HREF="#Add/ModifySequences">
966 dialog, you can use the Add Organisms, Locations, and Genetic Codes to
967 do so at this point. This button will launch the Multiple Organism
968 Editor pop-up where you may add or edit existing information concerning
978 <A HREF="#GeneticCode">
981 . The SeqID of each sequence is listed at the left of the spreadsheet
982 format. You can change the information in the spreadsheet individually
983 or globally for all sequences.
987 #The scrollable list at the top of the pop-up contains the scientific
988 names of many organisms. To reach a name on the list, type the first
989 few letters of the scientific name into the box above the list or the
990 appropriate box in the spreadsheet. The list will scroll to the names
991 beginning with those letters, and you can select the organism within
992 the list itself. You can then use the arrow button to copy this name
993 into the appropriate box in the spreadsheet.
995 #To apply the same scientific name to all sequences in the submission,
996 click on the Organism button in the spreadsheet column header. A
997 separate pop-up box will appear with the same organism list. You can
998 select a name from this list and choose Accept to apply this name to
1001 #If you have any questions about the scientific name of an organism, see
1003 <A HREF="http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html">
1006 http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html
1008 #If the name of the organism is not on the list, type it in directly. If
1009 you do not know the scientific name, please be as specific as you can
1010 and include a unique identifier, such as a clone, isolate, strain or
1011 voucher number, or cultivar name, e.g.; Nostoc ATCC29106, uncultured
1012 spirochete Im403, Lauraceae sp. Vásquez 25230 (MO), Rosa hybrid
1013 cultivar 'Kazanlik'. Also, if applicable, indicate if the name is
1014 unpublished as of the time of submission. Additional information such
1015 as strain, isolate, or serotype can be entered later in the submission
1020 #The default Location for all seqeunces is "Genomic". If the sequence
1021 is not genomic, select the alternative location (ie, organelle) from
1022 the pull-down list. You can change the location of all sequences
1023 globally by clicking on the Location button in the spreadsheet header.
1024 The following is a brief description of the choices in this list:
1026 #-Genomic: chromosome. This category includes
1027 mitochondrial and chloroplast proteins that are encoded by the nuclear
1030 #-Chloroplast: a chlorophyllous plastid.
1032 #-Chromoplast: a non-chlorophyllous, pigmented plastid, found in
1035 #-Kinetoplast: a specialized type of mitochondrion found exclusively
1036 in Kinetoplastida (e.g., Leishmania). NOTE: kinetoplast should
1037 be applied ONLY to members of the Kinetoplastida (trypanosomes and
1040 #-Mitochondrion: a semi-autonomous, self-reproducing organelle that
1041 occurs in the cytoplasm of most eukaryotic cells.
1043 #-Plastid: any of a class of double membrane-bound, light-harvesting
1044 organelles (or derived from same). NOTE: plastid should be used
1045 ONLY when a more precise term, e.g., chloroplast, is not
1048 #-Macronuclear: a specialized type of nucleus found exclusively in the
1049 ciliated protists (e.g., Tetrahymena). NOTE: macronucleus
1050 should be applied ONLY to members of the Ciliophora.
1052 #-Extrachromosomal: other extrachromosomal elements not listed here,
1053 such as a B chromosome or an F factor.
1055 #-Plasmid: extrachromosomal genetic element found in bacterial species.
1056 Note this does not include the cloning vector used to propagate
1057 the sequence of interest.
1059 #-Cyanelle: a specialized type of plastid found exclusively in
1060 glaucocystophytes (e.g., Cyanophora). NOTE: cyanelle should be
1061 applied ONLY to members of the Glaucocystophyceae.
1063 #-Proviral: a virus that is integrated into a host cell chromosome.
1065 #-Virion: a completed virus particle.
1067 #-Nucleomorph: a reduced nuclear remnant found in Chlorarachniophyceae
1068 (e.g., Chlorarachnion) and Cryptophyta (e.g, Cryptomonas). NOTE:
1069 nucleomorph should be applied ONLY to members of the
1070 Chlorarachniophyceae or Cryptophyta.
1072 #-Apicoplast: a reduced plastid characteristic of apicomplexans
1073 (e.g., Plasmodium). NOTE: apicoplast should be applied ONLY to
1074 members of the Apicomplexa.
1076 #-Leucoplast: a plastid lacking pigments of any type.
1078 #-Proplastid: an immature plastid.
1080 #-Endogenous_virus: a virus that has integrated permanently into the
1081 host genome, and which is inherited vertically through the
1082 germ-line of the host.
1084 #-Hydrogenosome: an organelle that produces hydrogen and ATP and is
1085 found mainly in ciliates, fungi and trichomonads. Hydrogenosomes may
1086 be reduced mitochondria
1090 #If you selected a scientific organism name from the scrollable list
1091 described above, this field will be filled out automatically. However,
1092 if the organism is not on the list, this field will default to the
1093 "Standard" genetic code. If this is incorrect, you can select the
1094 correct genetic code from the pull-down list. To globally change the
1095 genetic code for all sequences which are not automatically filled out,
1096 click on the Genetic Code button in the spreadsheet header.
1098 #For more information regarding the genetic codes available, see the NCBI
1099 <A HREF="http://www.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wprintgc?mode=c">
1102 http://www.ncbi.nlm.nih.gov/htbin-post/Taxonomy/wprintgc?mode=c
1104 *Import Source Modifiers
1106 #Using this button allows you to import a tab-delimited table of source
1107 modifiers. The first column in the table must contain the Sequince
1108 Identifiers (SeqIDs) used earlier in the submission and each subsequent
1109 column must contain a different source modifier. The first row in the
1110 table must contain the labels for each column. The label for the
1111 Sequence Identifiers column should be in the format "Seq_ID". A list
1113 <A HREF="http://www.ncbi.nlm.nih.gov/Sequin/modifiers.html">
1116 in the format to be used in the column headers can be found at
1117 http://www.ncbi.nlm.nih.gov/Sequin/modifiers.html .
1119 *Add Source Modifiers
1121 #Using this button will launch the Specify Source Modifiers pop-up box
1122 where you can add or edit any source modifier. You can also import a
1123 source modifier table or export the existing source modifiers in table
1124 format from this page.
1126 #The Select Modifier dialog allows you to select a modifier from the
1127 pull-down list and edit the value of this modifier for each sequence or
1128 globally add a value to all sequences.
1130 #The two windows in this pop-up provide information about the current
1131 source modifiers for the sequences in your submission. The top window
1132 provides a summary of these modifiers and the lower window lists the
1133 values of each modifier for each sequence. If any sequences have
1134 missing organism names or have source information that is identical to
1135 another sequence, the SeqIDs will be shown in red in this window.
1136 Double-clicking on a modifier value in this window will launch a pop-up
1137 where you can edit this value. Double-clicking on the modifier name
1138 used in the header will launch a modifier-specific pop-up where you can
1139 globally edit the modifier value for all sequences or change the value
1140 for individual sequences.
1142 *Clear All Source Modifiers
1144 #This button will clear all modifiers previously entered in either the
1145 FASTA definition lines or the submission dialogs. This includes the
1146 organism name which is required for submission.
1150 #This page allows you to provide the protein sequence translated from
1151 the nucleotide sequence that you just entered. If the nucleotide
1152 sequence is alternatively spliced or contains multiple open reading
1153 frames, enter all of the protein sequences on this page. Each protein
1154 sequence will appear in the database record as a coding sequence (CDS)
1155 feature. Sequin will automatically determine which nucleotide
1156 sequences code for the protein and indicate the nucleotide sequence
1157 interval on the database record. Sequin also provides tools that allow
1158 you to view a graphical representation of all the open reading frames
1159 in your nucleotide sequence and to convert these reading frames into
1160 CDS features. These tools are described later in the help
1161 documentation under the
1163 <A HREF="#ORFFinder">
1167 *Conceptual Translation Confirmed by Peptide Sequencing
1169 #Most protein entries are computer-generated conceptual translations of
1170 a nucleic acid sequence. If you have confirmed this translation by
1171 direct sequencing either of the entire protein or of peptides derived
1172 from the protein, please check this box.
1174 *Incomplete at NH3 end/Incomplete at COOH end
1176 #If the sequence is lacking amino acids at the amino- or
1177 carboxy-terminal end of the protein, please check the appropriate box.
1179 *Create Initial mRNA with CDS Intervals
1181 #If you check this box, Sequin will make an mRNA feature with the same
1182 initial intervals (i.e., range of sequence) as the CDS feature. After
1183 the record has been assembled, you should edit the mRNA feature location
1184 to add the 5' UTR and 3' UTR intervals. This may be done either in the
1185 mRNA editor or in the sequence editor.
1187 *Import Protein FASTA
1189 #You can import a single or multiple protein sequences contained within
1190 a previously generated protein FASTA file.
1192 **FASTA Format for Protein Sequences
1194 #The basic FASTA format is the same as that used for
1195 <A HREF="#FASTAFormatforNucleotideSequences">
1196 nucleotide sequences
1198 , with a FASTA definition line followed by the sequence itself.
1200 #In order to match the protein sequence to the correct nucleotide
1201 sequence, you must use the same Sequence Identifier (SeqID) that you
1202 used to identify the nucleotide sequence. Thus in cases of
1203 alternatively spliced genes, a single protein FASTA file can contain
1204 two unique sequences that have the same SeqID. Both coding regions
1205 will be added to the same nucleotide sequence.
1207 #The available modifiers for use in a protein FASTA definition line are
1208 different than those for a nucleotide FASTA definition line and are
1209 limited to information about the protein or gene itself and are
1210 contained within the examples below. The format remains [modifer=text].
1212 #Note in all cases, the FASTA definition line must not contain any hard
1213 returns. All information must be on a single line of text.
1215 #Examples of properly formatted protein FASTA definition lines are:
1217 <KBD><PRE>>Seq1 [protein=neuropilin 1] [gene=Nrp1]</KBD></PRE>
1219 <KBD><PRE>>ABCD [protein=merozoite surface protein 2] [gene=msp2] [protein_desc=MSP2]</KBD></PRE>
1221 <KBD><PRE>>DNA.new [protein=breast and ovarian cancer susceptibility protein] [gene=BRCA1] [note=breast cancer 1, early onset]</KBD></PRE>
1223 #The protein name should be included in the entry; all other fields are
1226 #The line after the FASTA definition line begins the amino acid
1227 sequence. It is recommended that each line of sequence be no longer
1228 than 80 characters. Please only use IUPAC symbols within the amino
1229 acid sequence. Non-IUPAC amino acid symbols will be stripped from the
1232 #After you import your sequence, a window will appear with information
1233 about the sequence. The first line will describe the number of protein
1234 sequences imported and the total length in amino acids of
1235 all sequences. Each sequence is numbered, and its length,
1236 unique identifier (SeqID), Gene symbol, Protein name, and title
1237 (Definition line) as supplied in the FASTA definition line are listed.
1241 #Note: This page will not be available if you have selected a segmented
1242 or gapped sequence as the
1243 <A HREF="#SubmissionType">
1248 #On this page, you can add a
1260 feature across the entire span of each sequence you are submitting.
1261 You can not specify locations within each sequence using this page.
1262 More options are available under the
1264 <A HREF="#AnnotateMenu">
1267 in the record viewer.
1269 #If the feature should be partial at one or both ends, check the
1270 appropriate box and then fill in the text boxes for the relevant
1273 #You may add a title to all sequences if this was not included in the
1274 FASTA definition line. This will be used as the DEFINITION field in
1275 the final flatfile. The title should contain a brief description of
1276 the sequence. There is a preferred format for nucleotide and protein
1277 titles and Sequin can generate them automatically using the Generate
1278 Definition Line function under the Annotate menu in the record viewer.
1282 #You will only see this form if you had previously indicated that the
1283 entry is a Third-Party Annotation submission. You must provide the
1284 GenBank Accession number(s) of the primary sequence used to assemble
1285 your TPA sequence. We can not accept primary sequences corresponding
1286 to Reference Sequences or those from proprietary databases. More
1287 information about this can be found on the
1289 <A HREF="http://www.ncbi.nlm.nih.gov/Genbank/tpa.html">
1294 #If a proper GenBank Accession is entered in the first column of the
1295 Assembly Tracking form, the GenBank staff can map the coordinates for
1296 you. You do not need to fill out the 'from' and 'to' columns. Note
1297 that multiple accessions may be entered to provide full coverage of the
1300 #You may also generate an Assembly Tracking form in the record viewer
1301 under the Annotate menu. Select Descriptors and TPA Assembly from the
1302 pull-down menu in order to generate the Assembly Tracking form.
