/* * Jalview - A Sequence Alignment Editor and Viewer (Version 2.8.2) * Copyright (C) 2014 The Jalview Authors * * This file is part of Jalview. * * Jalview is free software: you can redistribute it and/or * modify it under the terms of the GNU General Public License * as published by the Free Software Foundation, either version 3 * of the License, or (at your option) any later version. * * Jalview is distributed in the hope that it will be useful, but * WITHOUT ANY WARRANTY; without even the implied warranty * of MERCHANTABILITY or FITNESS FOR A PARTICULAR * PURPOSE. See the GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with Jalview. If not, see . * The Jalview Authors are detailed in the 'AUTHORS' file. */ package jalview.gui; import jalview.structure.AtomSpec; import jalview.util.MessageManager; import java.awt.BorderLayout; import java.awt.Color; import java.awt.Component; import java.awt.Dimension; import java.awt.Font; import java.awt.GridLayout; import java.awt.datatransfer.DataFlavor; import java.awt.datatransfer.Transferable; import java.awt.dnd.DnDConstants; import java.awt.dnd.DropTarget; import java.awt.dnd.DropTargetDragEvent; import java.awt.dnd.DropTargetDropEvent; import java.awt.dnd.DropTargetEvent; import java.awt.dnd.DropTargetListener; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import java.awt.event.ComponentEvent; import java.awt.event.MouseEvent; import java.awt.event.MouseListener; import java.io.File; import java.util.ArrayList; import java.util.Collection; import java.util.List; import javax.swing.DefaultListModel; import javax.swing.DefaultListSelectionModel; import javax.swing.JButton; import javax.swing.JLabel; import javax.swing.JList; import javax.swing.JPanel; import javax.swing.JScrollPane; import javax.swing.JTextField; import javax.swing.ListModel; import javax.swing.ListSelectionModel; import javax.swing.event.ListSelectionEvent; import javax.swing.event.ListSelectionListener; import fr.orsay.lri.varna.VARNAPanel; import fr.orsay.lri.varna.components.ReorderableJList; import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax; import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed; import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength; import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses; import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener; import fr.orsay.lri.varna.models.FullBackup; import fr.orsay.lri.varna.models.VARNAConfig; import fr.orsay.lri.varna.models.rna.Mapping; import fr.orsay.lri.varna.models.rna.RNA; public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding implements DropTargetListener, InterfaceVARNAListener, MouseListener { /** * */ // private static final long serialVersionUID = -790155708306987257L; private String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA"; private String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...))))).."; private String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...))))).."; public VARNAPanel vp; protected JPanel _tools = new JPanel(); private JPanel _input = new JPanel(); private JPanel _seqPanel = new JPanel(); private JPanel _strPanel = new JPanel(); private JLabel _info = new JLabel(); private JTextField _str = new JTextField(); private JTextField _seq = new JTextField(); private JLabel _strLabel = new JLabel( MessageManager.getString("label.str")); private JLabel _seqLabel = new JLabel( MessageManager.getString("label.seq")); private JButton _createButton = new JButton( MessageManager.getString("action.create")); private JButton _updateButton = new JButton( MessageManager.getString("action.update")); private JButton _deleteButton = new JButton( MessageManager.getString("action.delete")); private JButton _duplicateButton = new JButton( MessageManager.getString("action.snapshot")); protected JPanel _listPanel = new JPanel(); private ReorderableJList _sideList = null; private static String errorOpt = "error"; @SuppressWarnings("unused") private boolean _error; private Color _backgroundColor = Color.white; private static int _nextID = 1; @SuppressWarnings("unused") private int _algoCode; private BackupHolder _rnaList; /* * public AppVarnaBinding() { //super("VARNA in Jalview"); * //this.set_seq("ATGC"); //this.set_str(".()."); //RNAPanelDemoInit(); * * //initVarna("ATGCATGATATATATATAT","....((((...))))