/*
* Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
* Copyright (C) $$Year-Rel$$ The Jalview Authors
*
* This file is part of Jalview.
*
* Jalview is free software: you can redistribute it and/or
* modify it under the terms of the GNU General Public License
* as published by the Free Software Foundation, either version 3
* of the License, or (at your option) any later version.
*
* Jalview is distributed in the hope that it will be useful, but
* WITHOUT ANY WARRANTY; without even the implied warranty
* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
* PURPOSE. See the GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License
* along with Jalview. If not, see .
* The Jalview Authors are detailed in the 'AUTHORS' file.
*/
package jalview.datamodel.xdb.embl;
import java.io.StringReader;
public class EmblTestHelper
{
// adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml
// dna and translations truncated for convenience
private static final String TESTDATA = ""
+ ""
+ ""
+ "X07574"
+ "C. trachomatis plasmid"
+ "plasmidunidentified reading frame"
+ ""
+ ""
/*
* first CDS (range and translation changed to keep test data manageable)
*/
+ ""
// test the case of >1 cross-ref to the same database (JAL-2029)
+ ""
+ ""
+ "ORF 8 (AA 1-330)pickle"
+ "CAA30420.1"
+ "MLCFKeith"
+ ""
/*
* second CDS (range and translation changed to keep test data manageable)
*/
+ ""
+ ""
+ "CAA30421.1"
+ "MSSS"
+ ""
/*
* third CDS is made up - has no xref - code should synthesize
* one to an assumed EMBLCDSPROTEIN accession
*/
+ ""
+ "CAA12345.6"
+ "MSS"
+ ""
/*
* sequence (modified for test purposes)
* emulates EMBL XML 1.2 which splits sequence data every 60 characters
* see EmblSequence.setSequence
*/
+ "GGTATGTCCTCTAGTACAAAC\n"
+ "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT"
+ "";
static EmblFile getEmblFile()
{
return EmblFile.getEmblFile(new StringReader(TESTDATA));
}
}