1308 #After you finish the Organism and Sequences Form, Sequin will process
1309 your entry based on the information you have entered. The window you
1310 see now is called the record viewer. This is also the window you will
1311 see if you are submitting an update to an existing record. The
1312 instructions after this point are the same whether you are submitting a
1313 new record or an update.
1315 #In the default window of the record viewer, you will see your entry
1316 approximately as it would appear in the database. Most of the
1317 information that you entered earlier in the submission process is
1318 present in the viewer; other information, such as the contact, is still
1319 present in the record but will not be visible in the database entry. If
1320 you have provided a conceptual translation of the nucleotide sequence,
1321 the translation will be listed as a CDS Feature. Sequin automatically
1322 determines which nucleotides encode for the protein, and lists them,
1323 even if the nucleotide sequence contains introns and exons.
1325 #You can save the entry to a file by selecting Save or Save As under the
1326 File menu. This is not the same as saving the entry for submission to
1327 the database. It is a good idea to save the file at this point so that
1328 if you make any unwanted changes during the editing process you can
1329 revert to the original copy. If you wish to edit the entry later, click
1330 on "Read Existing Record" on the Welcome to Sequin form and choose
1333 #It is likely that the entry could be processed now for submission to
1334 the database. However, you may wish to add information to
1335 the entry. This information may be in the form of Descriptors or
1336 Features. Descriptors are annotations that apply to an
1337 entire sequence, or an entire set of sequences, and Features are
1338 annotations that apply to a specific sequence interval. For example,
1339 you may want to change the Reference Descriptor to add a published
1340 manuscript, or to annotate the sequence by adding features such as a
1341 signal peptide or polyA signal.
1343 #Information in the record viewer can be edited in different ways. One
1344 way to modify information is to double click within the block of
1345 information you wish to edit. Many blocks, such as "Definition",
1346 "Source", "Reference", or "Features" can be edited.
1348 #To add information, create a new descriptor
1349 or feature by selecting the appropriate form from the Misc or Features
1350 menus. These options are described later in this help document.
1352 #Finally, you may need to edit the sequence itself.
1353 <A HREF="#SequenceEditor">
1356 for working with the sequence are presented in the documentation for the
1359 *Submitting the Finished Record to the Database
1361 #Once you are satisfied that you have added all the appropriate
1362 information, you must process your entry for submission to the database.
1363 Select "Validate" under the Search menu. This function detects
1364 discrepancies between the format of your submission and that required by
1365 the database selected for entry.
1367 #If Sequin detects problems with the format of your record, you will see a
1368 screen listing the validation errors as well as suggestions for how to fix the
1369 discrepancies. Single clicking on an error message scrolls the record viewer
1370 to the feature that is causing the error. Double clicking on the error message
1371 launches a new form on which you can enter information to correct the problem.
1372 If you are annotating a set of multiple sequences, shift-click to scroll to the
1373 target sequence and feature. You can also dismiss the suggestion and proceed
1374 on your own. When you think you have corrected all the problems, click on
1377 #Message: Select Verbose, Normal, Terse, or Table. Verbose gives a more
1378 detailed explanation of the problem.
1380 #Filter: Select the error messages you wish to see. You can select
1381 ALL, SEQ_INST (errors regarding the sequence itself, its type, or
1382 length), SEQ_DESCR (descriptor errors), SEQ_FEAT (feature errors), or
1383 errors specific to your record.
1385 #Severity: Select the types of error messages you wish to see. You
1386 will see the type of message selected, as well as any messages warning
1387 of more serious problems.
1389 #There are four types of error messages, Info, Warning, Error, and
1390 Reject. Info is the least severe, and Reject is the most severe. You
1391 may submit the record even if it does contain errors. However, we
1392 encourage you to fix as many problems as possible. Note that some
1393 messages may be merely suggestions, not discrepancies. A possible
1394 Warning message is that a splice site does not match the consensus.
1395 This may be a legitimate result, but you may wish to recheck the
1396 sequence. A possible Error message is that the conceptual translation
1397 of the sequence that you supplied does not encode an open reading
1398 frame. In this case, you should check that you translated the sequence
1399 in the correct reading frame. A possible Reject message is that you
1400 neglected to include the name of the organism from which the sequence
1401 was derived. The name of the organism is absolutely required for a
1404 #If Sequin does not detect any problems with the format of your record,
1405 you will see a message that "Validation test succeeded".
1407 #To prepare the submission, click the "Done" button on the record
1408 viewer, or select "Prepare Submission" under the File menu. You will be
1409 prompted to save the file. Email this file to the database at the
1410 address shown. You MUST email the file; Sequin does not submit the
1411 file automatically over the network. The email addresses for the
1414 !-GenBank: gb-sub@ncbi.nlm.nih.gov
1415 !-EMBL: datasubs@ebi.ac.uk
1416 !-DDBJ: ddbjsub@ddbj.nig.ac.jp
1418 #After your entry is complete, close the record viewer. You will be
1419 returned to the Welcome to Sequin form and can begin another entry.
1425 #This pop-up menu shows a list of SeqIDs of all nucleotide and protein
1426 sequences associated with the Sequin entry. Use the menu to select the
1427 sequences displayed in the record viewer, as well as the sequences you
1428 want to "target", that is, the sequences to which you want to apply a
1430 <A HREF="#Descriptors">
1433 in the Sequin help documentation). You may select either an individual
1434 sequence by name or a set of sequences, such as All Sequences, or
1435 SEG_dna if you have a segmented nucleotide set. You may change the
1436 selection at any time.
1440 #You may change the display format of the record viewer to any of the
1441 formats described below. Editing a field in one display format will
1442 change that field in all formats. Subsequent pop-up menus will appear
1443 depending on which format is selected.
1447 #This display format allows you to see the submission as it would appear
1448 as a GenBank or DDBJ entry. It is the default format.
1450 #The Mode pop-up default setting is Sequin. Release mode shows certain
1451 qualifiers and db_xrefs in RefSeq entries which are non-collaborative.
1452 Entrez mode is used fro web display and can show new elements that have
1453 not yet finished their four month quarentine period. Dump mode requires
1454 that the accession slot be populated. In most cases, there is no need
1455 to change from the default Sequin mode.
1457 #The Style pop-up allows different views of segmented records. The
1458 default is Normal. Segment style is the traditional representation of
1459 segmented sequences, while Contig style displays a CONTIG line with a
1460 join of accessions instead of raw sequence. Master style shows
1461 features mapped to the segmented sequence coordinates instead of the
1462 coordinates of the individual parts.
1466 #This display format shows the entry in a graphical view. The top bar
1467 represents the nucleotide sequence. Lower arrows or bars represent
1468 different features on the sequence. Double click on an arrow or bar to
1469 launch the appropriate editing window. Any sequence highlighted in the
1470 Sequence Editor will be boxed on the graphical view of the sequence.
1471 To see a graphical representation of a segmented set (see
1473 <A HREF="#Submissiontype">
1476 above), the Target Sequence must be set to
1479 #The Style pop-up menu allows you to see the display in different styles
1482 #The Scale pop-up menu allows you to see the display in different sizes.
1483 The smaller the number, the larger the display.
1487 #This display format shows the nucleotide sequence in the record along
1488 with any annotated features (such as CDS or mRNA). You can only view a
1489 single sequence at a time with this option. You can use the Features
1490 pop-up menu to change the display of the features. With the numbering
1491 pop-up menu, select where you want the sequence numbers to be
1492 indicated, at the side of the sindow, at the top of each sequence line,
1497 #This display format shows sets of aligned sequences, such as those
1498 imported as part of a population, phylogenetic, mutation, or
1499 environmental samples set. When toggled to All Sequences in the Target
1500 Sequence pop-up, the alignment of all entries will be displayed. To
1501 more closely analyze similarities, you can select a single entry in the
1502 Target Sequence pop-up. The complete sequence of the entry selected
1503 will be displayed. Any nucleotides in the other sequences that differ
1504 from that selected will be displayed, while identical nucleotides will
1505 be displayed as a period. You can also display features annotated on
1506 the selected target sequence or all sequences using the Feature display
1507 toggle. To launch the alignment editor, select
1508 <A HREF="#AlignmentAssistant">
1511 from the record viewer Edit menu.
1515 #This display format allows you to see the submission as it would appear
1520 #This display format shows the annotation in a five-column, tab-delimited
1521 <A HREF="table.html">table</A>
1522 format. This format can be imported to add annotation to a record that
1527 #This display shows the sequence and Definition line only, without any
1528 annotations, in a format called the FASTA format. This is a format used
1529 by many molecular biology analysis programs. You cannot edit in this
1534 #This display format shows quality score data ifit has been included in
1539 #This display shows the entry in Abstract Syntax Notation 1, a data
1540 description language used by the NCBI. You cannot edit in this display
1545 #This display format shows the entry in XML language, sometimes used by
1546 various databases. You cannot edit in this display mode.
1550 #This display format shows the entry in the XML format used by the INSD.
1551 You cannot edit in this display mode.
1555 #The NCBI DeskTop displays the internal
1556 structure of the record being viewed in Sequin. The
1557 <A HREF="#NCBIDeskTop">
1560 is explained under the Misc menu.
1564 #This button allows you to validate the entry when you are finished with
1566 <A HREF="#SubmittingtheFinishedRecordtotheDatabase">
1567 Submitting the Finished Record to the Database
1569 in the Sequin help documentation.
1571 *Controls for Downloaded Entries
1573 #If you have downloaded a sequence from Entrez, you will see an
1574 additional button labeled PubMed. This button will launch a web
1575 browser containing the target sequence as it appears in Entrez. From
1576 here, you can access any Entrez-supported Links, including related
1577 sequences and associated references in PubMed.
1583 #Descriptors are annotations that apply to an entire sequence, or an
1584 entire set of sequences, in a given entry. They do not have a specific
1585 location on a sequence, as they apply to the entire sequence. They can
1587 <A HREF="#Features">
1590 which apply to a specific interval of the sequence.
1592 #You may edit descriptors in one of two ways.
1594 #(1) In the record viewer, double click within the text of the
1595 descriptor to bring up a form on which information can be added.
1597 #(2) Choose the option Descriptors from the Annotate menu.
1601 #This menu allows you either to create new descriptors or to modify
1602 existing ones. Select the descriptor that you wish to modify.
1604 #When you first select a descriptor, you will see a window called
1605 "Descriptor Target Control". Using the target control pop-up menu,
1606 select the sequences you wish this descriptor to cover. The name(s)
1607 listed correspond to the SeqID(s) given to the nucleotide or amino acid
1608 sequences when when they were imported into Sequin. The default
1609 selection for this menu is set in the Target Sequence pop-up menu on
1610 the record viewer. You may choose to have the descriptor cover just
1611 one sequence, or a set of sequences in your entry. If you are creating
1612 a new descriptor, select "Create New". If you wish to modify a
1613 previous descriptor, select "Edit Old".
1615 #The following is a list of some of the descriptors that can be added.
1616 Two additional descriptors, those for
1617 <A HREF="#Publications">
1621 <A HREF="#BiologicalSourceDescriptororFeature">
1624 are described in other sections.
1628 #If you indicated that your sequence is a TPA submission, a
1629 <A HREF="#AssemblyTracking">
1632 was created from the information regarding primary accession numbers.
1633 This Assembly information can be edited here. Note that it is not
1634 necessary to enter nucleotide location in the "from" and "to" columns.
1638 #This is for database staff use only. Please do not modify the date.
1642 #This is for database staff use only. Please do not modify the date.
1646 #This descriptor provides general information about the genetic context
1647 of the sequence. For example, if your nucleotide sequence is cloned
1648 from the region surrounding the Huntington's Disease gene, you could
1649 enter that information here. Providing information for this descriptor
1654 #Alternative place for a descriptive name for the sequence. This
1655 information will not appear in the flatfile view, but will be
1656 maintained in the ASN1.
1660 #This descriptor is used to list any additional information that you
1661 wish to provide about the sequence. Use of this descriptor is optional.
1662 Most information can be better annotated using the appropriate
1663 features and qualifiers rather than a generic comment descriptor.
1667 #This descriptor contains the information that will go on the Definition
1668 line of the database entry. If you supplied a title for your
1669 nucleotide sequence when you imported it into Sequin, that information
1670 is here. If you wish to change the Definition line, or if you did not
1671 supply a title when you submitted the sequence, edit this Descriptor.