...."); * initVarna(this.DEFAULT_SEQUENCE,this.DEFAULT_STRUCTURE1); } */ public AppVarnaBinding(String seq, String struc) { // super("VARNA in Jalview"); initVarna(seq, struc); } public AppVarnaBinding(ArrayList rnaList) { // super("VARNA in Jalview"); initVarnaEdit(rnaList); } private void initVarna(String seq, String str) { DefaultListModel dlm = new DefaultListModel(); DefaultListSelectionModel m = new DefaultListSelectionModel(); m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); m.setLeadAnchorNotificationEnabled(false); _sideList = new ReorderableJList(); _sideList.setModel(dlm); _sideList.addMouseListener(this); _sideList.setSelectionModel(m); _sideList.setPreferredSize(new Dimension(100, 0)); _sideList.addListSelectionListener(new ListSelectionListener() { public void valueChanged(ListSelectionEvent arg0) { if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting()) { FullBackup sel = (FullBackup) _sideList.getSelectedValue(); Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA() .getSize(), sel.rna.getSize()); vp.showRNAInterpolated(sel.rna, sel.config, map); _seq.setText(sel.rna.getSeq()); _str.setText(sel.rna.getStructDBN()); } } }); _rnaList = new BackupHolder(dlm, _sideList); RNA _RNA1 = new RNA("User defined 1"); try { vp = new VARNAPanel("0", "."); _RNA1.setRNA(seq, str); _RNA1.drawRNARadiate(vp.getConfig()); } catch (ExceptionNonEqualLength e) { vp.errorDialog(e); } catch (ExceptionUnmatchedClosingParentheses e2) { e2.printStackTrace(); } catch (ExceptionFileFormatOrSyntax e3) { e3.printStackTrace(); } vp.setPreferredSize(new Dimension(400, 400)); _rnaList.add(vp.getConfig().clone(), _RNA1, generateDefaultName(), true); // TODO setBackground(_backgroundColor); vp.setBackground(_backgroundColor); // TODO getContentPane().setLayout(new BorderLayout()); // TODO getContentPane().add(vp, BorderLayout.CENTER); // setVisible(true); vp.addVARNAListener(this); } private void initVarnaEdit(ArrayList rnaInList) { DefaultListModel dlm = new DefaultListModel(); int marginTools = 40; DefaultListSelectionModel m = new DefaultListSelectionModel(); m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); m.setLeadAnchorNotificationEnabled(false); _sideList = new ReorderableJList(); _sideList.setModel(dlm); _sideList.addMouseListener(this); _sideList.setSelectionModel(m); _sideList.setPreferredSize(new Dimension(100, 0)); _sideList.addListSelectionListener(new ListSelectionListener() { public void valueChanged(ListSelectionEvent arg0) { // System.out.println(arg0); if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting()) { FullBackup sel = (FullBackup) _sideList.getSelectedValue(); Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA() .getSize(), sel.rna.getSize()); // vp.showRNAInterpolated(sel.rna, sel.config, map); vp.showRNA(sel.rna, sel.config); // _seq.setText(sel.rna.getSeq()); _str.setText(sel.rna.getStructDBN()); } } }); _rnaList = new BackupHolder(dlm, _sideList); try { vp = new VARNAPanel("0", "."); for (int i = 0; i < rnaInList.size(); i++) { rnaInList.get(i).drawRNARadiate(vp.getConfig()); } } catch (ExceptionNonEqualLength e) { vp.errorDialog(e); } vp.setPreferredSize(new Dimension(400, 400)); for (int i = 0; i < rnaInList.size(); i++) { if (i < rnaInList.size() - 1) { _rnaList.add(vp.getConfig().clone(), rnaInList.get(i), rnaInList .get(i).getName()); } else { _rnaList.add(vp.getConfig().clone(), rnaInList.get(i), rnaInList .get(i).getName(), true); } } /* * _rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName()); * _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true); */ JScrollPane listScroller = new JScrollPane(_sideList); listScroller.setPreferredSize(new Dimension(150, 0)); vp.setBackground(_backgroundColor); Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12"); // _seqLabel.setHorizontalTextPosition(JLabel.LEFT); // _seqLabel.setPreferredSize(new Dimension(marginTools, 15)); _seq.setFont(textFieldsFont); _seq.setText(rnaInList.get(0).getSeq()); _updateButton.