/* * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$) * Copyright (C) $$Year-Rel$$ The Jalview Authors * * This file is part of Jalview. * * Jalview is free software: you can redistribute it and/or * modify it under the terms of the GNU General Public License * as published by the Free Software Foundation, either version 3 * of the License, or (at your option) any later version. * * Jalview is distributed in the hope that it will be useful, but * WITHOUT ANY WARRANTY; without even the implied warranty * of MERCHANTABILITY or FITNESS FOR A PARTICULAR * PURPOSE. See the GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with Jalview. If not, see . * The Jalview Authors are detailed in the 'AUTHORS' file. */ package jalview.io.gff; import static org.testng.AssertJUnit.assertEquals; import static org.testng.AssertJUnit.assertNull; import static org.testng.AssertJUnit.assertSame; import static org.testng.AssertJUnit.assertTrue; import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals; import jalview.datamodel.AlignedCodonFrame; import jalview.datamodel.Alignment; import jalview.datamodel.AlignmentI; import jalview.datamodel.Mapping; import jalview.datamodel.MappingType; import jalview.datamodel.Sequence; import jalview.datamodel.SequenceDummy; import jalview.datamodel.SequenceI; import jalview.gui.AlignFrame; import jalview.gui.JvOptionPane; import jalview.io.DataSourceType; import jalview.io.FileLoader; import java.io.IOException; import java.util.ArrayList; import java.util.Iterator; import java.util.List; import java.util.Map; import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; public class ExonerateHelperTest { @BeforeClass(alwaysRun = true) public void setUpJvOptionPane() { JvOptionPane.setInteractiveMode(false); JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION); } @Test(groups = "Functional") public void testGetMappingType() { // protein-to-dna: assertSame(MappingType.PeptideToNucleotide, ExonerateHelper .getMappingType("exonerate:protein2genome:local")); assertSame(MappingType.PeptideToNucleotide, ExonerateHelper.getMappingType("exonerate:protein2dna:local")); // dna-to-dna: assertSame(MappingType.NucleotideToNucleotide, ExonerateHelper.getMappingType("coding2coding")); assertSame(MappingType.NucleotideToNucleotide, ExonerateHelper.getMappingType("coding2genome")); assertSame(MappingType.NucleotideToNucleotide, ExonerateHelper.getMappingType("cdna2genome")); assertSame(MappingType.NucleotideToNucleotide, ExonerateHelper.getMappingType("genome2genome")); assertNull(ExonerateHelper.getMappingType("affine:local")); } /** * Test processing one exonerate GFF line for the case where the mapping is * protein2dna, similarity feature is on the query (the protein), match to the * forward strand, target sequence is in neither the alignment nor the 'new * sequences' * * @throws IOException */ @Test(groups = "Functional") public void testProcessGffSimilarity_protein2dna_forward_querygff() throws IOException { ExonerateHelper testee = new ExonerateHelper(); List newseqs = new ArrayList(); String[] gff = "Seq\texonerate:protein2dna:local\tsimilarity\t3\t10\t.\t+\t.\talignment_id 0 ; Target dna1 ; Align 3 400 8" .split("\\t"); SequenceI seq = new Sequence("Seq", "PQRASTGKEEDVMIWCHQN"); seq.createDatasetSequence(); AlignmentI align = new Alignment(new SequenceI[] {}); Map> set = Gff2Helper.parseNameValuePairs(gff[8]); /* * this should create a mapping from Seq2/3-10 to virtual sequence * dna1 (added to newseqs) positions 400-423 */ testee.processGffSimilarity(set, seq, gff, align, newseqs, false); assertEquals(1, newseqs.size()); assertTrue(newseqs.get(0) instanceof SequenceDummy); assertEquals("dna1", newseqs.get(0).getName()); assertEquals(1, align.getCodonFrames().size()); AlignedCodonFrame mapping = align.getCodonFrames().iterator().next(); assertEquals(1, mapping.getAaSeqs().length); assertSame(seq.getDatasetSequence(), mapping.getAaSeqs()[0]); assertEquals(1, mapping.getdnaSeqs().length); assertSame(newseqs.get(0), mapping.getdnaSeqs()[0]); assertEquals(1, mapping.getdnaToProt().length); assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size()); assertArrayEquals(new