/*
* Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
* Copyright (C) $$Year-Rel$$ The Jalview Authors
*
* This file is part of Jalview.
*
* Jalview is free software: you can redistribute it and/or
* modify it under the terms of the GNU General Public License
* as published by the Free Software Foundation, either version 3
* of the License, or (at your option) any later version.
*
* Jalview is distributed in the hope that it will be useful, but
* WITHOUT ANY WARRANTY; without even the implied warranty
* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
* PURPOSE. See the GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License
* along with Jalview. If not, see .
* The Jalview Authors are detailed in the 'AUTHORS' file.
*/
package jalview.analysis;
import static org.testng.AssertJUnit.assertEquals;
import static org.testng.AssertJUnit.assertFalse;
import static org.testng.AssertJUnit.assertNull;
import static org.testng.AssertJUnit.assertSame;
import static org.testng.AssertJUnit.assertTrue;
import jalview.datamodel.AlignedCodonFrame;
import jalview.datamodel.Alignment;
import jalview.datamodel.AlignmentAnnotation;
import jalview.datamodel.AlignmentI;
import jalview.datamodel.Annotation;
import jalview.datamodel.DBRefEntry;
import jalview.datamodel.Mapping;
import jalview.datamodel.SearchResults;
import jalview.datamodel.SearchResults.Match;
import jalview.datamodel.Sequence;
import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
import jalview.io.AppletFormatAdapter;
import jalview.io.FormatAdapter;
import jalview.util.MapList;
import jalview.util.MappingUtils;
import java.io.IOException;
import java.util.ArrayList;
import java.util.Arrays;
import java.util.HashSet;
import java.util.Iterator;
import java.util.LinkedHashMap;
import java.util.List;
import java.util.Map;
import java.util.Set;
import org.testng.annotations.Test;
public class AlignmentUtilsTests
{
// @formatter:off
private static final String TEST_DATA =
"# STOCKHOLM 1.0\n" +
"#=GS D.melanogaster.1 AC AY119185.1/838-902\n" +
"#=GS D.melanogaster.2 AC AC092237.1/57223-57161\n" +
"#=GS D.melanogaster.3 AC AY060611.1/560-627\n" +
"D.melanogaster.1 G.AGCC.CU...AUGAUCGA\n" +
"#=GR D.melanogaster.1 SS ................((((\n" +
"D.melanogaster.2 C.AUUCAACU.UAUGAGGAU\n" +
"#=GR D.melanogaster.2 SS ................((((\n" +
"D.melanogaster.3 G.UGGCGCU..UAUGACGCA\n" +
"#=GR D.melanogaster.3 SS (.(((...(....(((((((\n" +
"//";
private static final String AA_SEQS_1 =
">Seq1Name\n" +
"K-QY--L\n" +
">Seq2Name\n" +
"-R-FP-W-\n";
private static final String CDNA_SEQS_1 =
">Seq1Name\n" +
"AC-GG--CUC-CAA-CT\n" +
">Seq2Name\n" +
"-CG-TTA--ACG---AAGT\n";
private static final String CDNA_SEQS_2 =
">Seq1Name\n" +
"GCTCGUCGTACT\n" +
">Seq2Name\n" +
"GGGTCAGGCAGT\n";
// @formatter:on
// public static Sequence ts=new
// Sequence("short","ASDASDASDASDASDASDASDASDASDASDASDASDASD");
public static Sequence ts = new Sequence("short",
"ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklm");
@Test(groups = { "Functional" })
public void testExpandContext()
{
AlignmentI al = new Alignment(new Sequence[] {});
for (int i = 4; i < 14; i += 2)
{
SequenceI s1 = ts.deriveSequence().getSubSequence(i, i + 7);
al.addSequence(s1);
}
System.out.println(new AppletFormatAdapter().formatSequences("Clustal",
al, true));
for (int flnk = -1; flnk < 25; flnk++)
{
AlignmentI exp = AlignmentUtils.expandContext(al, flnk);
System.out.println("\nFlank size: " + flnk);
System.out.println(new AppletFormatAdapter().formatSequences(
"Clustal", exp, true));
if (flnk == -1)
{
/*
* Full expansion to complete sequences
*/
for (SequenceI sq : exp.getSequences())
{
String ung = sq.getSequenceAsString().replaceAll("-+", "");
final String errorMsg = "Flanking sequence not the same as original dataset sequence.\n"
+ ung
+ "\n"
+ sq.getDatasetSequence().getSequenceAsString();
assertTrue(errorMsg, ung.equalsIgnoreCase(sq.getDatasetSequence()
.getSequenceAsString()));
}
}
else if (flnk == 24)
{
/*
* Last sequence is fully expanded, others have leading gaps to match
*/
assertTrue(exp.getSequenceAt(4).getSequenceAsString()
.startsWith("abc"));
assertTrue(exp.getSequenceAt(3).getSequenceAsString()
.startsWith("--abc"));
assertTrue(exp.getSequenceAt(2).getSequenceAsString()
.startsWith("----abc"));
assertTrue(exp.getSequenceAt(1).getSequenceAsString()
.startsWith("------abc"));
assertTrue(exp.getSequenceAt(0).getSequenceAsString()
.startsWith("--------abc"));
}
}
}
/**
* Test that annotations are correctly adjusted by expandContext
*/
@Test(groups = { "Functional" })
public void testExpandContext_annotation()
{
AlignmentI al = new Alignment(new Sequence[] {});
SequenceI ds = new Sequence("Seq1", "ABCDEFGHI");
// subsequence DEF:
SequenceI seq1 = ds.deriveSequence().getSubSequence(3, 6);
al.addSequence(seq1);
/*
* Annotate DEF with 4/5/6 respectively
*/
Annotation[] anns = new Annotation[] { new Annotation(4),
new Annotation(5), new Annotation(6) };
AlignmentAnnotation ann = new AlignmentAnnotation("SS",
"secondary structure", anns);
seq1.addAlignmentAnnotation(ann);
/*
* The annotations array should match aligned positions
*/
assertEquals(3, ann.annotations.length);
assertEquals(4, ann.annotations[0].value, 0.001);
assertEquals(5, ann.annotations[1].value, 0.001);
assertEquals(6, ann.annotations[2].value, 0.001);
/*
* Check annotation to sequence position mappings before expanding the
* sequence; these are set up in Sequence.addAlignmentAnnotation ->
* Annotation.setSequenceRef -> createSequenceMappings
*/
assertNull(ann.getAnnotationForPosition(1));
assertNull(ann.getAnnotationForPosition(2));
assertNull(ann.getAnnotationForPosition(3));
assertEquals(4, ann.getAnnotationForPosition(4).value, 0.001);
assertEquals(5, ann.getAnnotationForPosition(5).value, 0.001);
assertEquals(6, ann.getAnnotationForPosition(6).value, 0.001);
assertNull(ann.getAnnotationForPosition(7));
assertNull(ann.getAnnotationForPosition(8));
assertNull(ann.getAnnotationForPosition(9));
/*
* Expand the subsequence to the full sequence abcDEFghi
*/
AlignmentI expanded = AlignmentUtils.expandContext(al, -1);
assertEquals("abcDEFghi", expanded.getSequenceAt(0)
.getSequenceAsString());
/*
* Confirm the alignment and sequence have the same SS annotation,
* referencing the expanded sequence
*/
ann = expanded.getSequenceAt(0).getAnnotation()[0];
assertSame(ann, expanded.getAlignmentAnnotation()[0]);
assertSame(expanded.getSequenceAt(0), ann.sequenceRef);
/*
* The annotations array should have null values except for annotated
* positions
*/
assertNull(ann.annotations[0]);
assertNull(ann.annotations[1]);
assertNull(ann.annotations[2]);
assertEquals(4, ann.annotations[3].value, 0.001);
assertEquals(5, ann.annotations[4].value, 0.001);
assertEquals(6, ann.annotations[5].value, 0.001);
assertNull(ann.annotations[6]);
assertNull(ann.annotations[7]);
assertNull(ann.annotations[8]);
/*
* sequence position mappings should be unchanged
*/
assertNull(ann.getAnnotationForPosition(1));
assertNull(ann.getAnnotationForPosition(2));
assertNull(ann.getAnnotationForPosition(3));
assertEquals(4, ann.getAnnotationForPosition(4).value, 0.001);
assertEquals(5, ann.getAnnotationForPosition(5).value, 0.001);
assertEquals(6, ann.getAnnotationForPosition(6).value, 0.001);
assertNull(ann.getAnnotationForPosition(7));
assertNull(ann.getAnnotationForPosition(8));
assertNull(ann.getAnnotationForPosition(9));
}
/**
* Test method that returns a map of lists of sequences by sequence name.
*
* @throws IOException
*/
@Test(groups = { "Functional" })
public void testGetSequencesByName() throws IOException
{
final String data = ">Seq1Name\nKQYL\n" + ">Seq2Name\nRFPW\n"
+ ">Seq1Name\nABCD\n";
AlignmentI al = loadAlignment(data, "FASTA");
Map> map = AlignmentUtils
.getSequencesByName(al);
assertEquals(2, map.keySet().size());
assertEquals(2, map.get("Seq1Name").size());
assertEquals("KQYL", map.get("Seq1Name").get(0).getSequenceAsString());
assertEquals("ABCD", map.get("Seq1Name").get(1).getSequenceAsString());
assertEquals(1, map.get("Seq2Name").size());
assertEquals("RFPW", map.get("Seq2Name").get(0).getSequenceAsString());
}
/**
* Helper method to load an alignment and ensure dataset sequences are set up.
*
* @param data
* @param format
* TODO
* @return
* @throws IOException
*/
protected AlignmentI loadAlignment(final String data, String format)
throws IOException
{
AlignmentI a = new FormatAdapter().readFile(data,
AppletFormatAdapter.PASTE, format);
a.setDataset(null);
return a;
}
/**
* Test mapping of protein to cDNA, for the case where we have no sequence
* cross-references, so mappings are made first-served 1-1 where sequences
* translate.