1672 For more information on creating proper Definition lines, please see
1673 the Sequin help documentation for the
1675 <A HREF="#NucleotideDefinitionLine(Title)">
1676 Nucleotide Definition Line (Title)
1679 **Molecule Description
1681 #This descriptor indicates the characteristics of the molecule from
1682 which the sequence was derived. The information that you have already
1683 entered can be edited here. In most cases, the molecule and class are
1684 the only choices which should be edited from the default values.
1688 #A GenBank sequence can represent one of several different molecule
1689 types. Enter in the Molecule pop-up menu the type of molecule that was
1690 sequenced. A brief description of the choices in this pop-up menu were
1695 Choose the appropriate option from the pop-up menu.
1697 #-Complete: Use this designation when a complete molecule, such as a
1698 complete mitochondrial genome, is being submitted.
1700 #-Partial: Use this designation when an incomplete unit, such as the
1701 partial coding sequence of a gene, is being submitted.
1703 #-No left: Use this designation when an incomplete unit, such as the
1704 partial coding sequence of a gene, or a partial protein sequence, is
1705 being submitted. The sequence has no left if it is incomplete on the
1706 5', or amino-terminal, end.
1708 #-No right: Use this designation when an incomplete unit, such as the
1709 partial coding sequence of a gene, or a partial protein sequence, is
1710 being submitted. The sequence has no right if it is incomplete on the
1711 3', or carboxy-terminal, end.
1713 #-No ends: Use this designation when an incomplete unit, such as the
1714 partial coding sequence of a gene, or a partial protein sequence, is
1715 being submitted, The sequence has no ends if it is incomplete at both
1716 the 5' and 3', or amino- and carboxy- terminal, ends.
1718 #-Other: Use this designation when none of the above descriptions apply.
1722 #From the pop-up menu, select the technique that was used to generate the
1725 #-Standard: standard sequencing technique.
1728 <A HREF="http://www.ncbi.nlm.nih.gov/dbEST/index.html">
1729 Expressed Sequence Tag
1731 : single-pass, low-quality mRNA sequences
1732 derived from cDNAs. These sequences will appear in the EST division.
1735 <A HREF="http://www.ncbi.nlm.nih.gov/dbSTS/index.html">
1736 Sequence Tagged Site
1738 : short sequences that are operationally
1739 unique in a genome and that define a specific position on the physical
1740 map. These sequences will appear in the STS division.
1743 <A HREF="http://www.ncbi.nlm.nih.gov/dbGSS/index.html">
1744 single-pass genomic sequence
1746 . These sequences will appear in
1747 the Genome Survey Sequence (GSS) division.
1749 #-Genetic Map: Genetic map information, for example, in the Genomes division.
1751 #-Physical Map: Physical map information, for example in the Genomes division.
1753 #-Derived: A sequence assembled into a contig from shorter sequences.
1755 #-Concept-trans: A protein translation generated with the appropriate
1758 #-Seq-pept: Protein sequence was generated by direct sequencing of a
1761 #-Both: Protein sequence was generated by conceptual translation and
1762 confirmed by peptide sequencing.
1764 #-Seq-pept-Overlap: Protein sequence was generated by sequencing
1765 multiple peptides, and the order of peptides was determined by overlap
1768 #-Seq-pept-Homol: Protein sequence was generated by sequencing
1769 multiple peptides, and the order of peptides was determined by homology
1770 with another protein.
1772 #-Concept-Trans-A: Conceptual translation of the nucleotide sequence
1773 provided by the author of the entry.
1776 <A HREF="http://www.ncbi.nlm.nih.gov/HTGS/">
1777 High Throughput Genome Sequence
1779 , Phase 0. These sequences
1780 are produced by high-throughput sequencing projects and will be in the
1784 <A HREF="http://www.ncbi.nlm.nih.gov/HTGS/">
1785 High Throughput Genome Sequence
1787 , Phase 1. These sequences
1788 are produced by high-throughput sequencing projects and will be in the
1792 <A HREF="http://www.ncbi.nlm.nih.gov/HTGS/">
1793 High Throughput Genome Sequence
1795 , Phase 2. These sequences
1796 are produced by high-throughput sequencing projects and will be in the
1800 <A HREF="http://www.ncbi.nlm.nih.gov/HTGS/">
1801 High Throughput Genome Sequence
1803 , Phase 3. These sequences
1804 are produced by high-throughput sequencing projects and will be in the
1807 #-FLI_cDNA: Full Length Insert cDNA. Sequence corresponds to entire cDNA but
1808 not necessarily entire transcript. These sequences are produced by large
1809 sequencing projects.
1811 #-HTC: High Throughput cDNA. These sequences are produced by large sequencing
1815 <A HREF="http://www.ncbi.nlm.nih.gov/Genbank/wgs.html">
1816 Whole Genome Shotgun
1818 . These sequences are produced by large sequencing projets and follow a
1819 separate submission process.
1821 #-Barcode: Nucleotide sequence is part of Barcodes of Life project. This
1822 selection should only be used by members of the Consortium for the
1825 #-Other: Do not use this designation.
1829 #From the pop-up menu, select the type of molecule that was sequenced.
1837 #-Nucleotide: Do not select this item
1839 #-Other: Do not select this item
1843 #From the pop-up menu, select the topology of the sequenced molecule.
1845 #-Linear: Linear molecule (most sequences).
1847 #-Circular: Circular molecule (such as a complete plasmid or mitochondrion).
1849 #-Tandem: Do not select this item.
1851 #-Other: Do not select this item.
1855 #From the pop-up menu, select whether the sequence was derived from an
1856 organism with a single- or double-stranded genome. This is used primarily for
1859 #-Single: The organism contains only a single-stranded genome, for
1860 example, ssRNA viruses.
1862 #-Double: The organism contains only a double-stranded genome, for
1863 example, dsDNA viruses.
1865 #-Mixed: Do not select this item.
1867 #-Mixed Rev: Do not select this item.
1869 #-Other: Do not select this item.
1873 #The Biological Source descriptor is described in more detail
1874 <A HREF="#BiologicalSourceDescriptororFeature">
1882 #Features are annotations which apply to one or more intervals on a
1883 sequence. They can be contrasted to
1884 <A HREF="#Descriptors">
1887 that apply to an entire sequence or an entire set of sequences.
1888 Features will be added to the Target Sequence selected in the record
1891 #You may add or modify features in one of three ways.
1893 #(1) In the record viewer, double click on the text of an existing
1894 feature to bring up a form on which information can be added or edited.
1896 #(2) Choose the feature from the Annotate menu to add a new feature.
1898 #(3) Choose the feature from the Sequence Editor Features menu to add a
1901 #The features listed in the Annotate menu and the Sequence Editor
1902 Features menu are identical, and the instructions for adding them are
1903 the same, with one exception. If you annotate them in the Annotate
1904 menu, you must provide the nucleotide sequence location of the feature.
1905 However, if you add features from the Sequence Editor, you can
1906 highlight the sequence that the feature covers, and the location of the
1907 sequence will be automatically entered in the feature location box.
1911 #This menu allows you to add or modify features on the sequence selected
1912 in the Target Sequence pop-up menu of the record viewer. Features are
1913 grouped into six categories. Select the feature that you would like to
1914 mark on your sequence. A new form will appear.
1916 #Feature forms share a common design. The first page is specific to the
1917 particular feature, e.g., Coding Region or Gene. The second page lists
1918 Properties of the Feature. The third page describes the Location of the
1919 feature. Details about the common second and third pages are provided
1926 #Enter general comments about the feature here.
1928 #Select any of the flags if necessary. If this sequence contains only a
1929 partial representation of the feature you are describing, check the
1930 "Partial" box. Check the "Exception" box if the feature annotates a
1931 post-transcriptional modification of the nucleotide sequence, such as
1932 ribosomal slippage or RNA editing. This is generally used only on CDS
1933 features. The evidence dialogs will only be editable if information
1934 has been entered in the Evidence subpage.
1936 #If a gene feature overlaps the feature you are editing, the gene symbol
1937 will appear in the pull-down menu. If you want to add the name of a
1938 new gene, select new, and enter its name and optional description. By
1939 default, mapping between the feature and the gene is done by overlap,
1940 that is, the gene associated with the feature is the gene whose
1941 location overlaps with the location of the feature. Under some
1942 circumstances, for example, if the sequences of two genes overlap, you
1943 may wish the feature to apply to a different gene. In this case,
1944 select cross-reference, and select the name of the new gene in the
1945 pop-up menu. If you do not want the feature to map to any existing
1946 gene, select suppress. You may also edit information on the Gene
1947 feature form by clicking on Edit Gene Feature.
1951 #Add any comments about the feature here, especially if you checked the
1952 "Exception" box on the General Subpage.
1954 ***Citations Subpage
1956 #This page is used to list any citations that specifically apply to the
1957 feature you are annotating. The citation must have already been entered
1958 into the record (see
1959 <A HREF="#Publications">
1962 in the Sequin help documentation. Click on Edit Citations, and
1963 place a check mark in box next to the publication you want to cite.
1964 However, we discourage the use of citations on features.
1966 ***Cross-Refs Subpage
1968 #This is a read-only page used to cross-reference this entry to entries
1969 in external databases (databases other than GenBank, EMBL/EBI, and
1970 DDBJ), such as dbEST or FLYBASE. For more information on this topic,
1971 see the International Nucleotide Sequence Database Collaboration
1973 <A HREF="http://www.ncbi.nlm.nih.gov/collab/db_xref.html">
1976 http://www.ncbi.nlm.nih.gov/collab/db_xref.html
1980 #This page is primarily used by large sequencing centers to explain
1981 annotation prediction methods and its use is optional. More details
1982 about these qualifiers can be found in the
1983 <A HREF="http://www.ncbi.nlm.nih.gov/GenBank/evidence.html">
1984 genome submission guidelines
1986 The two choices of evidence are Experiment or Inference.
1988 #Wet-bench, experimental evidence can be entered as free text in the
1989 Experiment section. Please be as brief as possible.
1991 #The Inference section allows for information to be added in cases where
1992 the feature is annotated based solely on sequence similarity or
1993 prediction software. In order to fill in text, you must select one of
1994 the options from the Category pull-down menu. Different pull-down and
1995 text boxes will appear depending on the selection you choose from the
1996 Category menu. If you select one of the 'similar to' categories, you
1997 must include the name of the database and the corresponding accession
1998 number of the sequence used as the basis for the annotation. If you
1999 choose one of the prediction categories, you must include the name and
2000 version of the prediction program used as the basis for the annotation.
2002 #For example, if your annotation of a coding region was based on
2003 similarity to the sequence and annotation in GenBank Accession number
2004 AY411252, you would select "similar to DNA sequence" from the pull-down
2005 menu and then select "INSD" in the Database pull-down. You would then
2006 type "AY411252.1" in the Accession text box. If the annotation is
2007 based on the Genscan prediction algorithm, you would select "ab initio
2008 prediction" from the pull-down menu, select "Genscan" in the Program
2009 pull-down and enter 2.0 in the Program Version text box. If the
2010 database or program used is not listed in the appropriate pull-down
2011 list, select Other from the list. A new text box will appear where you
2012 can enter the name of the database or program used. You still must
2013 include the appropriate accession number or version in the subsequent
2016 ***Identifiers Subpage
2018 #This is a read-only page used by the database staff for tracking
2019 features within the record.
2023 #This page allows you to select the location of the feature you are
2024 citing. Each feature must have a sequence interval associated with it.
2025 In most cases, Sequin will limit the option to the nucleic acid or
2026 protein sequence as appropriate.
2028 #Check the 5' Partial or 3' Partial box if the feature in your nucleic
2029 acid sequence is missing residues at the 5' or 3' ends, respectively.
2030 Check the NH2 Partial or COOH Partial if the feature in your amino acid
2031 sequence is missing residues at the amino- or carboxy-terminal ends,
2032 respectively. If you checked "Partial" on the Properties page, you
2033 must check either the 5' and/or 3' partial boxes.
2035 #Enter the sequence range of the feature. The numbers should correspond
2036 to the nucleotide sequence interval if the SeqID is set to a nucleotide
2037 sequence, and to an amino acid sequence interval if the SeqID is set to
2038 a protein sequence. If the feature spans multiple, non-continuous
2039 intervals on the sequence, indicate the beginning and end points of each
2040 interval. If each interval is separate, and should not be joined with
2041 the others to describe the feature, check the Intersperse intervals with
2042 gaps box (for example, when annotating multiple primer binding sites).
2043 If the feature is composed of several intervals that should all be
2044 joined together, do not check the box (for example, when annotating mRNA
2045 on a genomic DNA sequence).