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { FullBackup sel = (FullBackup) _sideList.getSelectedValue(); sel.rna.setSequence("A"); } }); // _seqPanel.setLayout(new BorderLayout()); // _seqPanel.add(_seqLabel, BorderLayout.WEST); // _seqPanel.add(_seq, BorderLayout.CENTER); _strLabel.setPreferredSize(new Dimension(marginTools, 15)); _strLabel.setHorizontalTextPosition(JLabel.LEFT); _str.setFont(textFieldsFont); _strPanel.setLayout(new BorderLayout()); _strPanel.add(_strLabel, BorderLayout.WEST); _strPanel.add(_str, BorderLayout.CENTER); _input.setLayout(new GridLayout(1, 0)); // _input.add(_seqPanel); _input.add(_strPanel); JPanel goPanel = new JPanel(); goPanel.setLayout(new BorderLayout()); _tools.setLayout(new BorderLayout()); _tools.add(_input, BorderLayout.CENTER); // _tools.add(_info, BorderLayout.SOUTH); _tools.add(goPanel, BorderLayout.EAST); /* * _deleteButton.addActionListener(new ActionListener() { public void * actionPerformed(ActionEvent e) { _rnaList.removeSelected(); } }); * _duplicateButton.addActionListener(new ActionListener() { public void * actionPerformed(ActionEvent e) { * _rnaList.add((VARNAConfig)vp.getConfig(). * clone(),vp.getRNA().clone(),vp.getRNA * ().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new * Date()),true); }}); */ goPanel.add(_updateButton, BorderLayout.CENTER); JPanel ops = new JPanel(); ops.setLayout(new GridLayout(1, 2)); ops.add(_deleteButton); ops.add(_duplicateButton); JLabel j = new JLabel( MessageManager.getString("label.structures_manager"), JLabel.CENTER); _listPanel.setLayout(new BorderLayout()); // _listPanel.add(ops, BorderLayout.SOUTH); _listPanel.add(j, BorderLayout.NORTH); _listPanel.add(listScroller, BorderLayout.CENTER); // JSplitPane split = new // JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp); /** * TODO getContentPane().setLayout(new BorderLayout()); * getContentPane().add(split, BorderLayout.CENTER); * getContentPane().add(_tools, BorderLayout.NORTH); */ // TODO setVisible(true); DropTarget dt = new DropTarget(vp, this); vp.addVARNAListener(this); } public JPanel getTools() { return _tools; } public JPanel getListPanel() { return _listPanel; } /** * TODO: Is it effective to transfer the whole RNA? * * @return Currently selected RNA */ public RNA getSelectedRNA() { return _rnaList.getElementAt(_sideList.getSelectedIndex()).rna; } /** * Substitute currently selected RNA with the edited one * * @param rnaEdit */ public void updateSelectedRNA(RNA rnaEdit) { vp.repaint(); vp.showRNA(rnaEdit); } /* * private void RNAPanelDemoInit() { DefaultListModel dlm = new * DefaultListModel(); * * * int marginTools = 40; * * DefaultListSelectionModel m = new DefaultListSelectionModel(); * m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); * m.setLeadAnchorNotificationEnabled(false); * * * _sideList = new ReorderableJList(); _sideList.setModel(dlm); * _sideList.addMouseListener(this); _sideList.setSelectionModel(m); * _sideList.setPreferredSize(new Dimension(100, 0)); * _sideList.addListSelectionListener( new ListSelectionListener(){ public * void valueChanged(ListSelectionEvent arg0) { //System.out.println(arg0); if * (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting()) { FullBackup * sel = (FullBackup) _sideList.getSelectedValue(); Mapping map = * Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize()); * vp.showRNAInterpolated(sel.rna,sel.config,map); * _seq.setText(sel.rna.getSeq()); _str.setText(sel.rna.getStructDBN()); } } * }); * * _rnaList = new BackupHolder(dlm,_sideList); RNA _RNA1 = new * RNA("User defined 1"); RNA _RNA2 = new RNA("User defined 2"); try { vp = * new VARNAPanel("0","."); _RNA1.setRNA(DEFAULT_SEQUENCE, * DEFAULT_STRUCTURE1); _RNA1.drawRNARadiate(vp.getConfig()); * _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2); * _RNA2.drawRNARadiate(vp.getConfig()); } catch (ExceptionNonEqualLength e) { * vp.errorDialog(e); } catch (ExceptionUnmatchedClosingParentheses e2) { * e2.printStackTrace(); } catch (ExceptionFileFormatOrSyntax e3) { * e3.printStackTrace(); } vp.setPreferredSize(new Dimension(400, 400)); * _rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName()); * _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true); * * JScrollPane listScroller = new JScrollPane(_sideList); * listScroller.setPreferredSize(new Dimension(150, 0)); * * setBackground(_backgroundColor); vp.setBackground(_backgroundColor); * * * Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12"); * * _seqLabel.setHorizontalTextPosition(JLabel.LEFT); * _seqLabel.setPreferredSize(new Dimension(marginTools, 15)); * _seq.setFont(textFieldsFont); _seq.setText(DEFAULT_SEQUENCE); * * _createButton.addActionListener(new ActionListener() { public void * actionPerformed(ActionEvent e) { try { RNA nRNA = new * RNA(generateDefaultName()); nRNA.setRNA(_seq.getText(), _str.getText()); * nRNA.drawRNARadiate(vp.getConfig()); _rnaList.add(new * VARNAConfig(),nRNA,true); } catch (ExceptionUnmatchedClosingParentheses e1) * { JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error", * JOptionPane.ERROR_MESSAGE); } catch (ExceptionFileFormatOrSyntax e1) { * JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error", * JOptionPane.ERROR_MESSAGE); } } }); * * * _seqPanel.setLayout(new BorderLayout()); _seqPanel.add(_seqLabel, * BorderLayout.WEST); _seqPanel.add(_seq, BorderLayout.CENTER); * * _strLabel.setPreferredSize(new Dimension(marginTools, 15)); * _strLabel.setHorizontalTextPosition(JLabel.LEFT); * _str.setFont(textFieldsFont); _strPanel.setLayout(new BorderLayout()); * _strPanel.add(_strLabel, BorderLayout.WEST); _strPanel.add(_str, * BorderLayout.CENTER); * * _input.setLayout(new GridLayout(2, 0)); _input.add(_seqPanel); * _input.add(_strPanel); * * JPanel goPanel = new JPanel(); goPanel.setLayout(new BorderLayout()); * * _tools.setLayout(new BorderLayout()); _tools.add(_input, * BorderLayout.CENTER); _tools.add(_info, BorderLayout.SOUTH); * _tools.add(goPanel, BorderLayout.EAST); * * _deleteButton.addActionListener(new ActionListener() { public void * actionPerformed(ActionEvent e) { _rnaList.removeSelected(); } }); * _duplicateButton.addActionListener(new ActionListener() { public void * actionPerformed(ActionEvent e) { * _rnaList.add((VARNAConfig)vp.getConfig().clone * (),vp.getRNA().clone(),vp.getRNA * ().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new * Date()),true); }}); * * JPanel ops = new JPanel(); ops.setLayout(new GridLayout(1,2)); * ops.add(_deleteButton); ops.add(_duplicateButton); * * JLabel j = new JLabel("Structures Manager",JLabel.CENTER); * _listPanel.setLayout(new BorderLayout()); * * _listPanel.add(ops,BorderLayout.SOUTH); * _listPanel.add(j,BorderLayout.NORTH); * _listPanel.add(listScroller,BorderLayout.CENTER); * * goPanel.add(_createButton, BorderLayout.CENTER); * * JSplitPane split = new * JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp); * getContentPane().setLayout(new BorderLayout()); getContentPane().add(split, * BorderLayout.CENTER); getContentPane().add(_tools, BorderLayout.NORTH); * * setVisible(true); DropTarget dt = new DropTarget(vp, this); * * vp.addVARNAListener(this); } */ public static String generateDefaultName() { return "User file #" + _nextID++; } public RNA getRNA() { return (RNA) _sideList.getSelectedValue(); } public String[][] getParameterInfo() { String[][] info = { // Parameter Name Kind of Value Description, { "sequenceDBN", "String", "A raw RNA sequence" }, { "structureDBN", "String", "An RNA structure in dot bracket notation (DBN)" }, { errorOpt, "boolean", "To show errors" }, }; return info; } public void init() { vp.setBackground(_backgroundColor); _error = true; } @SuppressWarnings("unused") private Color getSafeColor(String col, Color def) { Color result; try { result = Color.decode(col); } catch (Exception e) { try { result = Color.getColor(col, def); } catch (Exception e2) { return def; } } return result; } public VARNAPanel get_varnaPanel() { return vp; } public void set_varnaPanel(VARNAPanel surface) { vp = surface; } public String get_seq() { return _seq.getText(); } public void set_seq(String _seq) { this._seq.setText(_seq); } public String get_str() { return _str.getText(); } public void set_str(String _str) { this._str.setText(_str); } public JLabel get_info() { return _info; } public void set_info(JLabel _info) { this._info = _info; } /* * public static void main(String[] args) { AppVarnaBinding d = new * AppVarnaBinding(); d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); * d.pack(); d.setVisible(true); } */ public void dragEnter(DropTargetDragEvent arg0) { // TODO Auto-generated method stub } public void dragExit(DropTargetEvent arg0) { // TODO Auto-generated method stub } public void dragOver(DropTargetDragEvent arg0) { // TODO Auto-generated method stub } public void drop(DropTargetDropEvent dtde) { try { Transferable tr = dtde.getTransferable(); DataFlavor[] flavors = tr.getTransferDataFlavors(); for (int i = 0; i < flavors.length; i++) { if (flavors[i].isFlavorJavaFileListType()) { dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE); Object ob = tr.getTransferData(flavors[i]); if (ob instanceof List) { List list = (List) ob; for (int j = 0; j < list.size(); j++) { Object o = list.get(j); if (dtde.getSource() instanceof