*
* @throws IOException
*/
@Test(groups = { "Functional" })
public void testMapProteinAlignmentToCdna_noXrefs() throws IOException
{
List protseqs = new ArrayList();
protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
protein.setDataset(null);
List dnaseqs = new ArrayList();
dnaseqs.add(new Sequence("EMBL|A11111", "TCAGCACGC")); // = SAR
dnaseqs.add(new Sequence("EMBL|A22222", "GAGATACAA")); // = EIQ
dnaseqs.add(new Sequence("EMBL|A33333", "GAAATCCAG")); // = EIQ
dnaseqs.add(new Sequence("EMBL|A44444", "GAAATTCAG")); // = EIQ
AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[4]));
cdna.setDataset(null);
assertTrue(AlignmentUtils.mapProteinAlignmentToCdna(protein, cdna));
// 3 mappings made, each from 1 to 1 sequence
assertEquals(3, protein.getCodonFrames().size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(0)).size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(1)).size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(2)).size());
// V12345 mapped to A22222
AlignedCodonFrame acf = protein.getCodonFrame(protein.getSequenceAt(0))
.get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(1).getDatasetSequence(),
acf.getdnaSeqs()[0]);
Mapping[] protMappings = acf.getProtMappings();
assertEquals(1, protMappings.length);
MapList mapList = protMappings[0].getMap();
assertEquals(3, mapList.getFromRatio());
assertEquals(1, mapList.getToRatio());
assertTrue(Arrays.equals(new int[] { 1, 9 }, mapList.getFromRanges()
.get(0)));
assertEquals(1, mapList.getFromRanges().size());
assertTrue(Arrays.equals(new int[] { 1, 3 },
mapList.getToRanges().get(0)));
assertEquals(1, mapList.getToRanges().size());
// V12346 mapped to A33333
acf = protein.getCodonFrame(protein.getSequenceAt(1)).get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(2).getDatasetSequence(),
acf.getdnaSeqs()[0]);
// V12347 mapped to A11111
acf = protein.getCodonFrame(protein.getSequenceAt(2)).get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(0).getDatasetSequence(),
acf.getdnaSeqs()[0]);
// no mapping involving the 'extra' A44444
assertTrue(protein.getCodonFrame(cdna.getSequenceAt(3)).isEmpty());
}
/**
* Test for the alignSequenceAs method that takes two sequences and a mapping.
*/
@Test(groups = { "Functional" })
public void testAlignSequenceAs_withMapping_noIntrons()
{
MapList map = new MapList(new int[] { 1, 6 }, new int[] { 1, 2 }, 3, 1);
/*
* No existing gaps in dna:
*/
checkAlignSequenceAs("GGGAAA", "-A-L-", false, false, map,
"---GGG---AAA");
/*
* Now introduce gaps in dna but ignore them when realigning.
*/
checkAlignSequenceAs("-G-G-G-A-A-A-", "-A-L-", false, false, map,
"---GGG---AAA");
/*
* Now include gaps in dna when realigning. First retaining 'mapped' gaps
* only, i.e. those within the exon region.
*/
checkAlignSequenceAs("-G-G--G-A--A-A-", "-A-L-", true, false, map,
"---G-G--G---A--A-A");
/*
* Include all gaps in dna when realigning (within and without the exon
* region). The leading gap, and the gaps between codons, are subsumed by
* the protein alignment gap.
*/
checkAlignSequenceAs("-G-GG--AA-A---", "-A-L-", true, true, map,
"---G-GG---AA-A---");
/*
* Include only unmapped gaps in dna when realigning (outside the exon
* region). The leading gap, and the gaps between codons, are subsumed by
* the protein alignment gap.
*/
checkAlignSequenceAs("-G-GG--AA-A-", "-A-L-", false, true, map,
"---GGG---AAA---");
}
/**
* Test for the alignSequenceAs method that takes two sequences and a mapping.
*/
@Test(groups = { "Functional" })
public void testAlignSequenceAs_withMapping_withIntrons()
{
/*
* Exons at codon 2 (AAA) and 4 (TTT)
*/
MapList map = new MapList(new int[] { 4, 6, 10, 12 },
new int[] { 1, 2 }, 3, 1);
/*
* Simple case: no gaps in dna
*/
checkAlignSequenceAs("GGGAAACCCTTTGGG", "--A-L-", false, false, map,
"GGG---AAACCCTTTGGG");
/*
* Add gaps to dna - but ignore when realigning.
*/
checkAlignSequenceAs("-G-G-G--A--A---AC-CC-T-TT-GG-G-", "--A-L-",
false, false, map, "GGG---AAACCCTTTGGG");
/*
* Add gaps to dna - include within exons only when realigning.
*/
checkAlignSequenceAs("-G-G-G--A--A---A-C-CC-T-TT-GG-G-", "--A-L-",
true, false, map, "GGG---A--A---ACCCT-TTGGG");
/*
* Include gaps outside exons only when realigning.
*/
checkAlignSequenceAs("-G-G-G--A--A---A-C-CC-T-TT-GG-G-", "--A-L-",
false, true, map, "-G-G-GAAAC-CCTTT-GG-G-");
/*
* Include gaps following first intron if we are 'preserving mapped gaps'
*/
checkAlignSequenceAs("-G-G-G--A--A---A-C-CC-T-TT-GG-G-", "--A-L-",
true, true, map, "-G-G-G--A--A---A-C-CC-T-TT-GG-G-");
/*
* Include all gaps in dna when realigning.
*/
checkAlignSequenceAs("-G-G-G--A--A---A-C-CC-T-TT-GG-G-", "--A-L-",
true, true, map, "-G-G-G--A--A---A-C-CC-T-TT-GG-G-");
}
/**
* Test for the case where not all of the protein sequence is mapped to cDNA.
*/
@Test(groups = { "Functional" })
public void testAlignSequenceAs_withMapping_withUnmappedProtein()
{
/*
* Exons at codon 2 (AAA) and 4 (TTT) mapped to A and P
*/
final MapList map = new MapList(new int[] { 4, 6, 10, 12 }, new int[] {
1, 1, 3, 3 }, 3, 1);
/*
* -L- 'aligns' ccc------
*/
checkAlignSequenceAs("gggAAAcccTTTggg", "-A-L-P-", false, false, map,
"gggAAAccc------TTTggg");
}
/**
* Helper method that performs and verifies the method under test.
*
* @param alignee
* the sequence to be realigned
* @param alignModel
* the sequence whose alignment is to be copied
* @param preserveMappedGaps
* @param preserveUnmappedGaps
* @param map
* @param expected
*/
protected void checkAlignSequenceAs(final String alignee,
final String alignModel, final boolean preserveMappedGaps,
final boolean preserveUnmappedGaps, MapList map,
final String expected)
{
SequenceI alignMe = new Sequence("Seq1", alignee);
alignMe.createDatasetSequence();
SequenceI alignFrom = new Sequence("Seq2", alignModel);
alignFrom.createDatasetSequence();
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(alignMe.getDatasetSequence(), alignFrom.getDatasetSequence(), map);
AlignmentUtils.alignSequenceAs(alignMe, alignFrom, acf, "---", '-',
preserveMappedGaps, preserveUnmappedGaps);
assertEquals(expected, alignMe.getSequenceAsString());
}
/**
* Test for the alignSequenceAs method where we preserve gaps in introns only.
*/
@Test(groups = { "Functional" })
public void testAlignSequenceAs_keepIntronGapsOnly()
{
/*
* Intron GGGAAA followed by exon CCCTTT
*/
MapList map = new MapList(new int[] { 7, 12 }, new int[] { 1, 2 }, 3, 1);
checkAlignSequenceAs("GG-G-AA-A-C-CC-T-TT", "AL", false, true, map,
"GG-G-AA-ACCCTTT");
}
/**
* Test for the method that generates an aligned translated sequence from one
* mapping.
*/
@Test(groups = { "Functional" })
public void testGetAlignedTranslation_dnaLikeProtein()
{
// dna alignment will be replaced
SequenceI dna = new Sequence("Seq1", "T-G-CC-A--T-TAC-CAG-");
dna.createDatasetSequence();
// protein alignment will be 'applied' to dna
SequenceI protein = new Sequence("Seq1", "-CH-Y--Q-");
protein.createDatasetSequence();
MapList map = new MapList(new int[] { 1, 12 }, new int[] { 1, 4 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(dna.getDatasetSequence(), protein.getDatasetSequence(), map);
final SequenceI aligned = AlignmentUtils.getAlignedTranslation(protein,
'-', acf);
assertEquals("---TGCCAT---TAC------CAG---",
aligned.getSequenceAsString());
assertSame(aligned.getDatasetSequence(), dna.getDatasetSequence());
}
/**
* Test the method that realigns protein to match mapped codon alignment.