2047 #For nucleic acid Features only: From the pop-up menu, select the
2048 strand on which the feature is found.
2050 #-Plus: Plus strand, or coding strand.
2052 #-Minus: Minus strand, or non-coding strand.
2054 #-Both: Both strands.
2056 #-Reverse: Do not select this item.
2058 #-Other: Do not select this item.
2060 #Use the pop-up menu to select the SeqID of the sequence you are
2061 describing by the location.
2063 #If you are working on a set of sequences which contain an alignment,
2064 you will see a toggle at the bottom of the Location Page where you can
2065 select to add or view the location of the feature using the Sequence
2066 Coordinates of the target sequence or the Alignment Coordinates. In
2067 either case, the feature will only be added to the target sequence. If
2068 you want to add features to all members of the set using the alignment
2069 coordinates, you must use the
2071 <A HREF="http://www.ncbi.nlm.nih.gov/Sequin/sequin.hlp.html#Workingwithsetsofalignedsequences">
2075 #A brief description of the available features follows. A detailed
2076 explanation of how to use the coding region (CDS) feature is included.
2077 The DDBJ/EMBL/GenBank feature table definition
2078 <A HREF="http://www.ncbi.nlm.nih.gov/collab/FT/index.html">
2081 http://www.ncbi.nlm.nih.gov/collab/FT/index.html
2082 provides detailed information about other features.
2086 #1) region of DNA at which regulation of termination of transcription
2087 occurs, which controls the expression of some bacterial operons; 2)
2088 sequence segment located between the promoter and the first structural
2089 gene that causes partial termination of transcription.
2093 #Constant region of immunoglobulin light and heavy chains, and T-cell
2094 receptor alpha, beta, and gamma chains. Includes one or more exons,
2095 depending on the particular chain.
2099 #CAAT box; part of a conserved sequence located about 75 bp upstream of
2100 the start point of eukaryotic transcription units that may be involved
2101 in RNA polymerase binding; consensus=GG(C or T)CAATCT.
2105 #coding sequence; sequence of nucleotides that corresponds with the
2106 sequence of amino acids in a protein (location includes stop codon).
2107 Feature includes amino acid conceptual translation.
2109 **Coding Region Page
2111 #Most users add a coding region to their sequence when they fill out the
2112 Organism and Sequences form. However, you may need to edit the coding
2113 region, or add additional ones. Choose CDS under the Coding Regions
2114 and Transcripts submenu of the Features menu, or to edit an existing
2115 CDS, double click on the record viewer. If you appended the partial
2116 sequence of a coding region to the Organism and Sequences form, you will
2117 probably need to edit the Coding Region feature to avoid validation
2118 error messages about the location of the coding region.
2120 ***General (Product) Subpage
2122 #Choose the genetic code that should be used to translate the
2123 nucleotide sequence. For more information, and for the translation
2124 tables themselves, see the NCBI Taxonomy
2125 <A HREF="http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi?mode=c">
2128 If the genetic code is already populated from the taxonomy database, do
2129 not change this selection.
2131 #Choose the reading frame in which to translate the sequence. Do not
2132 fill in the Protein Product or SeqID selections.
2134 #Supply additional information about the protein by clicking on Edit
2135 Protein Information to launch the Protein feature forms. The protein
2136 name must have already been filled out on the Protein subpage.
2138 #Checking retranslate on accept will translate the nucleotide sequence
2139 according to the interval(s) indicated on the Locations page when you
2140 click on Accept to exit the editor. This new translation will replace
2141 any earlier translations you have supplied. This should not be a
2142 problem if the interval was indicated appropriately.
2144 #If the coding sequence that you supply is a partial sequence and you
2145 have checked a Partial box on the Location subpage, it is a good idea to
2146 check the Synchronize Partials box. In this case, Sequin will ensure
2147 that all other appropriate features (such as protein) are also marked as
2150 #When editing existing CDS features, choose the sequence you want to
2151 view by selecting its name uder the Product pop-up menu. You may also
2152 import a new protein sequence by selecting Import Protein FASTA under
2153 the file menu. The sequence should be formatted as described above on
2154 the Organism and Sequences form.
2156 #After you have imported a protein sequence, click on Predict Interval.
2157 This function will predict the interval on the nucleotide sequence to
2158 which the coding region applies. If you do not select this function,
2159 the interval will likely be wrong, and you will get an error message
2160 when you attempt to validate the record. If your sequence is a 5' or 3'
2161 partial, you must first indicate this manually on the Location Page.
2163 #You may also have Sequin generate the protein sequence from the
2164 nucleotide sequence by clicking on Translate Product. However, you must
2165 first indicate the location and partialness of the coding region on the
2166 Location page in order to obtain the correct translation.
2170 #Use this page to enter or edit a name or descriptionof the protein
2171 product. For a new sequence, enter information directly into the
2172 boxes. You can edit descriptions of an existing sequence by clicking
2173 on Edit Protein Feature which will bring up the Protein feature form.
2174 The Launch Product Viewer displays the flatfile view of ht eprotein
2175 record generated from the information in the CDS feature.
2177 ***Exceptions Subpage
2179 #Exceptions describe places where there is a posttranslational
2180 modification. Enter the amino acid position at which the modification
2181 occurs, and select the amino acid that is actually represented in the
2182 protein from the pop-up list. Sequin will change the amino acid number
2183 to a nucleotide interval. Please provide some explanation for the
2184 exception in a comment.
2188 #Independent determinations of the "same" sequence differ at this site
2193 #Displacement loop; a region within mitochondrial DNA in which a short
2194 stretch of RNA is paired with one strand of DNA, displacing the
2195 original partner DNA strand in this region; also used to describe the
2196 displacement of a region of one strand of duplex DNA by a single
2197 stranded invader in the reaction catalyzed by RecA protein.
2201 #Diversity segment of immunoglobulin heavy chain, and T-cell receptor
2206 #A cis-acting sequence that increases the utilization of (some)
2207 eukaryotic promoters and can function in either orientation and in any
2208 location (upstream or downstream) relative to the promoter.
2212 #Region of genome that codes for portion of spliced mRNA; may contain
2213 5' UTR, all CDSs, and 3' UTR.
2217 #Gap in the sequence, only applied to gaps of unknown length. The
2218 location span of the gap feature is 100 base pairs, indicated by 100 "n"s
2219 in the sequence. The qualifier /estimated_length=unknown is mandatory.
2223 #GC box; a conserved GC-rich region located upstream of the start point
2224 of eukaryotic transcription units that may occur in multiple copies or
2225 in either orientation; consensus=GGGCGG.
2229 #Region of biological interest identified as a gene and for which a name
2234 #Intervening DNA; DNA which is eliminated through any of several kinds
2239 #A segment of DNA that is transcribed, but removed from within the
2240 transcript, by splicing together the sequences (exons) on either side of
2245 #Joining segment of immunoglobulin light and heavy chains, and T-cell
2246 receptor alpha, beta, and gamma chains.
2250 #Long terminal repeat, a sequence directly repeated at both ends of a
2251 defined sequence, of the sort typically found in retroviruses.
2255 #Mature peptide or protein coding sequence; coding sequence for the
2256 mature or final peptide or protein product following post-translational
2257 modification. The location does not include the stop codon (unlike the
2262 #Site in nucleic acid that covalently or non-covalently binds another
2263 moiety that cannot be described by any other Binding key (primer_bind or
2268 #Feature sequence is different from that presented in the entry and
2269 cannot be described by any other Difference key (conflict, unsure,
2270 old_sequence, mutation, variation, allele, or modified_base).
2274 #Region of biological interest which cannot be described by any other
2279 #Site of any generalized, site-specific, or replicative recombination
2280 event where there is a breakage and reunion of duplex DNA that cannot be
2281 described by other recombination keys (iDNA and virion) or qualifiers of
2282 source key (/insertion_seq, /transposon, /proviral).
2286 #Any transcript or RNA product that cannot be defined by other RNA keys
2287 (prim_transcript, precursor_RNA, mRNA, 5'clip, 3'clip, 5'UTR, 3'UTR,
2288 exon, intron, polyA_site, rRNA, tRNA, scRNA, snoRNA, and snRNA).
2292 #Any region containing a signal controlling or altering gene function or
2293 expression that cannot be described by other Signal keys (promoter,
2294 CAAT_signal, TATA_signal, -35_signal, -10_signal, GC_signal, RBS,
2295 polyA_signal, enhancer, attenuator, terminator, and rep_origin).
2299 #Any secondary or tertiary structure or conformation that cannot be
2300 described by other Structure keys (stem_loop and D-loop).
2304 #The indicated nucleotide is a modified nucleotide and should be
2305 substituted for by the indicated molecule (given in the mod_base
2310 #messenger RNA; includes 5' untranslated region (5' UTR), coding sequences
2311 (CDS, exon) and 3' untranslated region (3' UTR).
2315 #Extra nucleotides inserted between rearranged immunoglobulin segments.
2319 #The presented sequence revises a previous version of the sequence at
2324 #Region containing polycistronic transcript under the control of the same
2325 regulatory sequences.
2329 Origin of transfer; region of DNA where transfer is initiated during the
2330 process of conjugation or mobilization.
2334 #Recognition region necessary for endonuclease cleavage of an RNA
2335 transcript that is followed by polyadenylation; consensus=AATAAA.
2339 #Site on an RNA transcript to which will be added adenine residues by
2340 post-transcriptional polyadenylation.
2344 #Any RNA species that is not yet the mature RNA product; may include 5'
2345 clipped region (5' clip), 5' untranslated region (5' UTR), coding
2346 sequences (CDS, exon), intervening sequences (intron), 3' untranslated
2347 region (3' UTR), and 3' clipped region (3' clip).
2351 #Primary (initial, unprocessed) transcript; includes 5' clipped region
2352 (5' clip), 5' untranslated region (5' UTR), coding sequences (CDS, exon),
2353 intervening sequences (intron), 3' untranslated region (3' UTR), and 3'
2354 clipped region (3' clip).
2358 #Non-covalent primer binding site for initiation of replication,
2359 transcription, or reverse transcription. Includes site(s) for synthetic
2360 e.g., PCR primer elements.
2364 #Region on a DNA molecule involved in RNA polymerase binding to initiate
2369 #Non-covalent protein binding site on nucleic acid.
2373 #Ribosome binding site.
2377 #Region of genome containing repeating units.
2381 #Single repeat element.
2385 #Origin of replication; starting site for duplication of nucleic acid to
2386 give two identical copies.
2390 #Mature ribosomal RNA ; the RNA component of the ribonucleoprotein
2391 particle (ribosome) that assembles amino acids into proteins.
2395 #Switch region of immunoglobulin heavy chains. Involved in the
2396 rearrangement of heavy chain DNA leading to the expression of a
2397 different immunoglobulin class from the same B-cell.
2401 #Many tandem repeats (identical or related) of a short basic repeating
2402 unit; many have a base composition or other property different from the
2403 genome average that allows them to be separated from the bulk (main
2408 #Small cytoplasmic RNA; any one of several small cytoplasmic RNA
2409 molecules present in the cytoplasm and (sometimes) nucleus of a
2414 #Signal peptide coding sequence; coding sequence for an N-terminal
2415 domain of a secreted protein; this domain is involved in attaching
2416 nascent polypeptide to the membrane; leader sequence.
2420 #Small nuclear RNA involved in pre-mRNA splicing and processing.
2424 #Small nucleolar RNA molecules generally involved in rRNA modification
2429 #Identifies the biological source of the specified span of the sequence.
2430 This key is mandatory. Every entry will have, as a minimum, a single
2431 source key spanning the entire sequence. More than one source key per
2432 sequence is permittable.
2436 #Hairpin; a double-helical region formed by base-pairing between
2437 adjacent (inverted) complementary sequences in a single strand of RNA or
2442 #Sequence Tagged Site. Short, single-copy DNA sequence that
2443 characterizes a mapping landmark on the genome and can be detected by
2444 PCR. A region of the genome can be mapped by determining the order of a
2449 #TATA box; Goldberg-Hogness box; a conserved AT-rich septamer found
2450 about 25 bp before the start point of each eukaryotic RNA polymerase II
2451 transcript unit that may be involved in positioning the enzyme for
2452 correct initiation; consensus=TATA(A or T)A(A or T).
2456 #Sequence of DNA located either at the end of the transcript or adjacent
2457 to a promoter region that causes RNA polymerase to terminate
2458 transcription; may also be site of binding of repressor protein.
