1 /* Copyright (c) 2009 Peter Troshin
\r
2 * Copyright (c) 2013 Alexander Sherstnev
\r
4 * JAva Bioinformatics Analysis Web Services (JABAWS)
\r
7 * This library is free software; you can redistribute it and/or modify it under the terms of the
\r
8 * Apache License version 2 as published by the Apache Software Foundation
\r
10 * This library is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without
\r
11 * even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the Apache
\r
12 * License for more details.
\r
14 * A copy of the license is in apache_license.txt. It is also available here:
\r
15 * @see: http://www.apache.org/licenses/LICENSE-2.0.txt
\r
17 * Any republication or derived work distributed in source code form
\r
18 * must include this copyright and license notice.
\r
21 package compbio.runner.msa;
\r
23 import static org.testng.Assert.assertEquals;
\r
24 import static org.testng.Assert.assertFalse;
\r
25 import static org.testng.Assert.assertNotNull;
\r
26 import static org.testng.Assert.assertTrue;
\r
27 import static org.testng.Assert.fail;
\r
29 import java.io.File;
\r
30 import java.io.FileInputStream;
\r
31 import java.io.FileNotFoundException;
\r
32 import java.io.IOException;
\r
33 import java.text.ParseException;
\r
34 import java.util.ArrayList;
\r
35 import java.util.Collections;
\r
36 import java.util.List;
\r
38 import javax.xml.bind.JAXBException;
\r
39 import javax.xml.bind.ValidationException;
\r
41 import org.ggf.drmaa.DrmaaException;
\r
42 import org.ggf.drmaa.JobInfo;
\r
43 import org.testng.annotations.Test;
\r
45 import compbio.data.sequence.FastaSequence;
\r
46 import compbio.engine.AsyncExecutor;
\r
47 import compbio.engine.Configurator;
\r
48 import compbio.engine.FilePuller;
\r
49 import compbio.engine.SyncExecutor;
\r
50 import compbio.engine.client.ConfExecutable;
\r
51 import compbio.engine.client.ConfiguredExecutable;
\r
52 import compbio.engine.client.Executable;
\r
53 import compbio.engine.client.RunConfiguration;
\r
54 import compbio.engine.client.Executable.ExecProvider;
\r
55 import compbio.engine.cluster.drmaa.ClusterEngineUtil;
\r
56 import compbio.engine.cluster.drmaa.JobRunner;
\r
57 import compbio.engine.cluster.drmaa.StatisticManager;
\r
58 import compbio.engine.conf.RunnerConfigMarshaller;
\r
59 import compbio.engine.local.AsyncLocalRunner;
\r
60 import compbio.engine.local.LocalExecutorService;
\r
61 import compbio.engine.local.LocalRunner;
\r
62 import compbio.metadata.AllTestSuit;
\r
63 import compbio.metadata.ChunkHolder;
\r
64 import compbio.metadata.JobExecutionException;
\r
65 import compbio.metadata.JobStatus;
\r
66 import compbio.metadata.JobSubmissionException;
\r
67 import compbio.metadata.LimitsManager;
\r
68 import compbio.metadata.PresetManager;
\r
69 import compbio.metadata.ResultNotAvailableException;
\r
70 import compbio.metadata.RunnerConfig;
\r
71 import compbio.runner.OptionCombinator;
\r
72 import compbio.runner.RunnerUtil;
\r
73 import compbio.runner.msa.ClustalW;
\r
74 import compbio.util.FileWatcher;
\r
75 import compbio.util.SysPrefs;
\r
77 public class ClustalWTester {
\r
79 static final String clustalConfigFile = AllTestSuit.TEST_DATA_PATH + "ClustalParameters.xml";
\r
80 public static String test_outfile = "TO1381.clustal.out";
\r
81 public static String cluster_test_outfile = "TO1381.clustal.cluster.out";
\r
83 @Test(groups = { AllTestSuit.test_group_runner })
\r
84 public void RunLocally() {
\r
85 ClustalW clustal = new ClustalW();
\r
86 clustal.setInput(AllTestSuit.test_input).setOutput(test_outfile);
\r
89 // For local execution use relavive
\r