*/
@Test(groups = { "Functional" })
public void testAlignProteinAsDna()
{
// seq1 codons are [1,2,3] [4,5,6] [7,8,9] [10,11,12]
SequenceI dna1 = new Sequence("Seq1", "TGCCATTACCAG-");
// seq2 codons are [1,3,4] [5,6,7] [8,9,10] [11,12,13]
SequenceI dna2 = new Sequence("Seq2", "T-GCCATTACCAG");
// seq3 codons are [1,2,3] [4,5,7] [8,9,10] [11,12,13]
SequenceI dna3 = new Sequence("Seq3", "TGCCA-TTACCAG");
AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 });
dna.setDataset(null);
// protein alignment will be realigned like dna
SequenceI prot1 = new Sequence("Seq1", "CHYQ");
SequenceI prot2 = new Sequence("Seq2", "CHYQ");
SequenceI prot3 = new Sequence("Seq3", "CHYQ");
SequenceI prot4 = new Sequence("Seq4", "R-QSV"); // unmapped, unchanged
AlignmentI protein = new Alignment(new SequenceI[] { prot1, prot2,
prot3, prot4 });
protein.setDataset(null);
MapList map = new MapList(new int[] { 1, 12 }, new int[] { 1, 4 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), prot1.getDatasetSequence(), map);
acf.addMap(dna2.getDatasetSequence(), prot2.getDatasetSequence(), map);
acf.addMap(dna3.getDatasetSequence(), prot3.getDatasetSequence(), map);
ArrayList acfs = new ArrayList();
acfs.add(acf);
protein.setCodonFrames(acfs);
/*
* Translated codon order is [1,2,3] [1,3,4] [4,5,6] [4,5,7] [5,6,7] [7,8,9]
* [8,9,10] [10,11,12] [11,12,13]
*/
AlignmentUtils.alignProteinAsDna(protein, dna);
assertEquals("C-H--Y-Q-", prot1.getSequenceAsString());
assertEquals("-C--H-Y-Q", prot2.getSequenceAsString());
assertEquals("C--H--Y-Q", prot3.getSequenceAsString());
assertEquals("R-QSV", prot4.getSequenceAsString());
}
/**
* Test the method that tests whether a CDNA sequence translates to a protein
* sequence
*/
@Test(groups = { "Functional" })
public void testTranslatesAs()
{
// null arguments check
assertFalse(AlignmentUtils.translatesAs(null, 0, null));
assertFalse(AlignmentUtils.translatesAs(new char[] { 't' }, 0, null));
assertFalse(AlignmentUtils.translatesAs(null, 0, new char[] { 'a' }));
// straight translation
assertTrue(AlignmentUtils.translatesAs("tttcccaaaggg".toCharArray(), 0,
"FPKG".toCharArray()));
// with extra start codon (not in protein)
assertTrue(AlignmentUtils.translatesAs("atgtttcccaaaggg".toCharArray(),
3, "FPKG".toCharArray()));
// with stop codon1 (not in protein)
assertTrue(AlignmentUtils.translatesAs("tttcccaaagggtaa".toCharArray(),
0, "FPKG".toCharArray()));
// with stop codon1 (in protein as *)
assertTrue(AlignmentUtils.translatesAs("tttcccaaagggtaa".toCharArray(),
0, "FPKG*".toCharArray()));
// with stop codon2 (not in protein)
assertTrue(AlignmentUtils.translatesAs("tttcccaaagggtag".toCharArray(),
0, "FPKG".toCharArray()));
// with stop codon3 (not in protein)
assertTrue(AlignmentUtils.translatesAs("tttcccaaagggtga".toCharArray(),
0, "FPKG".toCharArray()));
// with start and stop codon1
assertTrue(AlignmentUtils.translatesAs(
"atgtttcccaaagggtaa".toCharArray(), 3, "FPKG".toCharArray()));
// with start and stop codon1 (in protein as *)
assertTrue(AlignmentUtils.translatesAs(
"atgtttcccaaagggtaa".toCharArray(), 3, "FPKG*".toCharArray()));
// with start and stop codon2
assertTrue(AlignmentUtils.translatesAs(
"atgtttcccaaagggtag".toCharArray(), 3, "FPKG".toCharArray()));
// with start and stop codon3
assertTrue(AlignmentUtils.translatesAs(
"atgtttcccaaagggtga".toCharArray(), 3, "FPKG".toCharArray()));
// with embedded stop codons
assertTrue(AlignmentUtils.translatesAs(
"atgtttTAGcccaaaTAAgggtga".toCharArray(), 3,
"F*PK*G".toCharArray()));
// wrong protein
assertFalse(AlignmentUtils.translatesAs("tttcccaaaggg".toCharArray(),
0, "FPMG".toCharArray()));
// truncated dna
assertFalse(AlignmentUtils.translatesAs("tttcccaaagg".toCharArray(), 0,
"FPKG".toCharArray()));
// truncated protein
assertFalse(AlignmentUtils.translatesAs("tttcccaaaggg".toCharArray(),
0, "FPK".toCharArray()));
// overlong dna (doesn't end in stop codon)
assertFalse(AlignmentUtils.translatesAs(
"tttcccaaagggttt".toCharArray(), 0, "FPKG".toCharArray()));
// dna + stop codon + more
assertFalse(AlignmentUtils.translatesAs(
"tttcccaaagggttaga".toCharArray(), 0, "FPKG".toCharArray()));
// overlong protein
assertFalse(AlignmentUtils.translatesAs("tttcccaaaggg".toCharArray(),
0, "FPKGQ".toCharArray()));
}
/**
* Test mapping of protein to cDNA, for cases where the cDNA has start and/or
* stop codons in addition to the protein coding sequence.
*
* @throws IOException
*/
@Test(groups = { "Functional" })
public void testMapProteinAlignmentToCdna_withStartAndStopCodons()
throws IOException
{
List protseqs = new ArrayList();
protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
protein.setDataset(null);
List dnaseqs = new ArrayList();
// start + SAR:
dnaseqs.add(new Sequence("EMBL|A11111", "ATGTCAGCACGC"));
// = EIQ + stop
dnaseqs.add(new Sequence("EMBL|A22222", "GAGATACAATAA"));
// = start +EIQ + stop
dnaseqs.add(new Sequence("EMBL|A33333", "ATGGAAATCCAGTAG"));
dnaseqs.add(new Sequence("EMBL|A44444", "GAAATTCAG"));
AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[4]));
cdna.setDataset(null);
assertTrue(AlignmentUtils.mapProteinAlignmentToCdna(protein, cdna));
// 3 mappings made, each from 1 to 1 sequence
assertEquals(3, protein.getCodonFrames().size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(0)).size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(1)).size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(2)).size());
// V12345 mapped from A22222
AlignedCodonFrame acf = protein.getCodonFrame(protein.getSequenceAt(0))
.get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(1).getDatasetSequence(),
acf.getdnaSeqs()[0]);
Mapping[] protMappings = acf.getProtMappings();
assertEquals(1, protMappings.length);
MapList mapList = protMappings[0].getMap();
assertEquals(3, mapList.getFromRatio());
assertEquals(1, mapList.getToRatio());
assertTrue(Arrays.equals(new int[] { 1, 9 }, mapList.getFromRanges()
.get(0)));
assertEquals(1, mapList.getFromRanges().size());
assertTrue(Arrays.equals(new int[] { 1, 3 },
mapList.getToRanges().get(0)));
assertEquals(1, mapList.getToRanges().size());
// V12346 mapped from A33333 starting position 4
acf = protein.getCodonFrame(protein.getSequenceAt(1)).get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(2).getDatasetSequence(),
acf.getdnaSeqs()[0]);
protMappings = acf.getProtMappings();
assertEquals(1, protMappings.length);
mapList = protMappings[0].getMap();
assertEquals(3, mapList.getFromRatio());
assertEquals(1, mapList.getToRatio());
assertTrue(Arrays.equals(new int[] { 4, 12 }, mapList.getFromRanges()
.get(0)));
assertEquals(1, mapList.getFromRanges().size());
assertTrue(Arrays.equals(new int[] { 1, 3 },
mapList.getToRanges().get(0)));
assertEquals(1, mapList.getToRanges().size());
// V12347 mapped to A11111 starting position 4
acf = protein.getCodonFrame(protein.getSequenceAt(2)).get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(0).getDatasetSequence(),
acf.getdnaSeqs()[0]);
protMappings = acf.getProtMappings();
assertEquals(1, protMappings.length);
mapList = protMappings[0].getMap();
assertEquals(3, mapList.getFromRatio());
assertEquals(1, mapList.getToRatio());
assertTrue(Arrays.equals(new int[] { 4, 12 }, mapList.getFromRanges()
.get(0)));
assertEquals(1, mapList.getFromRanges().size());
assertTrue(Arrays.equals(new int[] { 1, 3 },
mapList.getToRanges().get(0)));
assertEquals(1, mapList.getToRanges().size());
// no mapping involving the 'extra' A44444
assertTrue(protein.getCodonFrame(cdna.getSequenceAt(3)).isEmpty());
}
/**
* Test mapping of protein to cDNA, for the case where we have some sequence
* cross-references. Verify that 1-to-many mappings are made where
* cross-references exist and sequences are mappable.
*
* @throws IOException
*/
@Test(groups = { "Functional" })
public void testMapProteinAlignmentToCdna_withXrefs() throws IOException
{
List protseqs = new ArrayList();
protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12347", "SAR"));
AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3]));
protein.setDataset(null);
List dnaseqs = new ArrayList();
dnaseqs.add(new Sequence("EMBL|A11111", "TCAGCACGC")); // = SAR
dnaseqs.add(new Sequence("EMBL|A22222", "ATGGAGATACAA")); // = start + EIQ
dnaseqs.add(new Sequence("EMBL|A33333", "GAAATCCAG")); // = EIQ
dnaseqs.add(new Sequence("EMBL|A44444", "GAAATTCAG")); // = EIQ
dnaseqs.add(new Sequence("EMBL|A55555", "GAGATTCAG")); // = EIQ
AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[5]));
cdna.setDataset(null);
// Xref A22222 to V12345 (should get mapped)
dnaseqs.get(1).addDBRef(new DBRefEntry("UNIPROT", "1", "V12345"));
// Xref V12345 to A44444 (should get mapped)
protseqs.get(0).addDBRef(new DBRefEntry("EMBL", "1", "A44444"));
// Xref A33333 to V12347 (sequence mismatch - should not get mapped)
dnaseqs.get(2).addDBRef(new DBRefEntry("UNIPROT", "1", "V12347"));
// as V12345 is mapped to A22222 and A44444, this leaves V12346 unmapped.