2462 #Transit peptide coding sequence; coding sequence for an N-terminal
2463 domain of a nuclear-encoded organellar protein; this domain is involved
2464 in post- translational import of the protein into the organelle.
2468 #Mature transfer RNA, a small RNA molecule (75-85 bases long) that
2469 mediates the translation of a nucleic acid sequence into an amino acid
2474 #Author is unsure of exact sequence in this region.
2478 #Variable region of immunoglobulin light and heavy chains, and T-cell
2479 receptor alpha, beta, and gamma chains. Codes for the variable amino
2480 terminal portion. Can be made up from V_segments, D_segments,
2481 N_regions, and J_segments.
2485 #Variable segment of immunoglobulin light and heavy chains, and T-cell
2486 receptor alpha, beta, and gamma chains. Codes for most of the variable
2487 region (V_region) and the last few amino acids of the leader peptide.
2491 #A related strain contains stable mutations from the same gene (e.g.,
2492 RFLPs, polymorphisms, etc.) that differ from the presented sequence at
2493 this location (and possibly others).
2497 #3'-most region of a precursor transcript that is clipped off during
2502 #Region near or at the 3' end of a mature transcript (usually following
2503 the stop codon) that is not translated into a protein; trailer.
2507 #5'-most region of a precursor transcript that is clipped off during
2512 #Region near or at the 5' end of a mature transcript (usually preceding
2513 the initiation codon) that is not translated into a protein; leader.
2517 #Pribnow box; a conserved region about 10 bp upstream of the start point
2518 of bacterial transcription units that may be involved in binding RNA
2519 polymerase; consensus=TAtAaT.
2523 #A conserved hexamer about 35 bp upstream of the start point of
2524 bacterial transcription units; consensus = TTGACa or TGTTGACA.
2526 >Biological Source Descriptor or Feature
2528 #This annotation is very important, as an entry cannot be processed by
2529 the databases unless it includes some basic information about the
2530 organism from which the sequence was derived. This basic information was
2531 entered previously in the submission, in the Organism and Sequences
2532 Form. The more detailed Organism Information form allows you to alter
2533 or add to the data you entered earlier.
2535 *Overview: Descriptor or Feature?
2537 #Sequin allows two types of biological source information to be entered,
2538 Biological Source Descriptors and Biological Source Features. Biological
2539 Source Descriptors, like other descriptors, provide organism information
2540 about an entire sequence, or an entire set of sequences, in an entry.
2541 Biological Source Features, like other features, provide organism
2542 information about a specific interval on a given sequence.
2544 #In most cases, you will want to use a Biological Source Descriptor, because
2545 all the sequences in the entry will derive from the same source.
2546 However, if you have sequenced a transgenic molecule, for example, one
2547 that is part plant and part bacterial, you would use Biological Source
2548 Features to annotate which sequence was derived from plant and which from
2551 #To add a Biological Source Descriptor, select Biological Source under
2552 the Descriptor section of the Annotate menu. To add a Biological
2553 Source Feature, select Biological Source under the Bibliographic and
2554 Comments section of the Annotate menu.
2556 #Annotating a Biological Source Descriptor or Feature is similar to
2557 annotating any descriptor or feature. For help in creating descriptors
2558 and features, see the appropriate section of the help documentation.
2559 The following are instructions for filling out Biological
2560 Source-specific forms.
2566 #The scrollable list contains the scientific names of many organisms.
2567 To reach a name on the list, either type the first few letters of the
2568 scientific name, or use the thumb bar. Click on a name from the list to
2569 fill out the scientific name field. If there is a common name for the
2570 organism, that field will be filled out automatically. You may also
2571 directly type in the scientific name. If you have any questions about
2572 the scientific or common name of an organism, see the NCBI
2573 <A HREF="http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html">
2576 http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html
2580 ***Location of Sequence
2582 #From the selection list, please enter the location of the genome that
2583 contains your sequence. Most entries will have a "Genomic" location.
2584 A brief description of the choices in this pop-up menu were listed
2587 ***Origin of Sequence
2589 #This menu is for the use of database personnel. Please leave this
2590 field empty. The Biological focus box should be checked in rare cases
2591 where multiple source features are annotated.
2593 **Genetic Codes Subpage
2595 #Please use these fields to select the nuclear and mitochondrial genetic
2596 code that should be used to translate the nucleic acid sequence. The
2597 genetic code for a eukaryotic organism is "Standard". If you selected
2598 an organism name from the scrollable list described above, this field
2599 was filled out automatically. Do not change these fields if they have
2600 been filled out automatically.
2602 #For more information regarding the translation tables available, see
2605 <A HREF="http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi?mode=c">
2611 #This information is normally entered by the database staff. They will
2613 <A HREF="http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html">
2615 http://www.ncbi.nlm.nih.gov/Taxonomy/tax.html
2617 maintained by the NCBI/GenBank.
2619 #If you disagree with the lineage supplied please notify the database
2622 #If you are running Sequin in its
2623 <A HREF="#NetConfigure">
2626 mode, you will see a button labeled "Lookup Taxonomy". Click on this
2627 button to perform an automatic look-up of the taxonomic lineage of the
2628 organism. Sequin will perform the look-up by accessing the Taxonomy
2629 database and will fill out the Taxonomic Lineage and
2632 #If you have any comments about the taxonomic lineage determined by
2633 Sequin, please submit these comments with your entry. Under the Sequin
2634 File menu, select Edit Submitter Info. Enter your comments in the box
2635 entitled "Special Instructions to Database Staff", on the Submission
2640 #This page allows you to enter additional information about the source
2641 and/or organism. Entering information is optional.
2645 #Choose a modifier from the pull-down menu on the left side of the page
2646 and type the appropriate name on the right side of the page. If you do
2647 not find appropriate modifiers in the scroll down list, you can enter
2648 additional source information as text in the field at the bottom of the
2649 page. You may select as many modifiers as you want.
2651 #The following is a description of the available modifiers:
2653 #-Cell-line: Cell line from which sequence derives.
2655 #-Cell-type: Type of cell from which sequence derives.
2657 #-Chromosome: Chromosome to which the gene maps.
2659 #-Clone: Name of clone from which sequence was obtained.
2661 #-Clone-lib: Name of library from which sequence was obtained.
2663 #-Collected-by: Name of person who collected sample. Do not use
2664 accented or non-ASCII characters.
2666 #-Collection-date: Date sample was collected. Must use format
2667 23-Mar-2005, Mar-2005, or 2005.
2669 #-Country: The country of origin of DNA samples used for epidemiological
2670 or population studies.
2672 #-Dev-stage: Developmental stage of organism.
2674 #-Endogenous-virus-name: Name of inactive virus that is integrated into
2675 the chromosome of its host cell and can therefore exhibit vertical
2678 #-Environmental-sample: Identifies sequence derived by direct molecular
2679 isolation from an unidentified organism. Do not include extra text when
2680 using this modifier.
2682 #-Frequency: Frequency of occurrence of a feature.
2684 #-Fwd-PCR-primer-name: Name or designation of forward primer used for
2687 #-Fwd-PCR-primer-seq: Sequence of forward primer used for amplification.
2689 #-Genotype: Genotype of the organism.
2691 #-Germline: If the sequence shown is DNA and a member of the
2692 immunoglobulin family, this qualifier is used to denote that the sequence
2693 is from unrearranged DNA. Do not include extra text when using this
2696 #-Haplotype: Haplotype of the organism.
2698 #-Identified-by: Name of person who identified sample. Do not use
2699 accented or non-ASCII characters.
2701 #-Isolation-source: Describes the local geographical source of the organism
2702 from which the sequence was derived
2704 #-Lab-host: Laboratory host used to propagate the organism from which
2705 the sequence was derived.
2707 #-Lat-Lon: Latitude and longitude of location where sample was
2708 collected. Preferred format is decimal degrees N/S E/W.
2710 #-Map: Map location of the gene.
2712 #-Plasmid-name: Name of plasmid from which the sequence was obtained.
2714 #-Plastid-name: Name of plastid from which the sequence was obtained.
2716 #-Pop-variant: Name of the population variant from which the sequence was
2719 #-Rearranged: If the sequence shown is DNA and a member of the
2720 immunoglobulin family, this qualifier is used to denote that the sequence
2721 is from rearranged DNA. Do not include extra text when using this
2724 #Rev-PCR-primer-name: Name or description of reverse primer used for
2727 #Rev-PCR-primer-seq: Sequence of reverse primer used for amplification.
2729 #-Segment: Name of viral genome fragmented into two or more nucleic acid
2732 #-Sex: Sex of the organism from which the sequence derives.
2734 #-Subclone: Name of subclone from which sequence was obtained.
2736 #-Tissue-lib: Tissue library from which the sequence was obtained.
2738 #-Tissue-type: Type of tissue from which sequence derives.
2740 #-Transgenic: Identified organism that was the recipient of transgenic
2741 DNA. Do not include extra text when using this modifier.
2745 #Choose a modifier from the pull-down menu on the left side of the page
2746 and type the appropriate name on the right side of the page. If you do
2747 not find appropriate modifiers in the scroll down list, you can enter
2748 additional organism information as text in the field at the bottom of
2749 the page. You may select as many modifiers as you want.
2751 #The following is a description of the available modifiers:
2753 #-Acronym: Standard synonym (usually of a virus) based on the initials
2754 of the formal name. An example is HIV-1.
2756 #-Anamorph: The scientific name applied to the asexual phase of a fungus.
2758 #-Authority: The author or authors of the organism name from which sequence
2761 #-Biotype: See biovar.
2763 #-Biovar: Variety of a species (usually a fungus, bacteria, or virus)
2764 characterized by some specific biological property (often geographical,
2765 ecological, or physiological). Same as biotype.
2767 #-Breed: The named breed from which sequence was obtained (usually applied
2768 to domesticated mammals).
2770 #-Chemovar: Variety of a species (usually a fungus, bacteria, or virus)
2771 characterized by its biochemical properties.
2773 #-Common: Common name of the organism from which sequence was obtained.
2775 #-Cultivar: Cultivated variety of plant from which sequence was obtained.
2777 #-Ecotype: The named ecotype (population adapted to a local habitat) from
2778 which sequence was obtained (customarily applied to populations of
2779 Arabidopsis thaliana).
2781 #-Forma: The forma (lowest taxonomic unit governed by the nomenclatural
2782 codes) of organism from which sequence was obtained. This term is usually
2783 applied to plants and fungi.
2785 #-Forma-specialis: The physiologically distinct form from which sequence
2786 was obtained (usually restricted to certain parasitic fungi).
2788 #-Group: Do not select this item.
2790 #-Isolate: Identification or description of the specific individual
2791 from which this sequence was obtained. An example is Patient X14.
2793 #-Old name: Do not select this item.
2795 #-Pathovar: Variety of a species (usually a fungus, bacteria or virus)
2796 characterized by the biological target of the pathogen. Examples
2797 include Pseudomonas syringae pathovar tomato and Pseudomonas syringae
2800 #-Serogroup: See serotype.
2802 #-Serotype: Variety of a species (usually a fungus, bacteria, or virus)
2803 characterized by its antigenic properties. Same as serogroup and
2806 #-Serovar: See serotype.
2808 #-Specific-host: When the sequence submission is from an organism that
2809 exists in a symbiotic, parasititc, or other special relationship with
2810 some second organism, use this modifier to identify the name of the
2813 #-Specimen-voucher: An identifier of the individual or collection of the
2814 source organism and the place where it is currently stored, usually an
2817 #-Strain: Strain of organism from which sequence was obtained.
2819 #-Subgroup: Do not select this item.
2821 #-Sub-species: Subspecies of organism from which sequence was obtained.
2823 #-Substrain: Sub-strain of organism from which sequence was obtained.
2825 #-Subtype: Subtype of organism from which sequence was obtained.
2827 #-Synonym: The synonym (alternate scientific name) of the organism name
2828 from which sequence was obtained.
2830 #-Teleomorph: The scientific name applied to the sexual phase of a fungus.
2832 #-Type: Type of organism from which sequence was obtained.
2834 #-Variety: Variety of organism from which sequence was obtained.
2838 #Please do not use this form. This field is reserved for information from
2839 NCBI's taxonomy database.
2845 #If there are alternative names for the organism from which the sequence
2846 was derived, enter them here. Please be aware that this is the
2847 appropriate field only for alternative names for the organism, not for
2848 alternative gene or protein names.
2850 **Cross-Refs Subpage
2852 #This page is for use by database staff only.
2856 *Overview: Descriptor or Feature?