int[] { 400, 423 }, mapping.getdnaToProt()[0] .getFromRanges().get(0)); assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size()); assertArrayEquals(new int[] { 3, 10 }, mapping.getdnaToProt()[0] .getToRanges().get(0)); } /** * Test processing one exonerate GFF line for the case where the mapping is * protein2dna, similarity feature is on the query (the protein), match to the * reverse strand * * @throws IOException */ @Test(groups = "Functional") public void testProcessGffSimilarity_protein2dna_reverse_querygff() throws IOException { ExonerateHelper testee = new ExonerateHelper(); List newseqs = new ArrayList(); String[] gff = "Seq\texonerate:protein2dna:local\tsimilarity\t3\t10\t0\t-\t.\talignment_id 0 ; Target dna1 ; Align 3 400 8" .split("\\t"); SequenceI seq = new Sequence("Seq", "PQRASTGKEEDVMIWCHQN"); seq.createDatasetSequence(); AlignmentI align = new Alignment(new SequenceI[] {}); Map> set = Gff2Helper.parseNameValuePairs(gff[8]); /* * this should create a mapping from Seq2/3-10 to virtual sequence * dna1 (added to newseqs) positions 400-377 (reverse) */ testee.processGffSimilarity(set, seq, gff, align, newseqs, false); assertEquals(1, newseqs.size()); assertTrue(newseqs.get(0) instanceof SequenceDummy); assertEquals("dna1", newseqs.get(0).getName()); assertEquals(1, align.getCodonFrames().size()); AlignedCodonFrame mapping = align.getCodonFrames().iterator().next(); assertEquals(1, mapping.getAaSeqs().length); assertSame(seq.getDatasetSequence(), mapping.getAaSeqs()[0]); assertEquals(1, mapping.getdnaSeqs().length); assertSame(newseqs.get(0), mapping.getdnaSeqs()[0]); assertEquals(1, mapping.getdnaToProt().length); assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size()); assertArrayEquals(new int[] { 400, 377 }, mapping.getdnaToProt()[0] .getFromRanges().get(0)); assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size()); assertArrayEquals(new int[] { 3, 10 }, mapping.getdnaToProt()[0] .getToRanges().get(0)); } /** * Test processing one exonerate GFF line for the case where the mapping is * protein2dna, similarity feature is on the target (the dna), match to the * forward strand * * @throws IOException */ @Test(groups = "Functional") public void testProcessGffSimilarity_protein2dna_forward_targetgff() throws IOException { ExonerateHelper testee = new ExonerateHelper(); List newseqs = new ArrayList(); String[] gff = "dna1\texonerate:protein2dna:local\tsimilarity\t400\t423\t0\t+\t.\talignment_id 0 ; Query Prot1 ; Align 400 3 24" .split("\\t"); SequenceI seq = new Sequence("dna1/391-430", "CGATCCGATCCGATCCGATCCGATCCGATCCGATCCGATC"); seq.createDatasetSequence(); AlignmentI align = new Alignment(new SequenceI[] { seq }); // GFF feature on the target describes mapping from base 400 for // count 24 to position 3 Map> set = Gff2Helper.parseNameValuePairs(gff[8]); /* * this should create a mapping from virtual sequence dna1 (added to * newseqs) positions 400-423 to Prot1/3-10 */ testee.processGffSimilarity(set, seq, gff, align, newseqs, false); assertEquals(1, newseqs.size()); assertTrue(newseqs.get(0) instanceof SequenceDummy); assertEquals("Prot1", newseqs.get(0).getName()); assertEquals(1, align.getCodonFrames().size()); AlignedCodonFrame mapping = align.getCodonFrames().iterator().next(); assertEquals(1, mapping.getAaSeqs().length); assertSame(newseqs.get(0), mapping.getAaSeqs()[0]); assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]); assertEquals(1, mapping.getdnaSeqs().length); assertEquals(1, mapping.getdnaToProt().length); assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size()); assertArrayEquals(new int[] { 400, 423 }, mapping.getdnaToProt()[0] .getFromRanges().get(0)); assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size()); assertArrayEquals(new int[] { 3, 10 }, mapping.getdnaToProt()[0] .getToRanges().get(0)); } /** * Test processing one exonerate GFF line for the case where the mapping is * protein2dna, similarity feature is on the target (the dna), match to the * reverse strand * * @throws IOException */ @Test(groups = "Functional") public void testProcessGffSimilarity_protein2dna_reverse_targetgff() throws IOException { ExonerateHelper testee = new ExonerateHelper(); List newseqs = new ArrayList(); String[] gff = "dna1\texonerate:protein2dna:local\tsimilarity\t377\t400\t0\t-\t.