90 ConfiguredExecutable<ClustalW> confClustal = Configurator.configureExecutable(clustal, Executable.ExecProvider.Local);
\r
91 LocalRunner lr = new LocalRunner(confClustal);
\r
93 confClustal = (ConfiguredExecutable<ClustalW>) lr.waitForResult();
\r
94 assertNotNull(confClustal.getResults());
\r
95 } catch (JobSubmissionException e) {
\r
96 e.printStackTrace();
\r
97 fail(e.getLocalizedMessage());
\r
98 } catch (JobExecutionException e) {
\r
99 e.printStackTrace();
\r
100 fail(e.getLocalizedMessage());
\r
101 } catch (ResultNotAvailableException e) {
\r
102 e.printStackTrace();
\r
103 fail(e.getLocalizedMessage());
\r
107 @Test(groups = { AllTestSuit.test_group_runner })
\r
108 public void RunWithMatrix() {
\r
109 ClustalW clustal = new ClustalW();
\r
110 clustal.setInput(AllTestSuit.test_input).setOutput(test_outfile);
\r
111 clustal.setParameter("-matrix=BLOSUM62");
\r
114 // For local execution use relavive
\r
115 ConfiguredExecutable<ClustalW> confClustal = Configurator
\r
116 .configureExecutable(clustal, Executable.ExecProvider.Local);
\r
117 LocalRunner lr = new LocalRunner(confClustal);
\r
119 confClustal = (ConfiguredExecutable<ClustalW>) lr.waitForResult();
\r
120 assertNotNull(confClustal.getResults());
\r
121 } catch (JobSubmissionException e) {
\r
122 e.printStackTrace();
\r
123 fail(e.getLocalizedMessage());
\r
124 } catch (JobExecutionException e) {
\r
125 e.printStackTrace();
\r
126 fail(e.getLocalizedMessage());
\r
127 } catch (ResultNotAvailableException e) {
\r
128 e.printStackTrace();
\r
129 fail(e.getLocalizedMessage());
\r
133 @Test(groups = {AllTestSuit.test_group_runner})
\r
134 public void ConfigurationLoading() {
\r
136 RunnerConfig<ClustalW> clustalConfig = ConfExecutable.getRunnerOptions(ClustalW.class);
\r
137 assertNotNull(clustalConfig);
\r
138 assertTrue(clustalConfig.getArguments().size() > 0);
\r
140 PresetManager<ClustalW> clustalPresets = ConfExecutable.getRunnerPresets(ClustalW.class);
\r
141 assertNotNull(clustalPresets);
\r
142 assertTrue(clustalPresets.getPresets().size() > 0);
\r
143 clustalPresets.validate(clustalConfig);
\r
145 LimitsManager<ClustalW> clustalLimits = ConfExecutable.getRunnerLimits(ClustalW.class);
\r
146 assertNotNull(clustalLimits);
\r
147 assertTrue(clustalLimits.getLimits().size() > 0);
\r
148 clustalLimits.validate(clustalPresets);
\r
149 } catch (FileNotFoundException e) {
\r
150 e.printStackTrace();
\r
151 fail(e.getLocalizedMessage());
\r
152 } catch (IOException e) {
\r
153 e.printStackTrace();
\r
154 fail(e.getLocalizedMessage());
\r
155 } catch (ValidationException e) {
\r
156 e.printStackTrace();
\r
157 fail(e.getLocalizedMessage());
\r
161 @Test(groups = { AllTestSuit.test_group_runner })
\r
162 public void OptionsLocally() {
\r
164 RunnerConfigMarshaller<ClustalW> clustalmarsh = new RunnerConfigMarshaller<ClustalW>(RunnerConfig.class);
\r
165 RunnerConfig<ClustalW> clustalConfig = clustalmarsh.read(new FileInputStream(new File(clustalConfigFile)),RunnerConfig.class);
\r
167 OptionCombinator clustalOpc = new OptionCombinator(clustalConfig);
\r
168 List<String> options = clustalOpc.getOptionsAtRandom();
\r
169 for (int i = 0; i < options.size(); i++) {
\r
170 System.out.println("Using options: " + options);
\r
171 ClustalW clustal = new ClustalW();
\r
172 clustal.setInput(AllTestSuit.test_input).setOutput(test_outfile);
\r
174 // For local execution use relavive
\r
175 ConfiguredExecutable<ClustalW> confClustal = Configurator.configureExecutable(clustal, ExecProvider.Local);
\r
177 // Add options to the executable
\r
178 confClustal.addParameters(options);
\r
180 LocalRunner lr = new LocalRunner(confClustal);
\r
182 confClustal = (ConfiguredExecutable<ClustalW>) lr.waitForResult();