2858 #Sequin allows two types of publications to be entered, Publication
2859 Descriptors and Publication Features. Publication Descriptors are
2860 bibliographic references that, like other descriptors, cover an entire
2861 sequence, or an entire set of sequences, in an entry. Publication
2862 Features are bibliographic references that, like other features, cover
2863 a specific interval on a given sequence.
2865 #Publications are entered into the Reference field of the database
2866 entry. References are citations of unpublished, in press, or published
2867 works that are relevant to the submitted sequence. Publications
2868 should provide information regarding the principle cloning and
2869 determination of the sequence within the record.
2871 #In general, there is one publication describing a sequence, and a
2872 Publication Descriptor should be used. To enter a Publication
2873 Descriptor, select Publications under the Annotate menu and click on
2874 Publication Descriptor.
2876 #However, if one publication describes the cloning of the 5' end of a
2877 gene, and another publication describes the cloning of the 3' end of
2878 the gene, Publication features may be used. To make a publication
2879 feature, choose Publication Feature in the Publications section of the
2880 Annotate menu. Enter the information about the publication, and then
2881 enter the nucleotide interval to which the publication refers on the
2884 *Citation on Entry Form
2888 #Using the radio buttons, select one of the three options:
2890 #-Unpublished: Select this option if a manuscript has been written but
2891 not yet submitted or has been submitted for publication but has not yet
2894 #-In Press: The article has been accepted for publication but is not yet
2897 #-Published: The article has been published.
2901 #Using the radio buttons, select the type of publication in which the
2902 sequence will appear.
2912 #-Proceedings Chapter: Abstract from a meeting
2914 #-Proceedings: A meeting
2918 #-Online Publication: Used for journals which publish strictly online and
2919 do not issue print copies.
2925 #Using the radio buttons, select one of the options.
2927 #-Refers to the entire sequence: Most publications should be classified
2930 #-Refers to part of the sequence: For use only when a publication
2931 discusses only part of the presented sequence. You must enter the
2932 locations in the location tab in later forms. This selection is only
2933 valid when adding a Publication feature, not descriptor.
2935 #-Cites a feature on the sequence: This selection should only be made in
2936 limited cases. Its use must coincide with the use of the /citation
2937 qualifier on the given feature.
2939 #After you have filled out the Citation on Entry form, click on
2940 "Proceed" to see the next form.
2942 *Citation Information Form (General)
2948 #Please enter the names of the authors. Note that the first name of the
2949 author is listed first. You can add as many authors to this page as
2950 necessary. After you type in the name of the third author, the box
2951 becomes a spreadsheet, and you can scroll down to the next line by
2952 using the thumb bar. The suffix toggle allows the addition of common
2953 suffixes to the author name. The consortium field should be used when
2954 a consortium is responsible for the sequencing or publication of the
2955 data. The consortium should not be the department or institute
2956 affiliation of the authors. Individual authors may be listed along
2957 with a consortium name.
2959 ***Affiliation Subpage
2961 #Please enter information about the institution where the sequencing was
2964 #Other pages in the Citation Information Form will be different,
2965 depending on the Class of publication selected in the Citation on Entry
2966 Form. Instructions for filling out the Citation Information Form for
2967 Journals is included here.
2969 *Citation Information Form (If Selected Class Was Journal)
2973 #Enter title for manuscript in the box.
2977 #Fill in the appropriate Journal, Volume, Issue, Pages, Day, and Year
2978 fields by typing information into the boxes. Select the month with the
2979 pop-up menu. If necessary, choose an option from the Erratum pop-up
2980 menu and explain the erratum.
2982 #If you are running Sequin in its
2983 <A HREF="#NetConfigure">
2986 mode, the program will look up the Title, Author, and Journal
2987 information in the MEDLINE database if you supply it with some minimal
2988 information. For example, if you know the MUID (MEDLINE Unique
2989 Identifier) of the publication, enter it in the appropriate box and
2990 select "Lookup By MUID." Sequin will automatically retrieve the rest
2991 of the information. One way to find the MUID of the publication is to
2992 look up the publication with the NCBI's
2994 <A HREF="http://www.ncbi.nlm.nih.gov/Entrez">
2997 service. Alternatively, if you do not know the MUID, enter the Journal,
2998 Volume, Pages, and Year. Then select "Lookup Article". Sequin will
2999 retrieve the missing Title and Author information.
3001 #The PubStatus toggle is used by database staff. If you have used the
3002 "Lookup by MUID" or "Lookup by PMID" functions, this field may be
3003 populated. Please do not edit the information.
3007 #This page is reserved for use by the database staff.
3013 #Details about the current version of Sequin.
3017 #Launches the help documentation.
3021 #Open an existing entry. This option will open a record that has been
3022 previously saved in Sequin. Furthermore, for analysis purposes, it can also
3024 a FASTA-formatted sequence file. The sequence will be displayed in Sequin and
3025 can be analyzed with tools such as CDD Search, but it should not be submitted,
3026 because it does not have the appropriate annotations.
3034 #Exports the currently displayed format to a file. Do not use export
3035 ASN1 for submission of sequences to the database.
3039 #Duplicates the entry. You can then view the entry simultaneously in
3040 different Display Formats.
3044 #Saves the entry. Note: This merely saves the entry so you can go back
3045 and edit it. It does not prepare the entry for submission to the
3046 database, that is, it does not validate the entry.
3052 *Save as Binary Seq-entry
3054 #Saves the file in a compressed format and should be used only when the
3055 file is to be imported into other analysis programs. Do not use this
3056 option to save files for submission directly to GenBank.
3060 #Replaces the displayed record with a previously saved version. This
3061 feature is useful if you have made unwanted changes since you last saved
3066 #Prepares the entry for submission to the database. See
3067 <A HREF="#SubmittingtheFinishedRecordtotheDatabase">
3068 Submitting the Finished Record to the Database
3070 in the Sequin help documentation.
3074 #Prints the window that is currently selected. The selected window can
3075 be one of the Sequin forms or pages, or the help documentation.
3085 #Copy the selected item.
3089 #Clear the selected item.
3093 #To edit a single sequence, select the sequence identifier in the Target
3094 Sequence pop-up menu, and click on Edit sequence. The sequence editor
3095 will be launched for that sequence. The
3096 <A HREF="#SequenceEditor">
3099 is discussed in more detail below.
3101 *Alignment Assistant
3103 #This option will launch the Alignment Assistant which is discussed in
3106 <A HREF="#Workingwithsetsofalignedsequences">
3111 *Edit Submitter Info
3113 #Opens up the Submission Instructions form, which allows you to enter
3114 additional information about the person submitting the record. Much of
3115 this information was entered on the first form in Sequin, the Submitting
3118 #You can also save the information from the Submitting Authors form
3119 here, so that you can use it in subsequent Sequin submissions. Click
3120 on "Edit Submitter Info" and, under the file menu in the resulting
3121 Submission Instructions form, click on Export Submitter Info to save
3122 the information to a file. For subsequent Sequin submissions, if you
3123 have already saved the submittor information, click on Import Submitter
3124 Info under the File menu on the Submission page of the Submitting
3129 #Indicate the type of submission. If it is a new submission, select
3130 New. If you are updating an existing submission in order to resubmit it
3131 to the databases, select Update. Check either the "Yes" or "No" radio
3132 button to indicate if the record should be released before publication.
3133 If you select "Yes", the entry will be released to the public after the
3134 database staff has added it to the database. If you select "No", fields
3135 will appear in which you can indicate the date on which the sequences
3136 should be released to the public. The submission will then be held back
3137 until formal publication of the sequence or
3138 GenBank Accession number, or until the Release Date, whichever comes
3139 first. If you have any special instructions, enter them in the box at
3140 the bottom of the page.
3144 #Update the name, affiliation, or contact numbers of the person
3145 submitting the record. Please supply a fax number to facilitate
3146 communication with database staff.
3150 #Update the names and affiliation of the people who should receive
3151 scientific credit for the generation of sequences in this entry. The
3152 address should list the principal institution in which the sequencing
3153 and/or analysis was carried out. If you are submitting the record as
3154 an update to the databases, explain the reason for the update on the
3155 Description subpage.
3159 #This selection allows you to replace a sequence with another sequence,
3160 merge two sequences that overlap at their ends, 'patch' a corrected
3161 fragment of a sequence to the current sequence, or copy features from
3162 one sequence to another.
3164 #Use Single Sequence to import a sequence in FASTA or ASN.1 format (for
3165 example, a sequence record that has already been saved in Sequin). If
3166 you are running Sequin in
3168 <A HREF="#NetConfigure">
3171 you can use Download Accession to import a record from Entrez. The
3172 Multiple Sequences option allows you to update multiple sequences using
3173 either FASTA or ASN.1 formats. In either format, each sequence
3174 identifier must be identical in the new and old sequences.
3176 #After you import the updated sequence, a new window will open that
3177 displays two graphical views and the text of the alignment of the new
3178 and old sequence. The first graphic displays the relative length of the
3179 two sequences and the length of the overlapping region between
3180 sequences. The second graphic represents any inserts, deletions, or
3181 point changes within the aligned region between the new and old
3182 sequences. Clicking on a region in this graphic will scroll to the
3183 corresponding nucleotide sequence in the alignment text below.
3185 #The Sequence Update box to the left shows the action that will be
3186 performed upon updating the sequence, i.e., no change, replace, extend
3187 5', extend 3', or patch. The patch function allows you to replace an
3188 internal fragment of the sequence without affecting flanking regions.
3189 You can also override the alignment between the new and old sequence
3190 using the Ignore alignment checkbox to force a sequence change of
3191 replace, Extend 5' or Extend 3'. This option allows you to append new
3192 sequence to with no overlap.
3194 #If the current sequence has annotation, you can use the Existing
3195 Features box to determine whether the annotation should remain or be
3196 removed upon updating the sequence. The Do not remove option is the
3197 default. However, you may chose to remove annotated features only in
3198 the aligned area, outside the aligned area, or to remove all currently
3201 #When updating via Download Accession or an ASN.1 file, the Import
3202 Features box allows you to specify whether features from the new file
3203 should be imported to the existing record. The dialog offers
3204 different options for cases where the features on the new file are
3205 identical to those on the existing record.
3207 #If you are using the Multiple Sequences option, you may choose to
3208 review the sequences and update them one by one using the Update this
3209 Sequence box at the bottom of the window. You may skip a sequence
3210 update or choose to update all sequences at once without reviewing them
3211 in the Update Sequence dialog.
3213 #In any case, please carefully review the sequence and annotation in the
3214 record viewer after using the Update Sequence function.
3218 #This selection functions similar to the
3220 <A HREF="#UpdateSequence">
3224 function. However, you can only extend the existing sequence in either
3225 the 5' or 3' direction in cases with no overlap between the existing
3230 #This selection allows you to propagate any annotated feature from one
3231 sequence in an aligned set to other sequences within the set. For
3232 example, if one nucleotide sequence in the alignment contains a CDS
3233 feature, you can annotate a similar CDS on the other nucleotide
3234 sequences in the set.
3236 #The default source of features to be propagated is the first member
3237 of the set. If you would like to use a different entry as the source of
3238 the features, scope to that entry in the Target Sequence menu before
3239 selecting Feature Propagate from the Edit menu.
3241 #The Feature Propagate window allows you to select which sequences
3242 should receive the new annotation and which features will be
3243 propagated. You can also select whether the features will be extended
3244 or split at gaps in the alignment. The split at gaps selection will
3245 produce two features, one on either side of the gap within the
3246 alignment. If you are propagating a CDS feature, you may specify that
3247 the translation end or extend through internal stop codons. You may
3248 also extend the translation after the stop codon on the source entry by
3249 chosing to translate the CDS after partial 3' boundary. If the CDS
3250 that you are propagating to other records is partial on either end, you
3251 should select the 'Cleanup CDS partials after propagation' check box.
3252 This will retain the partial nature of the CDS features on all records.
3253 The fuse adjacent propagated intervals function will create one
3254 feature from two of the same type that contain abutting nucleotide
3255 intervals due to the nature of the alignment used for propagation.
3259 #This selection allows you to add a new sequence to an existing
3260 population, mutation, phylogenetic, or environmental sample set.
3261 You may import the new entry in FASTA format or ASN.1 format (for
3262 example, a sequence record that has been saved in Sequin).