// it should get paired up with the unmapped A33333
// A11111 should be mapped to V12347
// A55555 is spare and has no xref so is not mapped
assertTrue(AlignmentUtils.mapProteinAlignmentToCdna(protein, cdna));
// 4 protein mappings made for 3 proteins, 2 to V12345, 1 each to V12346/7
assertEquals(3, protein.getCodonFrames().size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(0)).size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(1)).size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(2)).size());
// one mapping for each of the first 4 cDNA sequences
assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(0)).size());
assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(1)).size());
assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(2)).size());
assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(3)).size());
// V12345 mapped to A22222 and A44444
AlignedCodonFrame acf = protein.getCodonFrame(protein.getSequenceAt(0))
.get(0);
assertEquals(2, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(1).getDatasetSequence(),
acf.getdnaSeqs()[0]);
assertEquals(cdna.getSequenceAt(3).getDatasetSequence(),
acf.getdnaSeqs()[1]);
// V12346 mapped to A33333
acf = protein.getCodonFrame(protein.getSequenceAt(1)).get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(2).getDatasetSequence(),
acf.getdnaSeqs()[0]);
// V12347 mapped to A11111
acf = protein.getCodonFrame(protein.getSequenceAt(2)).get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(0).getDatasetSequence(),
acf.getdnaSeqs()[0]);
// no mapping involving the 'extra' A55555
assertTrue(protein.getCodonFrame(cdna.getSequenceAt(4)).isEmpty());
}
/**
* Test mapping of protein to cDNA, for the case where we have some sequence
* cross-references. Verify that once we have made an xref mapping we don't
* also map un-xrefd sequeces.
*
* @throws IOException
*/
@Test(groups = { "Functional" })
public void testMapProteinAlignmentToCdna_prioritiseXrefs()
throws IOException
{
List protseqs = new ArrayList();
protseqs.add(new Sequence("UNIPROT|V12345", "EIQ"));
protseqs.add(new Sequence("UNIPROT|V12346", "EIQ"));
AlignmentI protein = new Alignment(
protseqs.toArray(new SequenceI[protseqs.size()]));
protein.setDataset(null);
List dnaseqs = new ArrayList();
dnaseqs.add(new Sequence("EMBL|A11111", "GAAATCCAG")); // = EIQ
dnaseqs.add(new Sequence("EMBL|A22222", "GAAATTCAG")); // = EIQ
AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[dnaseqs
.size()]));
cdna.setDataset(null);
// Xref A22222 to V12345 (should get mapped)
// A11111 should then be mapped to the unmapped V12346
dnaseqs.get(1).addDBRef(new DBRefEntry("UNIPROT", "1", "V12345"));
assertTrue(AlignmentUtils.mapProteinAlignmentToCdna(protein, cdna));
// 2 protein mappings made
assertEquals(2, protein.getCodonFrames().size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(0)).size());
assertEquals(1, protein.getCodonFrame(protein.getSequenceAt(1)).size());
// one mapping for each of the cDNA sequences
assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(0)).size());
assertEquals(1, protein.getCodonFrame(cdna.getSequenceAt(1)).size());
// V12345 mapped to A22222
AlignedCodonFrame acf = protein.getCodonFrame(protein.getSequenceAt(0))
.get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(1).getDatasetSequence(),
acf.getdnaSeqs()[0]);
// V12346 mapped to A11111
acf = protein.getCodonFrame(protein.getSequenceAt(1)).get(0);
assertEquals(1, acf.getdnaSeqs().length);
assertEquals(cdna.getSequenceAt(0).getDatasetSequence(),
acf.getdnaSeqs()[0]);
}
/**
* Test the method that shows or hides sequence annotations by type(s) and
* selection group.
*/
@Test(groups = { "Functional" })
public void testShowOrHideSequenceAnnotations()
{
SequenceI seq1 = new Sequence("Seq1", "AAA");
SequenceI seq2 = new Sequence("Seq2", "BBB");
SequenceI seq3 = new Sequence("Seq3", "CCC");
Annotation[] anns = new Annotation[] { new Annotation(2f) };
AlignmentAnnotation ann1 = new AlignmentAnnotation("Structure", "ann1",
anns);
ann1.setSequenceRef(seq1);
AlignmentAnnotation ann2 = new AlignmentAnnotation("Structure", "ann2",
anns);
ann2.setSequenceRef(seq2);
AlignmentAnnotation ann3 = new AlignmentAnnotation("Structure", "ann3",
anns);
AlignmentAnnotation ann4 = new AlignmentAnnotation("Temp", "ann4", anns);
ann4.setSequenceRef(seq1);
AlignmentAnnotation ann5 = new AlignmentAnnotation("Temp", "ann5", anns);
ann5.setSequenceRef(seq2);
AlignmentAnnotation ann6 = new AlignmentAnnotation("Temp", "ann6", anns);
AlignmentI al = new Alignment(new SequenceI[] { seq1, seq2, seq3 });
al.addAnnotation(ann1); // Structure for Seq1
al.addAnnotation(ann2); // Structure for Seq2
al.addAnnotation(ann3); // Structure for no sequence
al.addAnnotation(ann4); // Temp for seq1
al.addAnnotation(ann5); // Temp for seq2
al.addAnnotation(ann6); // Temp for no sequence
List types = new ArrayList();
List scope = new ArrayList();
/*
* Set all sequence related Structure to hidden (ann1, ann2)
*/
types.add("Structure");
AlignmentUtils.showOrHideSequenceAnnotations(al, types, null, false,
false);
assertFalse(ann1.visible);
assertFalse(ann2.visible);
assertTrue(ann3.visible); // not sequence-related, not affected
assertTrue(ann4.visible); // not Structure, not affected
assertTrue(ann5.visible); // "
assertTrue(ann6.visible); // not sequence-related, not affected
/*
* Set Temp in {seq1, seq3} to hidden
*/
types.clear();
types.add("Temp");
scope.add(seq1);
scope.add(seq3);
AlignmentUtils.showOrHideSequenceAnnotations(al, types, scope, false,
false);
assertFalse(ann1.visible); // unchanged
assertFalse(ann2.visible); // unchanged
assertTrue(ann3.visible); // not sequence-related, not affected
assertFalse(ann4.visible); // Temp for seq1 hidden
assertTrue(ann5.visible); // not in scope, not affected
assertTrue(ann6.visible); // not sequence-related, not affected
/*
* Set Temp in all sequences to hidden
*/
types.clear();
types.add("Temp");
scope.add(seq1);
scope.add(seq3);
AlignmentUtils.showOrHideSequenceAnnotations(al, types, null, false,
false);
assertFalse(ann1.visible); // unchanged
assertFalse(ann2.visible); // unchanged
assertTrue(ann3.visible); // not sequence-related, not affected
assertFalse(ann4.visible); // Temp for seq1 hidden
assertFalse(ann5.visible); // Temp for seq2 hidden
assertTrue(ann6.visible); // not sequence-related, not affected
/*
* Set all types in {seq1, seq3} to visible
*/
types.clear();
scope.clear();
scope.add(seq1);
scope.add(seq3);
AlignmentUtils.showOrHideSequenceAnnotations(al, types, scope, true,
true);
assertTrue(ann1.visible); // Structure for seq1 set visible
assertFalse(ann2.visible); // not in scope, unchanged
assertTrue(ann3.visible); // not sequence-related, not affected
assertTrue(ann4.visible); // Temp for seq1 set visible
assertFalse(ann5.visible); // not in scope, unchanged
assertTrue(ann6.visible); // not sequence-related, not affected
/*
* Set all types in all scope to hidden
*/
AlignmentUtils.showOrHideSequenceAnnotations(al, types, null, true,
false);
assertFalse(ann1.visible);
assertFalse(ann2.visible);
assertTrue(ann3.visible); // not sequence-related, not affected
assertFalse(ann4.visible);
assertFalse(ann5.visible);
assertTrue(ann6.visible); // not sequence-related, not affected
}
/**
* Tests for the method that checks if one sequence cross-references another
*/
@Test(groups = { "Functional" })
public void testHasCrossRef()
{
assertFalse(AlignmentUtils.hasCrossRef(null, null));
SequenceI seq1 = new Sequence("EMBL|A12345", "ABCDEF");
assertFalse(AlignmentUtils.hasCrossRef(seq1, null));
assertFalse(AlignmentUtils.hasCrossRef(null, seq1));
SequenceI seq2 = new Sequence("UNIPROT|V20192", "ABCDEF");
assertFalse(AlignmentUtils.hasCrossRef(seq1, seq2));
// different ref
seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "v20193"));
assertFalse(AlignmentUtils.hasCrossRef(seq1, seq2));
// case-insensitive; version number is ignored
seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "v20192"));
assertTrue(AlignmentUtils.hasCrossRef(seq1, seq2));
// right case!
seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "V20192"));
assertTrue(AlignmentUtils.hasCrossRef(seq1, seq2));
// test is one-way only
assertFalse(AlignmentUtils.hasCrossRef(seq2, seq1));
}
/**
* Tests for the method that checks if either sequence cross-references the
* other
*/
@Test(groups = { "Functional" })
public void testHaveCrossRef()
{
assertFalse(AlignmentUtils.hasCrossRef(null, null));
SequenceI seq1 = new Sequence("EMBL|A12345", "ABCDEF");
assertFalse(AlignmentUtils.haveCrossRef(seq1, null));
assertFalse(AlignmentUtils.haveCrossRef(null, seq1));
SequenceI seq2 = new Sequence("UNIPROT|V20192", "ABCDEF");
assertFalse(AlignmentUtils.haveCrossRef(seq1, seq2));
seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "V20192"));
assertTrue(AlignmentUtils.haveCrossRef(seq1, seq2));
// next is true for haveCrossRef, false for hasCrossRef
assertTrue(AlignmentUtils.haveCrossRef(seq2, seq1));
// now the other way round
seq1.setDBRefs(null);
seq2.addDBRef(new DBRefEntry("EMBL", "1", "A12345"));
assertTrue(AlignmentUtils.haveCrossRef(seq1, seq2));
assertTrue(AlignmentUtils.haveCrossRef(seq2, seq1));
// now both ways
seq1.addDBRef(new DBRefEntry("UNIPROT", "1", "V20192"));
assertTrue(AlignmentUtils.haveCrossRef(seq1, seq2));
assertTrue(AlignmentUtils.haveCrossRef(seq2, seq1));
}
/**
* Test the method that extracts the cds-only part of a dna alignment.
