package jalview.datamodel.xdb.embl; import java.io.StringReader; public class EmblTestHelper { // adapted from http://www.ebi.ac.uk/ena/data/view/X07547&display=xml // dna and translations truncated for convenience private static final String TESTDATA = "" + "" + "" + "X07574" + "C. trachomatis plasmid" + "plasmidunidentified reading frame" + "" + "" /* * first CDS (range and translation changed to keep test data manageable) */ + "" // test the case of >1 cross-ref to the same database (JAL-2029) + "" + "" + "ORF 8 (AA 1-330)pickle" + "CAA30420.1" + "MLCFKeith" + "" /* * second CDS (range and translation changed to keep test data manageable) */ + "" + "" + "CAA30421.1" + "MSSS" + "" /* * sequence (modified for test purposes) * emulates EMBL XML 1.2 which splits sequence data every 60 characters * see EmblSequence.setSequence */ + "GGTATGTCCTCTAGTACAAAC\n" + "ACCCCCAATATTGTGATATAATTAAAAACATAGCAT" + ""; static EmblFile getEmblFile() { return EmblFile.getEmblFile(new StringReader(TESTDATA)); } }