3264 *Parse File to Source
3266 #This selection allows you to add unique information for one source
3267 qualifier for each of the records in a batch or set. The input file
3268 must be in the format of a tab-delimited, two column table. The first
3269 column should list the SeqID exactly as it was listed in the original
3270 FASTA file. The second column should list the text value for the
3271 desired source qualifier for each record. Once the file has been
3272 imported, a pop-up box will appear with the source qualifiers listed in
3273 the pull down menus. The qualifiers are separated into three menus:
3274 one for taxonomic information, one for the Organism modifiers and one
3275 for the Source modifiers. For example, in order to add the clone
3276 designations 57 and 49 to the sequences labeled seq1 and seq2, the table
3281 should be used and clone should be selected from the Source modifiers
3288 #Under this command, you can find and replace strings of letters in
3289 those fields of your submission that contain manually entered data.
3290 The fields that can be altered are Locus, Definition, Accession,
3291 Keywords, Source, Reference, and Features. To use this option, select
3292 Find and fill the Find and Replace lines with the appropriate text.
3293 Note that you cannot edit the sequence in this way.
3297 #Under this command, you can find strings of letters in all fields of
3298 your submission. You can use the Find First and Find Next buttons to
3299 identify the specified text sequentially through the flatfile.
3303 #This option allows you to move quickly in the record viewer to a gene
3304 feature containing the specified gene symbol.
3308 #This option allows you to move quickly in the record viewer to a CDS
3309 feature containing the specified product name.
3313 #This option allows you to move quickly in the record viewer to any
3314 feature annotated at the specified nucleotide location.
3318 #This option detects discrepancies between the format of your submission
3319 and that required by the database selected for entry. If discrepancies
3320 are present, it suggests ways in which to correct them. See the topic on
3322 <A HREF="#SubmittingtheFinishedRecordtotheDatabase">
3323 Submitting the Finished Record to the Database
3325 in the Sequin help documentation.
3329 #Performs a CDD BLAST search of the selected sequence against the
3331 <A HREF="http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml">
3332 Conserved Domain Database
3334 . To do a CDD BLAST search, Sequin must be in its network aware mode.
3336 #CDD currently contains domains derived from two popular collections,
3337 Smart and Pfam, plus contributions from colleagues at NCBI. The source
3338 databases also provide descriptions and links to citations. Since
3339 conserved domains correspond to compact structural units, CDs contain
3340 links to 3D-structure via Cn3D whenever possible.
3342 #The results of the CDD search will be displayed in the record
3343 viewer. These results are for your use only and should be removed
3344 from the record before submission.
3348 #This option allows you to run a BLAST search of your nucleotide
3349 #sequence(s) against NCBI's
3350 <A HREF="http://www.ncbi.nlm.nih.gov/VecScreen/UniVec.html">
3353 database. We highly recommend that you run this analysis and remove
3354 any vector contamination before submission. The UniVec database
3355 contains only one copy of every unique sequence segment from a large
3356 number of vectors. It also contains sequences for adapters, linkers
3357 and primers commonly used.
3359 #To run Vector screen on a submission containing multiple sequences,
3360 scope to ALL SEQUENCES in the Target Sequence pull-down before running
3361 the analysis. If there are many sequences, a status bar will appear
3362 indicating the progress of the search. If no contamination is found, a
3363 pop-up box will appear to notify you. If contamination is found, a
3364 miscellaneous feature will be annotated on the flatfile with the
3365 location of the contamination. Details will include the relative
3366 strength of the BLAST hit. You must trim the nucleotide sequence to
3367 remove this feature before submission.
3371 #The ORF Finder shows a graphical representation of all the open reading
3372 frames (ORFs) in the nucleotide sequence. This tool allows you to
3373 select ORFs and have them appear as coding sequence (CDS) features on
3374 the sequence record.
3376 #The ORFs, indicated by colored boxes, are defined as the longest
3377 sequence containing a start codon and a stop codon. If the
3378 entire nucleotide sequence is an open reading frame but does not
3379 contain an initial start or a terminal stop codon, it will be indicated
3380 as an ORF as well. All six reading frames are shown; the top three
3381 boxes represent the plus strands, and the bottom three boxes the minus
3382 strands. The nucleotide sequence intervals of the ORFs are displayed in
3383 descending length order on the right side of the window. Intervals on
3384 the complementary (minus) strand are indicated by a 'c'. ORFs can be
3385 selected by clicking either directly on them or on the sequence
3386 interval. The ORF length button selects the length of ORFs that are
3387 displayed. For example, the default of 10 shows all ORFs that are
3388 greater than 10 nucleotides in length. Clicking on the box labelled ORF
3389 changes the display; potential start codons are indicated in white, and
3390 stop codons in red. ORFs can be selected in this display also. The
3391 definition of start and stop codons is dependent on the genetic code
3392 that was selected. Be sure to choose the appropriate genetic code for
3393 translating the sequence before opening the ORF finder.
3397 #This option changes the sequence that is selected in the Target
3398 Sequence pop-up. Type the SeqID of the sequence in the box, and the
3399 record viewer will be updated to display that sequence.
3405 #The Style manager allows you to choose between different formats in
3406 which to view the Graphical Display Format. The graphical display is
3407 selected by choosing the Graphic display format on the record viewer.
3408 Using the Style Manager, you can also copy the style or modify it to
3413 #As a default, Sequin is available as a stand-alone program. However,
3414 the program can also be configured to exchange information with the NCBI
3415 (GenBank) over the Internet. The network-aware mode of Sequin is
3416 identical to the stand-alone mode, but it contains some additional
3419 #Sequin will only function in its network-aware mode if the computer on
3420 which it resides has a direct Internet connection. Electronic mail
3421 access to the Internet is insufficient. In general, if you can install
3422 and use a WWW browser on your system, you should be able to install and
3423 use network-aware Sequin. Check with your system administrator or
3424 Internet provider if you are uncertain as to whether you have direct
3425 Internet connectivity.
3427 #There are two ways to change Sequin into its network-aware mode. If
3428 you are still on the initial Welcome to Sequin form, select Net
3429 Configure under the Misc menu. If you have already worked on a Sequin
3430 submission and are looking at the record in the record viewer, select
3431 the Net Configure option from the Misc menu.
3433 #Most users will be able to use the default (Normal) settings on the
3434 Network Configuration page; select Accept to complete the configuration
3437 #If a "Normal" Connection does not work, you may need to select the
3438 Firewall Connection. Contact your system administrator to determine
3439 what to enter into the Proxy and Port fields. If you do not have
3440 access to the domain name server (DNS), uncheck this box.
3442 #The Timeout pop-up selects the length of time that your local copy of
3443 Sequin will wait for a reply from the NCBI server. You may need to set
3444 this number higher (i.e., 60 seconds or 5 minutes) if you are outside
3445 of the United States or have a bad internet connection.
3447 #If you have problems setting up the network configuration, contact
3449 <a href="mailto:info@ncbi.nlm.nih.gov">
3450 info@ncbi.nlm.nih.gov.
3453 #If you would like to change Sequin back to its stand-alone mode, select
3454 Net Configure again from the Misc menu. Click on Connection: None.
3456 #The network-aware mode of Sequin allows you to perform a number of
3457 additional, important functions. These functions all appear as
3458 additional menu items. A brief description of these functions follows.
3459 Further descriptions are available as indicated elsewhere in the help
3462 **Updating Existing GenBank Records
3464 #Using Sequin in its network-aware mode, you can download an existing
3465 GenBank record from Entrez using the GenBank accession number or GI
3466 identification number (NID). You can then use Sequin to make any
3467 necessary changes to the record, and resubmit it to GenBank as a
3470 <A HREF="#WelcometoSequinForm">
3473 for submitting sequence updates are presented under the Welcome to
3474 Sequin Form. You can download any record from Entrez and look at it in
3475 Sequin. However, you can only formally update those records which you
3476 have submitted since submitters retain editorial control of their
3479 **Performing a PubMed Look-Up
3481 #In its network-aware mode, Sequin can import the relevant sections of a
3482 PubMed record directly into a sequence submission record. Rather than
3483 typing in the entire citation, you can enter minimal information, such
3484 as the PubMed Unique Identifier (PMID), or Journal name, volume, year,
3487 <A HREF="#JournalPage">
3490 is explained in the section of the documentation entitled Publications.
3492 **Performing a Taxonomy Look-up
3493 #In its network-aware mode, Sequin can look
3494 up the taxonomic lineage of an organism from the NCBI's Taxonomy
3495 database. This look-up is normally performed by the NCBI database staff
3496 after the record has been submitted to GenBank. If you look up the
3497 taxonomy before submitting the sequence, you can make a note in the
3498 record of any disagreements. The
3499 <A HREF="#LineageSubpage">
3502 is explained in the section of the documentation covering
3503 Biological Source: Organism page: Lineage subpage.
3505 **Accessing the NCBI DeskTop
3506 #The NCBI DeskTop displays the internal
3507 structure of the record being viewed in Sequin. The
3508 <A HREF="#NCBIDeskTop">
3511 is explained under the Misc menu.
3515 #This option is only available if you are running Sequin in its
3516 <A HREF="#NetConfigure">
3521 #The NCBI DeskTop provides a view of the internal structure of the
3522 Sequin record, the ASN.1. Its display resembles a Venn diagram and
3523 represents all the structures represented in the ASN.1 data model.
3525 #In addition, a number of undocumented software tools from the NCBI can
3526 be accessed from the DeskTop. These tools are components of the NCBI
3527 portable software Toolkit. You can also customize these functions using
3528 the Toolkit with your own software tools. The Toolkit and its
3529 documentation are available from the NCBI by anonymous
3530 <A HREF="ftp://ftp.ncbi.nih.gov/toolbox/README">
3534 #The DeskTop should only be used by very seasoned users. At this time,
3535 we are not providing any documentation for these specialized functions.
3539 #This menu allows you to enter features and descriptors on the sequence.
3541 #The first six options, Genes and Named Regions, Coding Regions and
3542 Transcripts, Structural RNAs, Bibliographic and Comments, Sites and
3543 Bonds, and Remaining Features refer to types of Features that can be
3544 added to the sequence. Features are described in more detail in the
3545 above section entitled
3546 <A HREF="#Features">
3550 #If you are submitting a set of similar sequences, you can add the same
3551 feature across the entire span of each by using the Batch Feature Apply
3552 option. The feature must span the entire nucleotide sequence of each
3553 member; you can not annotate specific nucleotide locations using this
3554 option (for this, see
3556 <A HREF="#FeaturePropagate">Feature Propagate</A>).
3558 For each feature, you will be prompted to designate whether the feature
3559 is 5' or 3' partial and whether is is on the plus or minus strand. You
3560 may also add a comment or other qualifier to the feature. The Add
3561 Qualifier option allows you to add a qualifier to an existing feature.
3562 You must specify the feature and qualifier in the Add Qualifier pop-up
3563 box. Source qualifiers can be added to all entries using the Add
3564 Source Qualifier option. Qualifiers specific to the CDS and gene can
3565 be added using Add CDS-Gene-Prot-mRNA and RNA qualifiers using Add RNA
3566 Qual. In each case, a pop-up box appears with qualifier options
3567 appropriate for that feature.
3569 #The Batch Feature Edit function allows you to edit existing qualifiers.
3570 For each menu choice, a pop-up box allows you to select the feature
3571 containing the qualifier and the specific qualifier to be edited. You
3572 can use the Find/Replace text boxes to edit the information contained
3573 within the qualifier.
3575 #The Publications option allows you to add a Publication Feature or
3576 Publication Descriptor to the record. Publications are described in
3577 more detail in the above section entitled
3579 <A HREF="#Publications">
3583 #The Descriptors option allows you to add Descriptors to the
3584 record. Descriptors are described in more detail in the section
3586 <A HREF="#Descriptors">
3591 #The Generate Definition Line option will generate a title for your
3592 sequence based on the information provided in the record. This option
3593 will work for single sequences as well as sets of sequences, and can
3594 handle complex annotations with multiple features. The title will
3595 follow GenBank conventions, but may be modified by the database staff
3596 if it is not appropriate. The title you enter here will replace any
3597 title you entered elsewhere in the submission, for example, any title
3598 that was attached to the nucleotide sequence. For a description of
3599 definition lines, see
3601 <A HREF="#NucleotideDefinitionLine(Title)">
3602 Nucleotide Definition Line (Title)
3610 #Use this item to change the display font. From the pop-up menus,
3611 choose the style and size of type. For additional changes, mark the
3612 Bold, Italic, or Underline check boxes. The default font is 10-point
3617 #This editor allows you to modify the nucleotide or amino acid sequences
3618 and corresponding annotation in your entry. Although the Sequence Editor
3619 does allow you to undo changes you make to the sequence, we strongly
3620 suggest that you save a copy of the entry before launching the Sequence
3621 Editor so that you can revert to it if necessary.
3623 *Starting the Sequence Editor
3625 #The sequence that appears in the editor is dependent on the sequence(s)
3626 selected in the Target Sequence pull-down list. There are two ways to
3627 launch the sequence editor for nucleotide sequences. First, you can
3628 double click within sequence in any display format of the record viewer.