\r
183 assertNotNull(confClustal.getResults());
\r
184 Collections.shuffle(options);
\r
186 } catch (JobSubmissionException e) {
\r
187 e.printStackTrace();
\r
188 fail(e.getLocalizedMessage());
\r
189 } catch (JobExecutionException e) {
\r
190 e.printStackTrace();
\r
191 fail(e.getLocalizedMessage());
\r
192 } catch (JAXBException e) {
\r
193 e.printStackTrace();
\r
194 fail(e.getLocalizedMessage());
\r
195 } catch (ResultNotAvailableException e) {
\r
196 e.printStackTrace();
\r
197 fail(e.getLocalizedMessage());
\r
198 } catch (FileNotFoundException e) {
\r
199 e.printStackTrace();
\r
200 fail(e.getLocalizedMessage());
\r
204 public static final void main(String[] args)
\r
205 throws JobSubmissionException, JobExecutionException, InterruptedException {
\r
206 ClustalW clustal = new ClustalW();
\r
207 clustal.setInput(AllTestSuit.test_input).setOutput(test_outfile);
\r
208 // For local execution use relavive
\r
209 ConfiguredExecutable<ClustalW> confClustal = Configurator.configureExecutable(clustal);
\r
210 AsyncExecutor lr = new AsyncLocalRunner();
\r
211 lr.submitJob(confClustal);
\r
212 Thread.sleep(3000);
\r
213 LocalExecutorService.shutDown();
\r
217 @Test(enabled = false)
\r
218 public void AddParameters() {
\r
219 ArrayList<FastaSequence> seqs = new ArrayList<FastaSequence>();
\r
220 FastaSequence fs = new FastaSequence("tests1", "aqtctcatcatctcatctgcccccgggttatgagtagtacgcatctacg");
\r
221 FastaSequence fs2 = new FastaSequence("tests2", "aqtctcatcatctcatctgcccccgggttatgagtagtacgcatctacg");
\r
222 FastaSequence fs3 = new FastaSequence("tests3", "aqtctcatcatctcatctgcccccgggttatgagtagtacgcatctacg");
\r
226 ClustalW cl = new ClustalW();
\r
227 cl.setInput("input.txt").setOutput("output.txt");
\r
228 ConfiguredExecutable<ClustalW> confClustal;
\r
230 confClustal = Configurator.configureExecutable(cl);
\r
231 RunnerUtil.writeInput(seqs, confClustal);
\r
233 LocalRunner lr = new LocalRunner(confClustal);
\r
235 confClustal = (ConfiguredExecutable<ClustalW>) lr.waitForResult();
\r
236 assertNotNull(confClustal.getResults());
\r
238 assertTrue(confClustal.saveRunConfiguration());
\r
239 ConfiguredExecutable<ClustalW> cexec = (ConfiguredExecutable<ClustalW>) confClustal
\r
240 .loadRunConfiguration(new FileInputStream(new File(
\r
241 confClustal.getWorkDirectory(),
\r
242 RunConfiguration.rconfigFile)));
\r
243 assertNotNull(cexec);
\r
245 lr = new LocalRunner(cexec);
\r
247 confClustal = (ConfiguredExecutable<ClustalW>) lr.waitForResult();
\r
248 assertNotNull(confClustal.getResults());
\r
250 System.out.println("CE:" + cexec);
\r
251 } catch (JobSubmissionException e) {
\r
252 e.printStackTrace();
\r
253 fail(e.getMessage());
\r
254 } catch (FileNotFoundException e) {
\r
255 e.printStackTrace();
\r
256 fail(e.getMessage());
\r
257 } catch (JobExecutionException e) {
\r
258 e.printStackTrace();
\r
259 fail(e.getMessage());
\r
260 } catch (ResultNotAvailableException e) {
\r
261 e.printStackTrace();
\r
262 fail(e.getMessage());
\r
263 } catch (IOException e) {
\r
264 e.printStackTrace();
\r
265 fail(e.getMessage());
\r
269 @Test(groups = { AllTestSuit.test_group_runner })
\r
270 public void Persistance() {
\r
272 ClustalW clustal = new ClustalW();
\r
273 clustal.setError("errrr.txt");
\r
274 clustal.setInput(AllTestSuit.test_input);
\r
275 clustal.setOutput("outtt.txt");
\r
276 assertEquals(clustal.getInput(), AllTestSuit.test_input);
\r
277 assertEquals(clustal.getError(), "errrr.txt");
\r
278 assertEquals(clustal.getOutput(), "outtt.txt");
\r
279 ConfiguredExecutable<ClustalW> cClustal = Configurator.configureExecutable(clustal, Executable.ExecProvider.Local);