*/
@Test(groups = { "Functional" })
public void testMakeCdsAlignment()
{
SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa");
SequenceI dna2 = new Sequence("dna2", "GGGcccTTTaaaCCC");
SequenceI pep1 = new Sequence("pep1", "GF");
SequenceI pep2 = new Sequence("pep2", "GFP");
dna1.createDatasetSequence();
dna2.createDatasetSequence();
pep1.createDatasetSequence();
pep2.createDatasetSequence();
dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 6, 0f,
null));
dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 10, 12, 0f,
null));
dna2.addSequenceFeature(new SequenceFeature("CDS", "cds3", 1, 3, 0f,
null));
dna2.addSequenceFeature(new SequenceFeature("CDS", "cds4", 7, 9, 0f,
null));
dna2.addSequenceFeature(new SequenceFeature("CDS", "cds5", 13, 15, 0f,
null));
AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2 });
dna.setDataset(null);
List mappings = new ArrayList();
MapList map = new MapList(new int[] { 4, 6, 10, 12 },
new int[] { 1, 2 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
mappings.add(acf);
map = new MapList(new int[] { 1, 3, 7, 9, 13, 15 }, new int[] { 1, 3 },
3, 1);
acf = new AlignedCodonFrame();
acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), map);
mappings.add(acf);
AlignmentI cds = AlignmentUtils.makeCdsAlignment(new SequenceI[] {
dna1, dna2 }, mappings, dna);
assertEquals(2, cds.getSequences().size());
assertEquals("---GGG---TTT---", cds.getSequenceAt(0)
.getSequenceAsString());
assertEquals("GGG---TTT---CCC", cds.getSequenceAt(1)
.getSequenceAsString());
/*
* verify shared, extended alignment dataset
*/
assertSame(dna.getDataset(), cds.getDataset());
assertTrue(dna.getDataset().getSequences()
.contains(cds.getSequenceAt(0).getDatasetSequence()));
assertTrue(dna.getDataset().getSequences()
.contains(cds.getSequenceAt(1).getDatasetSequence()));
/*
* Verify updated mappings
*/
assertEquals(2, mappings.size());
/*
* Mapping from pep1 to GGGTTT in first new exon sequence
*/
List pep1Mapping = MappingUtils
.findMappingsForSequence(pep1, mappings);
assertEquals(1, pep1Mapping.size());
// map G to GGG
SearchResults sr = MappingUtils.buildSearchResults(pep1, 1, mappings);
assertEquals(1, sr.getResults().size());
Match m = sr.getResults().get(0);
assertSame(cds.getSequenceAt(0).getDatasetSequence(),
m.getSequence());
assertEquals(1, m.getStart());
assertEquals(3, m.getEnd());
// map F to TTT
sr = MappingUtils.buildSearchResults(pep1, 2, mappings);
m = sr.getResults().get(0);
assertSame(cds.getSequenceAt(0).getDatasetSequence(),
m.getSequence());
assertEquals(4, m.getStart());
assertEquals(6, m.getEnd());
/*
* Mapping from pep2 to GGGTTTCCC in second new exon sequence
*/
List pep2Mapping = MappingUtils
.findMappingsForSequence(pep2, mappings);
assertEquals(1, pep2Mapping.size());
// map G to GGG
sr = MappingUtils.buildSearchResults(pep2, 1, mappings);
assertEquals(1, sr.getResults().size());
m = sr.getResults().get(0);
assertSame(cds.getSequenceAt(1).getDatasetSequence(),
m.getSequence());
assertEquals(1, m.getStart());
assertEquals(3, m.getEnd());
// map F to TTT
sr = MappingUtils.buildSearchResults(pep2, 2, mappings);
m = sr.getResults().get(0);
assertSame(cds.getSequenceAt(1).getDatasetSequence(),
m.getSequence());
assertEquals(4, m.getStart());
assertEquals(6, m.getEnd());
// map P to CCC
sr = MappingUtils.buildSearchResults(pep2, 3, mappings);
m = sr.getResults().get(0);
assertSame(cds.getSequenceAt(1).getDatasetSequence(),
m.getSequence());
assertEquals(7, m.getStart());
assertEquals(9, m.getEnd());
}
/**
* Test the method that makes a cds-only sequence from a DNA sequence and its
* product mapping. Test includes the expected case that the DNA sequence
* already has a protein product (Uniprot translation) which in turn has an
* x-ref to the EMBLCDS record.
*/
@Test(groups = { "Functional" })
public void testMakeCdsSequences()
{
SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa");
SequenceI pep1 = new Sequence("pep1", "GF");
dna1.createDatasetSequence();
pep1.createDatasetSequence();
pep1.getDatasetSequence().addDBRef(
new DBRefEntry("EMBLCDS", "2", "A12345"));
/*
* Make the mapping from dna to protein. The protein sequence has a DBRef to
* EMBLCDS|A12345.
*/
Set mappings = new HashSet();
MapList map = new MapList(new int[] { 4, 6, 10, 12 },
new int[] { 1, 2 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
mappings.add(acf);
AlignedCodonFrame newMapping = new AlignedCodonFrame();
List ungappedColumns = new ArrayList();
ungappedColumns.add(new int[] { 4, 6 });
ungappedColumns.add(new int[] { 10, 12 });
List cdsSeqs = AlignmentUtils.makeCdsSequences(dna1, acf,
ungappedColumns,
newMapping, '-');
assertEquals(1, cdsSeqs.size());
SequenceI cdsSeq = cdsSeqs.get(0);
assertEquals("GGGTTT", cdsSeq.getSequenceAsString());
assertEquals("dna1|A12345", cdsSeq.getName());
assertEquals(1, cdsSeq.getDBRefs().length);
DBRefEntry cdsRef = cdsSeq.getDBRefs()[0];
assertEquals("EMBLCDS", cdsRef.getSource());
assertEquals("2", cdsRef.getVersion());
assertEquals("A12345", cdsRef.getAccessionId());
}
/**
* Test the method that makes a cds-only alignment from a DNA sequence and its
* product mappings, for the case where there are multiple exon mappings to
* different protein products.
*/
@Test(groups = { "Functional" })
public void testMakeCdsAlignment_multipleProteins()
{
SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa");
SequenceI pep1 = new Sequence("pep1", "GF"); // GGGTTT
SequenceI pep2 = new Sequence("pep2", "KP"); // aaaccc
SequenceI pep3 = new Sequence("pep3", "KF"); // aaaTTT
dna1.createDatasetSequence();
pep1.createDatasetSequence();
pep2.createDatasetSequence();
pep3.createDatasetSequence();
dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 6, 0f,
null));
dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 10, 12, 0f,
null));
dna1.addSequenceFeature(new SequenceFeature("CDS", "cds3", 1, 3, 0f,
null));
dna1.addSequenceFeature(new SequenceFeature("CDS", "cds4", 7, 9, 0f,
null));
dna1.addSequenceFeature(new SequenceFeature("CDS", "cds5", 1, 3, 0f,
null));
dna1.addSequenceFeature(new SequenceFeature("CDS", "cds6", 10, 12, 0f,
null));
pep1.getDatasetSequence().addDBRef(
new DBRefEntry("EMBLCDS", "2", "A12345"));
pep2.getDatasetSequence().addDBRef(
new DBRefEntry("EMBLCDS", "3", "A12346"));
pep3.getDatasetSequence().addDBRef(
new DBRefEntry("EMBLCDS", "4", "A12347"));
/*
* Make the mappings from dna to protein
*/
List mappings = new ArrayList();
// map ...GGG...TTT to GF
MapList map = new MapList(new int[] { 4, 6, 10, 12 },
new int[] { 1, 2 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
mappings.add(acf);
// map aaa...ccc to KP
map = new MapList(new int[] { 1, 3, 7, 9 }, new int[] { 1, 2 }, 3, 1);
acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), pep2.getDatasetSequence(), map);
mappings.add(acf);
// map aaa......TTT to KF
map = new MapList(new int[] { 1, 3, 10, 12 }, new int[] { 1, 2 }, 3, 1);
acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), pep3.getDatasetSequence(), map);
mappings.add(acf);
/*
* Create the Exon alignment; also replaces the dna-to-protein mappings with
* exon-to-protein and exon-to-dna mappings
*/
AlignmentI dna = new Alignment(new SequenceI[] { dna1 });
dna.setDataset(null);
AlignmentI exal = AlignmentUtils.makeCdsAlignment(
new SequenceI[] { dna1 }, mappings, dna);
/*
* Verify we have 3 cds sequences, mapped to pep1/2/3 respectively
*/
List cds = exal.getSequences();
assertEquals(3, cds.size());
/*
* verify shared, extended alignment dataset
*/
assertSame(exal.getDataset(), dna.getDataset());
assertTrue(dna.getDataset().getSequences()
.contains(cds.get(0).getDatasetSequence()));
assertTrue(dna.getDataset().getSequences()
.contains(cds.get(1).getDatasetSequence()));
assertTrue(dna.getDataset().getSequences()
.contains(cds.get(2).getDatasetSequence()));
/*
* verify aligned cds sequences and their xrefs
*/
SequenceI cdsSeq = cds.get(0);
assertEquals("---GGG---TTT", cdsSeq.getSequenceAsString());
assertEquals("dna1|A12345", cdsSeq.getName());
assertEquals(1, cdsSeq.getDBRefs().length);
DBRefEntry cdsRef = cdsSeq.getDBRefs()[0];
assertEquals("EMBLCDS", cdsRef.getSource());
assertEquals("2", cdsRef.getVersion());
assertEquals("A12345", cdsRef.getAccessionId());
cdsSeq = cds.get(1);
assertEquals("aaa---ccc---", cdsSeq.getSequenceAsString());
assertEquals("dna1|A12346", cdsSeq.getName());
assertEquals(1, cdsSeq.getDBRefs().length);
cdsRef = cdsSeq.getDBRefs()[0];
assertEquals("EMBLCDS", cdsRef.getSource());
assertEquals("3", cdsRef.getVersion());
assertEquals("A12346", cdsRef.getAccessionId());
cdsSeq = cds.get(2);
assertEquals("aaa------TTT", cdsSeq.getSequenceAsString());
assertEquals("dna1|A12347", cdsSeq.getName());
assertEquals(1, cdsSeq.getDBRefs().length);
cdsRef = cdsSeq.getDBRefs()[0];
assertEquals("EMBLCDS", cdsRef.getSource());