3629 A window containing the DNA sequence will appear. Second, in the record
3630 viewer, select the sequence that you would like to edit in the Target
3631 Sequence pop-up menu. Click on Edit Sequence under the Edit menu. You
3632 can launch the editor for protein sequences by selecting the protein
3633 sequence in the Target Sequence pop-up menu and double clicking within
3634 the protein sequence. A window containing the protein sequence will
3637 *Moving around the Sequence Editor
3639 #The cursor can be moved with the mouse or the arrow keys. The display
3640 window will change to show the position of the cursor. The sequence
3641 location of the first residue on each line is indicated on the left side
3642 of the window. The cursor location, or the range of sequences selected
3643 by the mouse, is shown in the upper left corner of the window. If you
3644 want to move the cursor to a specific location, type the number in the
3645 box on the top left of the sequence editor window, and hit the Go to
3646 button. If you want to look at a specific sequence, but not move the
3647 cursor to it, type the number in the upper right box of the window and
3648 hit the Look at button.
3650 *Editing Sequence and Existing Annotation
3652 #Select a piece of sequence by highlighting it with the mouse. To
3653 select the entire sequence, click on a sequence location number on the
3654 left side of the window. Any sequence that is highlighted in the
3655 Sequence Editor will show up as a box on the sequence when it is viewed
3656 in the Graphic Display Format.
3658 #One way to insert and delete residues is with the mouse. Move the
3659 cursor to the appropriate location and type. Text will be inserted to
3660 the left of the cursor. Delete sequence with the backspace or delete
3661 key. Text will be deleted to the left of the cursor. To delete a block
3662 of sequence, highlight it with the mouse and use the delete or backspace
3665 #Another way to insert and delete residues is with options under the Edit
3666 menu of the Sequence Editor. Use Cut to remove, or Copy to copy,
3667 highlighted residues. Copied residues can then be pasted elsewhere
3668 within the sequence by using the Paste option.
3670 #Features annotated via the record viewer will be displayed in a
3671 graphical format within the sequence editor. CDS features will be be
3672 displayed as a blue line across the appropriate nucleotide location. All
3673 other features will be displayed as a black line. To the left of the
3674 line, the name of the feature is displayed. In the case of CDS or mRNA
3675 features, the product name is shown. For gene features, the gene locus
3678 #Double-clicking on the feature will launch the feature editor just as in
3679 the record viewer. However, you can also change the nucleotide location
3680 of any feature within the graphical view. To move the entire feature,
3681 select the feature and drag it to the appropriate location while holding
3682 down the mouse button. To alter the 5' or 3' end of a feature, click on
3683 the feature's end and drag to the new location while holding down the
3686 #Before moving the nucleotide locations of a CDS feature, it may be
3687 useful to view the codons in the current translation. You can do this by
3688 clicking on the feature line and releasing the mouse button. A grid will
3689 be displayed that shows the triplet location for the current annotation.
3690 Once you have changed the nucleotide location of a CDS feature in the
3691 graphical view, you can see the new translation by using the Translate
3692 CDS button at the bottom of the window.
3694 #To save changes you have made to the sequence, press the Accept button
3695 at the bottom of the Sequence Editor display window. If you do not want
3696 to save the changes, press the Cancel button at the bottom of the
3697 Sequence Editor display window. Selecting either Accept or Cancel will
3698 quit the Sequence Editor and return you to the record viewer. Any
3699 changes you make will not become a permanent part of the Sequin record
3700 until you Save the record in the record viewer.
3702 #New features can be added using the Features menu.
3704 *Sequence Editor Window Buttons
3708 #Moves the cursor to the indicated location.
3712 #Moves the window to the indicated location without moving the cursor.
3714 **Merge Feature Mode/Split Feature Mode
3716 #In merge mode, any new sequence that is entered into a region spanned
3717 by an existing feature becomes part of that feature. For example, if
3718 you enter new sequence in the middle of a CDS, that sequence will be
3719 translated as part of the CDS. In split mode, the new sequence
3720 interrupts the feature. For example, if you enter new sequence in the
3721 middle of a CDS, the CDS will be interrupted by that sequence (see the
3722 location of the CDS in the record viewer).
3726 #Allows the sequence location numbering to be hidden, displayed on the
3727 side, or displayed on the top of the sequence.
3731 #Allows the display to show a grid separating each feature and sequence
3734 **Show/Hide Features
3736 #This box toggles between hiding and showing the features on a sequence.
3740 #Closes the Sequence Editor after saving all of the changes made to
3741 sequences and features.
3745 #Closes the Sequence Editor without saving any changes made to sequences or
3750 #Allows translation of coding region features after the location has been
3751 changed within the graphical view.
3753 *Sequence Editor File Menu
3757 #Allows the export of a range of sequence as a FASTA file or text file.
3758 Using the text option will also export overlapping features if they are
3759 displayed. If the features are first hidden, only the sequence will be
3760 exported. All protein translations displayed at the time of export, will
3761 be exported as well.
3765 #Closes the Sequence Editor after saving all of the changes made to
3766 sequence and features.
3770 #Closes the Sequence Editor without saving any changes made to sequences
3773 *Sequence Editor Edit Menu
3777 #Undoes all actions performed in the Sequence Editor since the last save.
3781 #Restores changes removed with Undo option
3785 #Removes the highlighted sequence. This sequence can be pasted elsewhere.
3789 #Pastes a cut or copied sequence to the right of the cursor.
3793 #Copies the highlighted sequence. This sequence can be pasted elsewhere.
3797 #Allows you to find DNA or amino acid sequence patterns in your sequence.
3798 The search is case insensitive. To find an exact match to a DNA
3799 sequence pattern, type the pattern in the box. The number of items found
3800 will be displayed and you can toggle through each instance with the Find
3801 Next button. To find the reverse complement of the pattern, click on
3802 the reverse complement box at the bottom of the pop-up box.
3804 #To find an exact match to an amino acid seqeunce pattern, type that
3805 sequence in the box, and click on "translate sequence". Sequin will look
3806 for all occurrences of that pattern in all six open reading frames. The
3807 DNA sequence encoding that protein sequence in any of the six reading
3808 frames will be hightlighted.
3812 #Allows translation of coding region features after the location has been
3813 changed within the graphical view.
3817 #Shows the complement of the submitted strand underneath the original.
3821 #Shows the indicated phase translation of the selected coding sequence.
3822 You can select any or all of the six reading frames, all reading frames
3823 or all positive or negative frames.
3825 **Protein Mismatches
3827 #Indicates amino acid which does not match conceptual translation
3828 following a nucleotide sequence change. The original amino acid sequence
3829 will be displayed until the Translate CDS function is used. Differences
3830 will be indicated by a red box around the amino acid abbreviation.
3832 **On-the-fly Protein Translations
3834 #Creates a second amino acid sequence in the display which retranslates
3835 as the nucleotide sequence is changed to allow side-by-side comparison to
3836 the original amino acid sequence.
3838 *Sequence Editor Features Menu
3840 #The menu contains a long list of all features that can be annotated on a
3841 sequence. These features are the same as those that are accessible
3842 through the main Sequin Annotate menu.
3844 #You can annotate features either in the Annotate menu or in the Sequence
3845 Editor. If you annotate them in the Annotate menu, you must type in the
3846 nucleotide sequence location of the feature. However, if you add
3847 features from the Sequence Editor, you can highlight the sequence that
3848 the feature covers, and the location of the sequence will be
3849 automatically entered in the feature location box. Additional
3850 explanations of how to annotate features are provided in the section on
3851 <A HREF="#Features">
3855 >Working with Sets of Aligned Sequences
3857 #Sequin allows you to work with aligned sets of closely related
3858 nucleotide sequences that are part of a population, phylogenetic, or
3859 mutation study. If the sequences are imported in a pre-aligned format,
3860 such as PHYLIP, Sequin uses this alignment. If the sequences are
3861 imported individually in FASTA format, Sequin can generate its own
3864 #You can view the aligned sequences in the Sequence Alignment Editor. In
3865 the record viewer, select All Sequences in the Target Sequences menu,
3866 and select the Alignment Display Format.
3868 #The Alignment Assistant is launched by selecting Alignment Assistant
3869 from the Edit menu in the record viewer. It can be used to apply
3870 features to the whole set of sequences using the alignment coordinates.
3871 Rather than calculating the nucleotide coordinates for every feature on
3872 every nucleotide sequence, you may select the feature's location using
3873 its alignment coordinates and apply it to every member of the set
3874 simultaneously. Sequin will calculate the nucleotide locations as they
3875 apply to each member of the set.
3877 *Alignment Assistant Window Buttons
3881 #The Go to alignment position and Go to sequence position buttons both
3882 scroll the aligment assistant so that the requested position is
3883 visible. If the requested position is already visible, nothing will
3884 happen. Unlike the Sequence editor window, the 'go to' button does not
3885 control the cursor position.
3889 #Allows the sequence location numbering to be hidden, displayed on the
3890 side, or displayed on the top of the sequence.
3894 #Allows the display to show a grid separating each feature and sequence for easier viewing.
3898 #It is possible to view annotated features in the aligment assistant.
3899 The features are displayed as a bar underneath the coordinates for that
3900 feature. The identity of the feature is displayed in the left-hand
3901 column. The default selection is to have the features Hidden. You may
3902 display the features associated only with the Target Sequence or
3903 features annotated on All Sequences in the alignment.
3905 *Alignment Assistant File Menu
3909 #Allows you to export the alignment to a file in three different
3910 formats. The contiguous and interleaved options export the alignment
3911 accordingly in FASTA+GAP format. The text representation option saves
3912 the alignment as it appears in the Alignment Assistant. Note that with
3913 this option features are included if they are displayed at the time of
3918 #Closes the Alignment Assistant window and saves any changes made.
3920 *Alignment Assistant Edit Menu
3922 **Remove Sequences from Alignment
3924 #Allows you to remove selected sequence(s) from the alignment. Select
3925 the sequence by clicking on it. You can select multiple sequences by
3926 holding down the control key. The sequence will then be highlighted in
3927 grey. Note that this option will remove the sequence from the
3928 alignment, but it is still present in your submission.
3930 **Validate Alignment
3932 #Checks for problems with the alignment. If errors are reported, please
3933 review and attempt to fix your alignment before submission.
3935 **Propagate Features
3937 #This function is the same as that available under the Edit Menu in the
3938 record viewer. A full description is available
3940 <A HREF="#FeaturePropagate">
3945 *Alignment Assistant View Menu
3949 #Allows you to select a sequence within the alignment as the target
3950 sequence. This can also be done by double-clicking on the sequence
3951 within the alignment. The SeqID of the target sequence will be
3952 displayed in red. Features can be displayed on the target sequence
3953 only and it is the sequence used for comparison in the
3955 <A HREF="#ShowSubstitutions">
3960 **Show Substitutions
3962 #Changes the alignment view so that identities are replaced with a "."
3963 and only substitutions are shown. The substitutions and identities are
3964 relative to the selected target sequence.
3966 *Alignment Assistant Features Menu
3968 #Allows the annotation of features to a single sequence or all sequences
3969 within the alignment. All features available in this menu are
3970 discussed through the main Sequin Annotate menu.
3972 #Select the feature location by clicking the start location on one of
3973 the sequences, keeping the mouse button depressed, drag the cursor to
3974 the end of the feature location. The selected area will now be
3975 underlined and red and the alignment coordinates of this area will be
3976 displayed in the upper left of the Alignment Assistant window.
3978 **Apply to Target Sequence
3980 #Allows you to choose a feature to be applied only to the target
3981 sequence. The locations may be entered manually or can be determined
3982 based on highlighting the sequence as described above.
3984 **Apply to Alignnent
3986 #Allows you to add the selected feature to all sequences within your
3987 alignment based on the alignment coordinates you have selected. Note
3988 that in the feature pop-up boxes in this menu, the Location will always
3989 be entered as the location relative to the alignment coordinates.
3995 <P CLASS=medium1><B>Questions or Comments?</B>
3996 <BR>Write to the <A HREF="mailto:info@ncbi.nlm.nih.gov">NCBI Service
3998 <P CLASS=medium1>Revised December 2, 2005
4002 <!-- end of content -->