\talignment_id 0 ; Query Prot1 ; Align 400 3 24" .split("\\t"); SequenceI seq = new Sequence("dna1/371-410", "CGATCCGATCCGATCCGATCCGATCCGATCCGATCCGATC"); seq.createDatasetSequence(); AlignmentI align = new Alignment(new SequenceI[] { seq }); // GFF feature on the target describes mapping from base 400 for // count 24 to position 3 Map> set = Gff2Helper.parseNameValuePairs(gff[8]); /* * this should create a mapping from virtual sequence dna1 (added to * newseqs) positions 400-377 (reverse) to Prot1/3-10 */ testee.processGffSimilarity(set, seq, gff, align, newseqs, false); assertEquals(1, newseqs.size()); assertTrue(newseqs.get(0) instanceof SequenceDummy); assertEquals("Prot1", newseqs.get(0).getName()); assertEquals(1, align.getCodonFrames().size()); AlignedCodonFrame mapping = align.getCodonFrames().iterator().next(); assertEquals(1, mapping.getAaSeqs().length); assertSame(newseqs.get(0), mapping.getAaSeqs()[0]); assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]); assertEquals(1, mapping.getdnaSeqs().length); assertEquals(1, mapping.getdnaToProt().length); assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size()); assertArrayEquals(new int[] { 400, 377 }, mapping.getdnaToProt()[0] .getFromRanges().get(0)); assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size()); assertArrayEquals(new int[] { 3, 10 }, mapping.getdnaToProt()[0] .getToRanges().get(0)); } /** * Tests loading exonerate GFF2 output, including 'similarity' alignment * feature, on to sequences */ @Test(groups = { "Functional" }) public void testAddExonerateGffToAlignment() { FileLoader loader = new FileLoader(false); AlignFrame af = loader.LoadFileWaitTillLoaded( "examples/testdata/exonerateseqs.fa", DataSourceType.FILE); af.loadJalviewDataFile("examples/testdata/exonerateoutput.gff", DataSourceType.FILE, null, null); /* * verify one mapping to a dummy sequence, one to a real one */ List mappings = af .getViewport().getAlignment().getDataset().getCodonFrames(); assertEquals(2, mappings.size()); Iterator iter = mappings.iterator(); // first mapping is to dummy sequence AlignedCodonFrame mapping = iter.next(); Mapping[] mapList = mapping.getProtMappings(); assertEquals(1, mapList.length); assertTrue(mapList[0].getTo() instanceof SequenceDummy); assertEquals("DDB_G0269124", mapList[0].getTo().getName()); // 143 in protein should map to codon [11270, 11269, 11268] in dna int[] mappedRegion = mapList[0].getMap().locateInFrom(143, 143); assertArrayEquals(new int[] { 11270, 11268 }, mappedRegion); // second mapping is to a sequence in the alignment mapping = iter.next(); mapList = mapping.getProtMappings(); assertEquals(1, mapList.length); SequenceI proteinSeq = af.getViewport().getAlignment() .findName("DDB_G0280897"); assertSame(proteinSeq.getDatasetSequence(), mapList[0].getTo()); assertEquals(1, mapping.getdnaToProt().length); // 143 in protein should map to codon [11270, 11269, 11268] in dna mappedRegion = mapList[0].getMap().locateInFrom(143, 143); assertArrayEquals(new int[] { 11270, 11268 }, mappedRegion); // 182 in protein should map to codon [11153, 11152, 11151] in dna mappedRegion = mapList[0].getMap().locateInFrom(182, 182); assertArrayEquals(new int[] { 11153, 11151 }, mappedRegion); // and the reverse mapping: mappedRegion = mapList[0].getMap().locateInTo(11151, 11153); assertArrayEquals(new int[] { 182, 182 }, mappedRegion); // 11150 in dna should _not_ map to protein mappedRegion = mapList[0].getMap().locateInTo(11150, 11150); assertNull(mappedRegion); // similarly 183 in protein should _not_ map to dna mappedRegion = mapList[0].getMap().locateInFrom(183, 183); assertNull(mappedRegion); } }