assertEquals("4", cdsRef.getVersion());
assertEquals("A12347", cdsRef.getAccessionId());
/*
* Verify there are mappings from each cds sequence to its protein product
* and also to its dna source
*/
Iterator newMappingsIterator = mappings.iterator();
// mappings for dna1 - exon1 - pep1
AlignedCodonFrame cdsMapping = newMappingsIterator.next();
List dnaMappings = cdsMapping.getMappingsForSequence(dna1);
assertEquals(1, dnaMappings.size());
assertSame(cds.get(0).getDatasetSequence(), dnaMappings.get(0)
.getTo());
assertEquals("G(1) in CDS should map to G(4) in DNA", 4, dnaMappings
.get(0).getMap().getToPosition(1));
List peptideMappings = cdsMapping
.getMappingsForSequence(pep1);
assertEquals(1, peptideMappings.size());
assertSame(pep1.getDatasetSequence(), peptideMappings.get(0).getTo());
// mappings for dna1 - cds2 - pep2
cdsMapping = newMappingsIterator.next();
dnaMappings = cdsMapping.getMappingsForSequence(dna1);
assertEquals(1, dnaMappings.size());
assertSame(cds.get(1).getDatasetSequence(), dnaMappings.get(0)
.getTo());
assertEquals("c(4) in CDS should map to c(7) in DNA", 7, dnaMappings
.get(0).getMap().getToPosition(4));
peptideMappings = cdsMapping.getMappingsForSequence(pep2);
assertEquals(1, peptideMappings.size());
assertSame(pep2.getDatasetSequence(), peptideMappings.get(0).getTo());
// mappings for dna1 - cds3 - pep3
cdsMapping = newMappingsIterator.next();
dnaMappings = cdsMapping.getMappingsForSequence(dna1);
assertEquals(1, dnaMappings.size());
assertSame(cds.get(2).getDatasetSequence(), dnaMappings.get(0)
.getTo());
assertEquals("T(4) in CDS should map to T(10) in DNA", 10, dnaMappings
.get(0).getMap().getToPosition(4));
peptideMappings = cdsMapping.getMappingsForSequence(pep3);
assertEquals(1, peptideMappings.size());
assertSame(pep3.getDatasetSequence(), peptideMappings.get(0).getTo());
}
@Test(groups = { "Functional" })
public void testIsMappable()
{
SequenceI dna1 = new Sequence("dna1", "cgCAGtgGT");
SequenceI aa1 = new Sequence("aa1", "RSG");
AlignmentI al1 = new Alignment(new SequenceI[] { dna1 });
AlignmentI al2 = new Alignment(new SequenceI[] { aa1 });
assertFalse(AlignmentUtils.isMappable(null, null));
assertFalse(AlignmentUtils.isMappable(al1, null));
assertFalse(AlignmentUtils.isMappable(null, al1));
assertFalse(AlignmentUtils.isMappable(al1, al1));
assertFalse(AlignmentUtils.isMappable(al2, al2));
assertTrue(AlignmentUtils.isMappable(al1, al2));
assertTrue(AlignmentUtils.isMappable(al2, al1));
}
/**
* Test creating a mapping when the sequences involved do not start at residue
* 1
*
* @throws IOException
*/
@Test(groups = { "Functional" })
public void testMapCdnaToProtein_forSubsequence()
throws IOException
{
SequenceI prot = new Sequence("UNIPROT|V12345", "E-I--Q", 10, 12);
prot.createDatasetSequence();
SequenceI dna = new Sequence("EMBL|A33333", "GAA--AT-C-CAG", 40, 48);
dna.createDatasetSequence();
MapList map = AlignmentUtils.mapCdnaToProtein(prot, dna);
assertEquals(10, map.getToLowest());
assertEquals(12, map.getToHighest());
assertEquals(40, map.getFromLowest());
assertEquals(48, map.getFromHighest());
}
/**
* Test for the alignSequenceAs method where we have protein mapped to protein
*/
@Test(groups = { "Functional" })
public void testAlignSequenceAs_mappedProteinProtein()
{
SequenceI alignMe = new Sequence("Match", "MGAASEV");
alignMe.createDatasetSequence();
SequenceI alignFrom = new Sequence("Query", "LQTGYMGAASEVMFSPTRR");
alignFrom.createDatasetSequence();
AlignedCodonFrame acf = new AlignedCodonFrame();
// this is like a domain or motif match of part of a peptide sequence
MapList map = new MapList(new int[] { 6, 12 }, new int[] { 1, 7 }, 1, 1);
acf.addMap(alignFrom.getDatasetSequence(),
alignMe.getDatasetSequence(), map);
AlignmentUtils.alignSequenceAs(alignMe, alignFrom, acf, "-", '-', true,
true);
assertEquals("-----MGAASEV-------", alignMe.getSequenceAsString());
}
/**
* Test for the alignSequenceAs method where there are trailing unmapped
* residues in the model sequence
*/
@Test(groups = { "Functional" })
public void testAlignSequenceAs_withTrailingPeptide()
{
// map first 3 codons to KPF; G is a trailing unmapped residue
MapList map = new MapList(new int[] { 1, 9 }, new int[] { 1, 3 }, 3, 1);
checkAlignSequenceAs("AAACCCTTT", "K-PFG", true, true, map,
"AAA---CCCTTT---");
}
/**
* Tests for transferring features between mapped sequences
*/
@Test(groups = { "Functional" })
public void testTransferFeatures()
{
SequenceI dna = new Sequence("dna/20-34", "acgTAGcaaGCCcgt");
SequenceI cds = new Sequence("cds/10-15", "TAGGCC");
// no overlap
dna.addSequenceFeature(new SequenceFeature("type1", "desc1", 1, 2, 1f,
null));
// partial overlap - to [1, 1]
dna.addSequenceFeature(new SequenceFeature("type2", "desc2", 3, 4, 2f,
null));
// exact overlap - to [1, 3]
dna.addSequenceFeature(new SequenceFeature("type3", "desc3", 4, 6, 3f,
null));
// spanning overlap - to [2, 5]
dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f,
null));
// exactly overlaps whole mapped range [1, 6]
dna.addSequenceFeature(new SequenceFeature("type5", "desc5", 4, 12, 5f,
null));
// no overlap (internal)
dna.addSequenceFeature(new SequenceFeature("type6", "desc6", 7, 9, 6f,
null));
// no overlap (3' end)
dna.addSequenceFeature(new SequenceFeature("type7", "desc7", 13, 15,
7f, null));
// overlap (3' end) - to [6, 6]
dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12,
8f, null));
// extended overlap - to [6, +]
dna.addSequenceFeature(new SequenceFeature("type9", "desc9", 12, 13,
9f, null));
MapList map = new MapList(new int[] { 4, 6, 10, 12 },
new int[] { 1, 6 }, 1, 1);
/*
* transferFeatures() will build 'partial overlap' for regions
* that partially overlap 5' or 3' (start or end) of target sequence
*/
AlignmentUtils.transferFeatures(dna, cds, map, null);
SequenceFeature[] sfs = cds.getSequenceFeatures();
assertEquals(6, sfs.length);
SequenceFeature sf = sfs[0];
assertEquals("type2", sf.getType());
assertEquals("desc2", sf.getDescription());
assertEquals(2f, sf.getScore());
assertEquals(1, sf.getBegin());
assertEquals(1, sf.getEnd());
sf = sfs[1];
assertEquals("type3", sf.getType());
assertEquals("desc3", sf.getDescription());
assertEquals(3f, sf.getScore());
assertEquals(1, sf.getBegin());
assertEquals(3, sf.getEnd());
sf = sfs[2];
assertEquals("type4", sf.getType());
assertEquals(2, sf.getBegin());
assertEquals(5, sf.getEnd());
sf = sfs[3];
assertEquals("type5", sf.getType());
assertEquals(1, sf.getBegin());
assertEquals(6, sf.getEnd());
sf = sfs[4];
assertEquals("type8", sf.getType());
assertEquals(6, sf.getBegin());
assertEquals(6, sf.getEnd());
sf = sfs[5];
assertEquals("type9", sf.getType());
assertEquals(6, sf.getBegin());
assertEquals(6, sf.getEnd());
}
/**
* Tests for transferring features between mapped sequences
*/
@Test(groups = { "Functional" })
public void testTransferFeatures_withOmit()
{
SequenceI dna = new Sequence("dna/20-34", "acgTAGcaaGCCcgt");
SequenceI cds = new Sequence("cds/10-15", "TAGGCC");
MapList map = new MapList(new int[] { 4, 6, 10, 12 },
new int[] { 1, 6 }, 1, 1);
// [5, 11] maps to [2, 5]
dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f,
null));
// [4, 12] maps to [1, 6]
dna.addSequenceFeature(new SequenceFeature("type5", "desc5", 4, 12, 5f,
null));
// [12, 12] maps to [6, 6]
dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12,
8f, null));
// desc4 and desc8 are the 'omit these' varargs
AlignmentUtils.transferFeatures(dna, cds, map, null, "type4", "type8");
SequenceFeature[] sfs = cds.getSequenceFeatures();
assertEquals(1, sfs.length);
SequenceFeature sf = sfs[0];
assertEquals("type5", sf.getType());
assertEquals(1, sf.getBegin());
assertEquals(6, sf.getEnd());
}
/**
* Tests for transferring features between mapped sequences
*/
@Test(groups = { "Functional" })
public void testTransferFeatures_withSelect()
{
SequenceI dna = new Sequence("dna/20-34", "acgTAGcaaGCCcgt");
SequenceI cds = new Sequence("cds/10-15", "TAGGCC");
MapList map = new MapList(new int[] { 4, 6, 10, 12 },
new int[] { 1, 6 }, 1, 1);
// [5, 11] maps to [2, 5]
dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f,
null));
// [4, 12] maps to [1, 6]
dna.addSequenceFeature(new SequenceFeature("type5", "desc5", 4, 12, 5f,
null));
// [12, 12] maps to [6, 6]
dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12,
8f, null));
// "type5" is the 'select this type' argument
AlignmentUtils.transferFeatures(dna, cds, map, "type5");
SequenceFeature[] sfs = cds.getSequenceFeatures();
assertEquals(1, sfs.length);
SequenceFeature sf = sfs[0];
assertEquals("type5", sf.getType());
assertEquals(1, sf.getBegin());
assertEquals(6, sf.getEnd());
}
/**
* Test the method that extracts the cds-only part of a dna alignment, for the
* case where the cds should be aligned to match its nucleotide sequence.