\r
281 SyncExecutor sexec = Configurator.getSyncEngine(cClustal);
\r
282 sexec.executeJob();
\r
283 cClustal = (ConfiguredExecutable<ClustalW>) sexec.waitForResult();
\r
284 assertNotNull(cClustal.getResults());
\r
285 // Save run configuration
\r
286 assertTrue(cClustal.saveRunConfiguration());
\r
288 // See if loaded configuration is the same as saved
\r
289 RunConfiguration loadedRun = RunConfiguration
\r
290 .load(new FileInputStream(new File(cClustal
\r
291 .getWorkDirectory(), RunConfiguration.rconfigFile)));
\r
292 assertTrue(((ConfExecutable<ClustalW>) cClustal)
\r
293 .getRunConfiguration().equals(loadedRun));
\r
294 // Load run configuration as ConfExecutable
\r
295 ConfiguredExecutable<ClustalW> resurrectedCclustal = (ConfiguredExecutable<ClustalW>) cClustal
\r
296 .loadRunConfiguration(new FileInputStream(new File(cClustal
\r
297 .getWorkDirectory(), RunConfiguration.rconfigFile)));
\r
298 assertNotNull(resurrectedCclustal);
\r
299 // See in details whether executables are the same
\r
300 assertEquals(resurrectedCclustal.getExecutable(), clustal);
\r
302 // Finally rerun the job in the new task directory
\r
303 ConfiguredExecutable<ClustalW> resclustal = Configurator
\r
304 .configureExecutable(resurrectedCclustal.getExecutable(),
\r
305 Executable.ExecProvider.Local);
\r
307 sexec = Configurator.getSyncEngine(resclustal, Executable.ExecProvider.Local);
\r
308 sexec.executeJob();
\r
309 cClustal = (ConfiguredExecutable<ClustalW>) sexec.waitForResult();
\r
310 assertNotNull(cClustal.getResults());
\r
311 } catch (JobSubmissionException e) {
\r
312 e.printStackTrace();
\r
313 fail(e.getMessage());
\r
314 } catch (JobExecutionException e) {
\r
315 e.printStackTrace();
\r
316 fail(e.getMessage());
\r
317 } catch (FileNotFoundException e) {
\r
318 e.printStackTrace();
\r
319 fail(e.getMessage());
\r
320 } catch (IOException e) {
\r
321 e.printStackTrace();
\r
322 fail(e.getMessage());
\r
323 } catch (ResultNotAvailableException e) {
\r
324 e.printStackTrace();
\r
325 fail(e.getMessage());
\r
329 @Test(groups = { AllTestSuit.test_group_runner })
\r
330 public void readStatistics() {
\r
332 ClustalW clustal = new ClustalW().setInput(AllTestSuit.test_input).setOutput(test_outfile);
\r
333 ConfiguredExecutable<ClustalW> confClustal = Configurator.configureExecutable(clustal, Executable.ExecProvider.Local);
\r
335 AsyncExecutor sexec = Configurator.getAsyncEngine(confClustal);
\r
336 String jobId = sexec.submitJob(confClustal);
\r
337 String file = confClustal.getWorkDirectory() + File.separator + ClustalW.getStatFile();
\r
338 FilePuller fw = FilePuller.newFilePuller(file, FileWatcher.MIN_CHUNK_SIZE_BYTES);
\r
342 while (!(sexec.getJobStatus(jobId) == JobStatus.FINISHED || sexec
\r
343 .getJobStatus(jobId) == JobStatus.FAILED || sexec
\r
344 .getJobStatus(jobId) == JobStatus.UNDEFINED)
\r
345 || fw.hasMoreData()) {
\r
346 ChunkHolder ch = fw.pull(position);
\r
347 String chunk = ch.getChunk();
\r
348 position = ch.getNextPosition();
\r
349 System.out.print(chunk);
\r
352 assertTrue(count > 1);
\r
353 ConfiguredExecutable<?> al = sexec.getResults(jobId);
\r
354 assertNotNull(al.getResults());
\r
355 } catch (JobSubmissionException e) {
\r
356 e.printStackTrace();
\r
357 fail(e.getMessage());
\r
358 } catch (ResultNotAvailableException e) {
\r
359 e.printStackTrace();
\r
360 fail(e.getMessage());
\r
361 } catch (IOException e) {
\r
362 e.printStackTrace();
\r
363 fail(e.getMessage());
\r
367 @Test(groups = { AllTestSuit.test_group_cluster, AllTestSuit.test_group_runner })
\r
368 public void RunOnCluster() {
\r
369 ClustalW clustal = new ClustalW();
\r
