package jalview.datamodel.xdb.embl;

import static org.testng.AssertJUnit.assertEquals;

import jalview.datamodel.Sequence;
import jalview.datamodel.SequenceI;

import java.util.ArrayList;
import java.util.Arrays;
import java.util.List;

import org.testng.annotations.Test;

public class EmblEntryTest
{
  @Test(groups = "Functional")
  public void testGetCdsRanges()
  {
    EmblEntry testee = new EmblEntry();

    /*
     * Make a (CDS) Feature with 4 locations
     */
    EmblFeature cds = new EmblFeature();
    cds.setLocation("join(10..20,complement(30..40),50..60,70..80,complement(110..120))");

    int[] exons = testee.getCdsRanges(cds);
    assertEquals("[10, 20, 40, 30, 50, 60, 70, 80, 120, 110]",
            Arrays.toString(exons));
  }

  @Test(groups = "Functional")
  public void testParseCodingFeature()
  {
    // not the whole sequence but enough for this test...
    SequenceI dna = new Sequence("J03321", "GGATCCGTAAGTTAGACGAAATT");
    List<SequenceI> peptides = new ArrayList<SequenceI>();
    EmblFile ef = EmblTestHelper.getEmblFile();
    EmblFeature feature = null;
    for (EmblFeature feat : ef.getEntries().get(0).getFeatures())
    {
      if ("CDS".equals(feat.getName()))
      {
        feature = feat;
        break;
      }
    }

    EmblEntry testee = new EmblEntry();
    testee.parseCodingFeature(feature, "EMBL", dna, peptides);
  }
}