*/
@Test(groups = { "Functional" })
public void testMakeCdsAlignment_alternativeTranscripts()
{
SequenceI dna1 = new Sequence("dna1", "aaaGGGCC-----CTTTaaaGGG");
// alternative transcript of same dna skips CCC codon
SequenceI dna2 = new Sequence("dna2", "aaaGGGCC-----cttTaaaGGG");
// dna3 has no mapping (protein product) so should be ignored here
SequenceI dna3 = new Sequence("dna3", "aaaGGGCCCCCGGGcttTaaaGGG");
SequenceI pep1 = new Sequence("pep1", "GPFG");
SequenceI pep2 = new Sequence("pep2", "GPG");
dna1.createDatasetSequence();
dna2.createDatasetSequence();
dna3.createDatasetSequence();
pep1.createDatasetSequence();
pep2.createDatasetSequence();
dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 8, 0f,
null));
dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 9, 12, 0f,
null));
dna1.addSequenceFeature(new SequenceFeature("CDS", "cds3", 16, 18, 0f,
null));
dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 4, 8, 0f,
null));
dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 12, 12, 0f,
null));
dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 16, 18, 0f,
null));
List mappings = new ArrayList();
MapList map = new MapList(new int[] { 4, 12, 16, 18 },
new int[] { 1, 4 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map);
mappings.add(acf);
map = new MapList(new int[] { 4, 8, 12, 12, 16, 18 },
new int[] { 1, 3 },
3, 1);
acf = new AlignedCodonFrame();
acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), map);
mappings.add(acf);
AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 });
dna.setDataset(null);
AlignmentI cds = AlignmentUtils.makeCdsAlignment(new SequenceI[] {
dna1, dna2, dna3 }, mappings, dna);
List cdsSeqs = cds.getSequences();
assertEquals(2, cdsSeqs.size());
assertEquals("GGGCCCTTTGGG", cdsSeqs.get(0).getSequenceAsString());
assertEquals("GGGCC---TGGG", cdsSeqs.get(1).getSequenceAsString());
/*
* verify shared, extended alignment dataset
*/
assertSame(dna.getDataset(), cds.getDataset());
assertTrue(dna.getDataset().getSequences()
.contains(cdsSeqs.get(0).getDatasetSequence()));
assertTrue(dna.getDataset().getSequences()
.contains(cdsSeqs.get(1).getDatasetSequence()));
/*
* Verify updated mappings
*/
assertEquals(2, mappings.size());
/*
* Mapping from pep1 to GGGTTT in first new CDS sequence
*/
List pep1Mapping = MappingUtils
.findMappingsForSequence(pep1, mappings);
assertEquals(1, pep1Mapping.size());
/*
* maps GPFG to 1-3,4-6,7-9,10-12
*/
SearchResults sr = MappingUtils.buildSearchResults(pep1, 1, mappings);
assertEquals(1, sr.getResults().size());
Match m = sr.getResults().get(0);
assertEquals(cds.getSequenceAt(0).getDatasetSequence(),
m.getSequence());
assertEquals(1, m.getStart());
assertEquals(3, m.getEnd());
sr = MappingUtils.buildSearchResults(pep1, 2, mappings);
m = sr.getResults().get(0);
assertEquals(4, m.getStart());
assertEquals(6, m.getEnd());
sr = MappingUtils.buildSearchResults(pep1, 3, mappings);
m = sr.getResults().get(0);
assertEquals(7, m.getStart());
assertEquals(9, m.getEnd());
sr = MappingUtils.buildSearchResults(pep1, 4, mappings);
m = sr.getResults().get(0);
assertEquals(10, m.getStart());
assertEquals(12, m.getEnd());
/*
* GPG in pep2 map to 1-3,4-6,7-9 in second CDS sequence
*/
List pep2Mapping = MappingUtils
.findMappingsForSequence(pep2, mappings);
assertEquals(1, pep2Mapping.size());
sr = MappingUtils.buildSearchResults(pep2, 1, mappings);
assertEquals(1, sr.getResults().size());
m = sr.getResults().get(0);
assertEquals(cds.getSequenceAt(1).getDatasetSequence(),
m.getSequence());
assertEquals(1, m.getStart());
assertEquals(3, m.getEnd());
sr = MappingUtils.buildSearchResults(pep2, 2, mappings);
m = sr.getResults().get(0);
assertEquals(4, m.getStart());
assertEquals(6, m.getEnd());
sr = MappingUtils.buildSearchResults(pep2, 3, mappings);
m = sr.getResults().get(0);
assertEquals(7, m.getStart());
assertEquals(9, m.getEnd());
}
/**
* Tests for gapped column in sequences
*/
@Test(groups = { "Functional" })
public void testIsGappedColumn()
{
SequenceI seq1 = new Sequence("Seq1", "a--c.tc-a-g");
SequenceI seq2 = new Sequence("Seq2", "aa---t--a-g");
SequenceI seq3 = new Sequence("Seq3", "ag-c t-g-");
List seqs = Arrays
.asList(new SequenceI[] { seq1, seq2, seq3 });
// the column number is base 1
assertFalse(AlignmentUtils.isGappedColumn(seqs, 1));
assertFalse(AlignmentUtils.isGappedColumn(seqs, 2));
assertTrue(AlignmentUtils.isGappedColumn(seqs, 3));
assertFalse(AlignmentUtils.isGappedColumn(seqs, 4));
assertTrue(AlignmentUtils.isGappedColumn(seqs, 5));
assertFalse(AlignmentUtils.isGappedColumn(seqs, 6));
assertFalse(AlignmentUtils.isGappedColumn(seqs, 7));
assertFalse(AlignmentUtils.isGappedColumn(seqs, 8));
assertFalse(AlignmentUtils.isGappedColumn(seqs, 9));
assertTrue(AlignmentUtils.isGappedColumn(seqs, 10));
assertFalse(AlignmentUtils.isGappedColumn(seqs, 11));
// out of bounds:
assertTrue(AlignmentUtils.isGappedColumn(seqs, 0));
assertTrue(AlignmentUtils.isGappedColumn(seqs, 100));
assertTrue(AlignmentUtils.isGappedColumn(seqs, -100));
assertTrue(AlignmentUtils.isGappedColumn(null, 0));
}
@Test(groups = { "Functional" })
public void testFindCdsColumns()
{
// TODO target method belongs in a general-purpose alignment
// analysis method to find columns for feature
/*
* NB this method assumes CDS ranges are contiguous (no introns)
*/
SequenceI gene = new Sequence("gene", "aaacccgggtttaaacccgggttt");
SequenceI seq1 = new Sequence("Seq1", "--ac-cgGG-GGaaACC--GGtt-");
SequenceI seq2 = new Sequence("Seq2", "AA--CCGG--g-AAA--cG-GTTt");
seq1.createDatasetSequence();
seq2.createDatasetSequence();
seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 5, 6, 0f,
null));
seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 7, 8, 0f,
null));
seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 11, 13, 0f,
null));
seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 14, 15, 0f,
null));
seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 1, 2, 0f,
null));
seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 3, 6, 0f,
null));
seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 8, 10, 0f,
null));
seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 12, 12, 0f,
null));
seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 13, 15, 0f,
null));
List cdsColumns = AlignmentUtils.findCdsColumns(new SequenceI[] {
seq1, seq2 });
assertEquals(4, cdsColumns.size());
assertEquals("[1, 2]", Arrays.toString(cdsColumns.get(0)));
assertEquals("[5, 9]", Arrays.toString(cdsColumns.get(1)));
assertEquals("[11, 17]", Arrays.toString(cdsColumns.get(2)));
assertEquals("[19, 23]", Arrays.toString(cdsColumns.get(3)));
}
/**
* Test the method that realigns protein to match mapped codon alignment.