370 assertFalse(SysPrefs.isWindows, "Cluster execution can only be in unix environment");
\r
371 clustal.setInput(AllTestSuit.test_input).setOutput(cluster_test_outfile);
\r
374 ConfiguredExecutable<ClustalW> confClustal = Configurator.configureExecutable(clustal);
\r
375 JobRunner runner = JobRunner.getInstance(confClustal);
\r
376 // ClusterSession csession = JobRunner.getSession();
\r
377 assertNotNull(runner);
\r
378 runner.executeJob();
\r
379 // assertNotNull("JobId is null", jobId1);
\r
380 JobStatus status = runner.getJobStatus();
\r
381 assertTrue(status == JobStatus.PENDING || status == JobStatus.RUNNING);
\r
382 JobInfo info = runner.getJobInfo();
\r
383 assertNotNull(info);
\r
384 StatisticManager sm = new StatisticManager(info);
\r
387 String exits = sm.getExitStatus();
\r
388 assertNotNull("Exit status is null", exits);
\r
389 // cut 4 trailing zeros from the number
\r
390 int exitsInt = ClusterEngineUtil.CLUSTER_STAT_IN_SEC.parse(exits).intValue();
\r
391 assertEquals(0, exitsInt);
\r
392 System.out.println(sm.getAllStats());
\r
393 } catch (ParseException e) {
\r
394 e.printStackTrace();
\r
395 fail("Parse Exception: " + e.getMessage());
\r
397 // At present the task directory could not be completely removed
\r
398 // @see JobRunner.cleanup()
\r
399 assertFalse(runner.cleanup(), "Could not remove some files whilst cleaning up ");
\r
400 assertTrue(sm.hasExited());
\r
401 assertFalse(sm.wasAborted());
\r
402 assertFalse(sm.hasDump());
\r
403 assertFalse(sm.hasSignaled());
\r
404 } catch (JobSubmissionException e) {
\r
405 e.printStackTrace();
\r
406 fail("DrmaaException caught:" + e.getMessage());
\r
407 } catch (JobExecutionException e) {
\r
408 e.printStackTrace();
\r
409 fail("DrmaaException caught:" + e.getMessage());
\r
410 } catch (DrmaaException e) {
\r
411 e.printStackTrace();
\r
412 fail("DrmaaException caught:" + e.getMessage());
\r
416 @Test(groups = { AllTestSuit.test_group_cluster, AllTestSuit.test_group_runner })
\r
417 public void readStatisticsClusterExecution() {
\r
419 ClustalW clustal = new ClustalW();
\r
420 clustal.setInput(AllTestSuit.test_input);
\r
421 clustal.setOutput(test_outfile);
\r
422 ConfiguredExecutable<ClustalW> confClustal = Configurator.configureExecutable(clustal, Executable.ExecProvider.Cluster);
\r
424 AsyncExecutor sexec = Configurator.getAsyncEngine(confClustal);
\r
425 String jobId = sexec.submitJob(confClustal);
\r
426 String file = confClustal.getWorkDirectory() + File.separator + ClustalW.getStatFile();
\r
427 FilePuller fw = FilePuller.newFilePuller(file, FileWatcher.MIN_CHUNK_SIZE_BYTES);
\r
430 fw.waitForFile(200);
\r
431 /* Under certain circumstances DRMAA could report the status wrongly thus this loop never ends
\r
432 * TODO deal with this!
\r
434 while (!(sexec.getJobStatus(jobId) == JobStatus.FINISHED || sexec
\r
435 .getJobStatus(jobId) == JobStatus.FAILED )
\r
436 || fw.hasMoreData()) {
\r
437 ChunkHolder ch = fw.pull(position);
\r
438 String chunk = ch.getChunk();
\r
439 position = ch.getNextPosition();
\r
440 System.out.print(chunk);
\r
442 if(sexec.getJobStatus(jobId) == JobStatus.UNDEFINED ) {
\r
443 System.out.println("DRMAA reported wrong status for job + " + jobId +" continue anyway!");
\r
447 assertTrue(count > 1);
\r
448 ConfiguredExecutable<?> al = sexec.getResults(jobId);
\r
449 assertNotNull(al.getResults());
\r
450 } catch (JobSubmissionException e) {
\r
451 e.printStackTrace();
\r
452 fail(e.getMessage());
\r
453 } catch (ResultNotAvailableException e) {
\r
454 e.printStackTrace();
\r
455 fail(e.getMessage());
\r
456 } catch (IOException e) {
\r
457 e.printStackTrace();
\r
458 fail(e.getMessage());
\r