DropTarget) { DropTarget dt = (DropTarget) dtde.getSource(); Component c = dt.getComponent(); if (c instanceof VARNAPanel) { String path = o.toString(); VARNAPanel vp = (VARNAPanel) c; try { FullBackup bck = VARNAPanel.importSession(path); _rnaList.add(bck.config, bck.rna, bck.name, true); } catch (ExceptionLoadingFailed e3) { int mn = 1; Collection mdls = fr.orsay.lri.varna.factories.RNAFactory .loadSecStr(path); for (RNA r : mdls) { r.drawRNA(vp.getConfig()); String name = r.getName(); if (name.equals("")) { name = path.substring(path .lastIndexOf(File.separatorChar) + 1); } if (mdls.size() > 1) { name += " (Model " + mn++ + ")"; } _rnaList.add(vp.getConfig().clone(), r, name, true); } } } } } } // If we made it this far, everything worked. dtde.dropComplete(true); return; } } // Hmm, the user must not have dropped a file list dtde.rejectDrop(); } catch (Exception e) { e.printStackTrace(); dtde.rejectDrop(); } } public void dropActionChanged(DropTargetDragEvent arg0) { } private class BackupHolder { private DefaultListModel _rnaList; private ArrayList _rnas = new ArrayList(); JList _l; public BackupHolder(DefaultListModel rnaList, JList l) { _rnaList = rnaList; _l = l; } public void add(VARNAConfig c, RNA r) { add(c, r, r.getName(), false); } public void add(VARNAConfig c, RNA r, boolean select) { add(c, r, r.getName(), select); } public void add(VARNAConfig c, RNA r, String name) { add(c, r, name, false); } public void add(VARNAConfig c, RNA r, String name, boolean select) { if (select) { _l.removeSelectionInterval(0, _rnaList.size()); } if (name.equals("")) { name = generateDefaultName(); } FullBackup bck = new FullBackup(c, r, name); _rnas.add(0, r); _rnaList.add(0, bck); if (select) { _l.setSelectedIndex(0); } } public void remove(int i) { _rnas.remove(i); _rnaList.remove(i); } public DefaultListModel getModel() { return _rnaList; } public boolean contains(RNA r) { return _rnas.contains(r); } /* * public int getSize() { return _rnaList.getSize(); } */ public FullBackup getElementAt(int i) { return (FullBackup) _rnaList.getElementAt(i); } public void removeSelected() { int i = _l.getSelectedIndex(); if (i != -1) { if (_rnaList.getSize() == 1) { RNA r = new RNA(); try { r.setRNA(" ", "."); } catch (ExceptionUnmatchedClosingParentheses e1) { } catch (ExceptionFileFormatOrSyntax e1) { } vp.showRNA(r); vp.repaint(); } else { int newi = i + 1; if (newi == _rnaList.getSize()) { newi = _rnaList.getSize() - 2; } FullBackup bck = (FullBackup) _rnaList.getElementAt(newi); _l.setSelectedValue(bck, true); } _rnaList.remove(i); } } } public void onLayoutChanged() { // TODO Auto-generated method stub } public void onUINewStructure(VARNAConfig v, RNA r) { // patch to fix infinite loop // The problem is that onUINewStructure is called when user clicks // check with Yann about whether Jalview should do anything with this event. // e.g. if user has used VARNA's menu to import a structure .. Jalview may // need to be told which structure is displayed. // _rnaList.add(v, r, "", true); } public void onWarningEmitted(String s) { } public void mouseClicked(MouseEvent e) { if (e.getClickCount() == 2) { int index = _sideList.locationToIndex(e.getPoint()); ListModel dlm = _sideList.getModel(); FullBackup item = (FullBackup) dlm.getElementAt(index); ; _sideList.ensureIndexIsVisible(index); /* * TODO Object newName = JOptionPane.showInputDialog( this, * "Specify a new name for this RNA", "Rename RNA", * JOptionPane.QUESTION_MESSAGE, (Icon)null, null, item.toString()); if * (newName!=null) { item.name = newName.toString(); * this._sideList.repaint(); } */ } } public void mouseEntered(MouseEvent arg0) { } public void mouseExited(MouseEvent arg0) { } public void mousePressed(MouseEvent arg0) { } public void mouseReleased(MouseEvent arg0) { } @Override public String[] getPdbFile() { return null; } @Override public void releaseReferences(Object svl) { } @Override public void updateColours(Object source) { } @Override public void componentHidden(ComponentEvent e) { } @Override public void componentMoved(ComponentEvent e) { } @Override public void componentResized(ComponentEvent e) { } @Override public void componentShown(ComponentEvent e) { } @Override public void onStructureRedrawn() { } @Override public void onZoomLevelChanged() { } @Override public void onTranslationChanged() { } @Override public void highlightAtoms(List atoms) { } }