*/
@Test(groups = { "Functional" })
public void testAlignProteinAsDna_incompleteStartCodon()
{
// seq1: incomplete start codon (not mapped), then [3, 11]
SequenceI dna1 = new Sequence("Seq1", "ccAAA-TTT-GGG-");
// seq2 codons are [4, 5], [8, 11]
SequenceI dna2 = new Sequence("Seq2", "ccaAA-ttT-GGG-");
// seq3 incomplete start codon at 'tt'
SequenceI dna3 = new Sequence("Seq3", "ccaaa-ttt-GGG-");
AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 });
dna.setDataset(null);
// prot1 has 'X' for incomplete start codon (not mapped)
SequenceI prot1 = new Sequence("Seq1", "XKFG"); // X for incomplete start
SequenceI prot2 = new Sequence("Seq2", "NG");
SequenceI prot3 = new Sequence("Seq3", "XG"); // X for incomplete start
AlignmentI protein = new Alignment(new SequenceI[] { prot1, prot2,
prot3 });
protein.setDataset(null);
// map dna1 [3, 11] to prot1 [2, 4] KFG
MapList map = new MapList(new int[] { 3, 11 }, new int[] { 2, 4 }, 3, 1);
AlignedCodonFrame acf = new AlignedCodonFrame();
acf.addMap(dna1.getDatasetSequence(), prot1.getDatasetSequence(), map);
// map dna2 [4, 5] [8, 11] to prot2 [1, 2] NG
map = new MapList(new int[] { 4, 5, 8, 11 }, new int[] { 1, 2 }, 3, 1);
acf.addMap(dna2.getDatasetSequence(), prot2.getDatasetSequence(), map);
// map dna3 [9, 11] to prot3 [2, 2] G
map = new MapList(new int[] { 9, 11 }, new int[] { 2, 2 }, 3, 1);
acf.addMap(dna3.getDatasetSequence(), prot3.getDatasetSequence(), map);
ArrayList acfs = new ArrayList();
acfs.add(acf);
protein.setCodonFrames(acfs);
/*
* verify X is included in the aligned proteins, and placed just
* before the first mapped residue
* CCT is between CCC and TTT
*/
AlignmentUtils.alignProteinAsDna(protein, dna);
assertEquals("XK-FG", prot1.getSequenceAsString());
assertEquals("--N-G", prot2.getSequenceAsString());
assertEquals("---XG", prot3.getSequenceAsString());
}
/**
* Tests for the method that maps the subset of a dna sequence that has CDS
* (or subtype) feature - case where the start codon is incomplete.
*/
@Test(groups = "Functional")
public void testGetCdsRanges_fivePrimeIncomplete()
{
SequenceI dnaSeq = new Sequence("dna", "aaagGGCCCaaaTTTttt");
dnaSeq.createDatasetSequence();
SequenceI ds = dnaSeq.getDatasetSequence();
// CDS for dna 5-6 (incomplete codon), 7-9
SequenceFeature sf = new SequenceFeature("CDS", "", 5, 9, 0f, null);
sf.setPhase("2"); // skip 2 bases to start of next codon
ds.addSequenceFeature(sf);
// CDS for dna 13-15
sf = new SequenceFeature("CDS_predicted", "", 13, 15, 0f, null);
ds.addSequenceFeature(sf);
List ranges = AlignmentUtils.findCdsPositions(dnaSeq);
/*
* check the mapping starts with the first complete codon
*/
assertEquals(6, MappingUtils.getLength(ranges));
assertEquals(2, ranges.size());
assertEquals(7, ranges.get(0)[0]);
assertEquals(9, ranges.get(0)[1]);
assertEquals(13, ranges.get(1)[0]);
assertEquals(15, ranges.get(1)[1]);
}
/**
* Tests for the method that maps the subset of a dna sequence that has CDS
* (or subtype) feature.
*/
@Test(groups = "Functional")
public void testGetCdsRanges()
{
SequenceI dnaSeq = new Sequence("dna", "aaaGGGcccAAATTTttt");
dnaSeq.createDatasetSequence();
SequenceI ds = dnaSeq.getDatasetSequence();
// CDS for dna 3-6
SequenceFeature sf = new SequenceFeature("CDS", "", 4, 6, 0f, null);
ds.addSequenceFeature(sf);
// exon feature should be ignored here
sf = new SequenceFeature("exon", "", 7, 9, 0f, null);
ds.addSequenceFeature(sf);
// CDS for dna 10-12
sf = new SequenceFeature("CDS_predicted", "", 10, 12, 0f, null);
ds.addSequenceFeature(sf);
List ranges = AlignmentUtils.findCdsPositions(dnaSeq);
assertEquals(6, MappingUtils.getLength(ranges));
assertEquals(2, ranges.size());
assertEquals(4, ranges.get(0)[0]);
assertEquals(6, ranges.get(0)[1]);
assertEquals(10, ranges.get(1)[0]);
assertEquals(12, ranges.get(1)[1]);
}
/**
* Test the method that computes a map of codon variants for each protein
* position from "sequence_variant" features on dna
*/
@Test(groups = "Functional")
public void testBuildDnaVariantsMap()
{
SequenceI dna = new Sequence("dna", "atgAAATTTGGGCCCtag");
MapList map = new MapList(new int[] { 1, 18 }, new int[] { 1, 5 }, 3, 1);
/*
* first with no variants on dna
*/
LinkedHashMap variantsMap = AlignmentUtils
.buildDnaVariantsMap(dna, map);
assertTrue(variantsMap.isEmpty());
// single allele codon 1, on base 1
SequenceFeature sf = new SequenceFeature("sequence_variant", "", 1, 1,
0f, null);
sf.setValue("alleles", "T");
dna.addSequenceFeature(sf);
// two alleles codon 2, on bases 2 and 3
sf = new SequenceFeature("sequence_variant", "", 5, 5, 0f, null);
sf.setValue("alleles", "T");
dna.addSequenceFeature(sf);
sf = new SequenceFeature("sequence_variant", "", 6, 6, 0f, null);
sf.setValue("alleles", "G");
dna.addSequenceFeature(sf);
// two alleles codon 3, both on base 2
sf = new SequenceFeature("sequence_variant", "", 8, 8, 0f, null);
sf.setValue("alleles", "C, G");
dna.addSequenceFeature(sf);
// no alleles on codon 4
// alleles on codon 5 on all 3 bases
sf = new SequenceFeature("sequence_variant", "", 13, 13, 0f, null);
sf.setValue("alleles", "C, G"); // (C duplicates given base value)
dna.addSequenceFeature(sf);
sf = new SequenceFeature("sequence_variant", "", 14, 14, 0f, null);
sf.setValue("alleles", "g, a"); // should force to upper-case
dna.addSequenceFeature(sf);
sf = new SequenceFeature("sequence_variant", "", 15, 15, 0f, null);
sf.setValue("alleles", "A, T");
dna.addSequenceFeature(sf);
variantsMap = AlignmentUtils.buildDnaVariantsMap(dna, map);
assertEquals(4, variantsMap.size());
assertTrue(Arrays.deepEquals(new String[][] { { "A", "T" }, { "T" },
{ "G" } }, variantsMap.get(1)));
assertTrue(Arrays.deepEquals(new String[][] { { "A" }, { "A", "T" },
{ "A", "G" } }, variantsMap.get(2)));
assertTrue(Arrays.deepEquals(new String[][] { { "T" },
{ "T", "C", "G" }, { "T" } }, variantsMap.get(3)));
// duplicated bases are not removed here, handled in computePeptideVariants
assertTrue(Arrays.deepEquals(new String[][] { { "C", "C", "G" },
{ "C", "G", "A" }, { "C", "A", "T" } }, variantsMap.get(5)));
}
/**
* Tests for the method that computes all peptide variants given codon
* variants
*/
@Test(groups = "Functional")
public void testComputePeptideVariants()
{
String[][] codonVariants = new String[][] { { "A" }, { "G" }, { "T" } };
/*
* AGT codes for S - this is not included in the variants returned
*/
List variants = AlignmentUtils.computePeptideVariants(codonVariants, "S");
assertEquals("[]", variants.toString());
// S is reported if it differs from the current value (A):
variants = AlignmentUtils.computePeptideVariants(codonVariants, "A");
assertEquals("[S]", variants.toString());
/*
* synonymous variant is not reported
*/
codonVariants = new String[][] { { "A" }, { "G" }, { "C", "T" } };
// AGC and AGT both code for S
variants = AlignmentUtils.computePeptideVariants(codonVariants, "s");
assertEquals("[]", variants.toString());
/*
* equivalent variants are only reported once
*/
codonVariants = new String[][] { { "C" }, { "T" },
{ "A", "C", "G", "T" } };
// CTA CTC CTG CTT all code for L
variants = AlignmentUtils.computePeptideVariants(codonVariants, "S");
assertEquals("[L]", variants.toString());
/*
* vary codons 1 and 2; variant products are sorted and non-redundant
*/
codonVariants = new String[][] { { "a", "C" }, { "g", "T" }, { "A" } };
// aga ata cga cta code for R, I, R, L
variants = AlignmentUtils.computePeptideVariants(codonVariants, "S");
assertEquals("[I, L, R]", variants.toString());
/*
* vary codons 2 and 3
*/
codonVariants = new String[][] { { "a" }, { "g", "T" }, { "A", "c" } };
// aga agc ata atc code for R, S, I, I
variants = AlignmentUtils.computePeptideVariants(codonVariants, "S");
assertEquals("[I, R]", variants.toString());
/*
* vary codons 1 and 3
*/
codonVariants = new String[][] { { "a", "t" }, { "a" }, { "t", "g" } };
// aat aag tat tag code for N, K, Y, STOP - STOP sorted to end
variants = AlignmentUtils.computePeptideVariants(codonVariants, "S");
assertEquals("[K, N, Y, STOP]", variants.toString());
/*
* vary codons 1, 2 and 3
*/
codonVariants = new String[][] { { "a", "t" }, { "G", "C" },
{ "t", "g" } };
// agt agg act acg tgt tgg tct tcg code for S, R, T, T, C, W, S, S
variants = AlignmentUtils.computePeptideVariants(codonVariants, "S");
assertEquals("[C, R, T, W]", variants.toString());
}
}