/*
* Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
* Copyright (C) $$Year-Rel$$ The Jalview Authors
*
* This file is part of Jalview.
*
* Jalview is free software: you can redistribute it and/or
* modify it under the terms of the GNU General Public License
* as published by the Free Software Foundation, either version 3
* of the License, or (at your option) any later version.
*
* Jalview is distributed in the hope that it will be useful, but
* WITHOUT ANY WARRANTY; without even the implied warranty
* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
* PURPOSE. See the GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License
* along with Jalview. If not, see .
* The Jalview Authors are detailed in the 'AUTHORS' file.
*/
package jalview.io.gff;
import static org.testng.AssertJUnit.assertEquals;
import static org.testng.AssertJUnit.assertNull;
import static org.testng.AssertJUnit.assertSame;
import static org.testng.AssertJUnit.assertTrue;
import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
import jalview.datamodel.AlignedCodonFrame;
import jalview.datamodel.Alignment;
import jalview.datamodel.AlignmentI;
import jalview.datamodel.Sequence;
import jalview.datamodel.SequenceDummy;
import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
import jalview.gui.JvOptionPane;
import java.io.IOException;
import java.util.ArrayList;
import java.util.HashMap;
import java.util.List;
import java.util.Map;
import org.testng.annotations.BeforeClass;
import org.testng.annotations.Test;
public class Gff3HelperTest
{
@BeforeClass(alwaysRun = true)
public void setUpJvOptionPane()
{
JvOptionPane.setInteractiveMode(false);
JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION);
}
/**
* Test processing one PASA GFF line giving a match from forward strand to
* forward strand
*
* @throws IOException
*/
@Test(groups = "Functional")
public void testProcessCdnaMatch_forwardToForward() throws IOException
{
GffHelperBase testee = new Gff3Helper();
List newseqs = new ArrayList();
String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t+\t.\tID=align_68;Target=gi|N37351 1 138 +"
.split("\\t");
SequenceI seq = new Sequence("gi|68711",
"GAATTCGTTCATGTAGGTTGATTTTTATT");
seq.createDatasetSequence();
AlignmentI align = new Alignment(new SequenceI[] {});
/*
* this should create a mapping from gi|68711/12923-13060
* to virtual sequence gi|N37351 (added to newseqs) positions 1-138
*/
testee.processGff(seq, gff, align, newseqs, false);
assertEquals(1, newseqs.size());
assertTrue(newseqs.get(0) instanceof SequenceDummy);
assertEquals("gi|N37351", newseqs.get(0).getName());
assertEquals(1, align.getCodonFrames().size());
AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
/*
* 'dnaseqs' (map from) is here [gi|68711]
* 'aaseqs' (map to) is here [gi|N37351]
*/
// TODO use more suitable naming in AlignedCodonFrame
assertEquals(1, mapping.getAaSeqs().length);
assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
assertEquals(1, mapping.getdnaSeqs().length);
assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
assertEquals(1, mapping.getdnaToProt().length);
assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
assertArrayEquals(new int[] { 12923, 13060 },
mapping.getdnaToProt()[0].getFromRanges().get(0));
assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
assertArrayEquals(new int[] { 1, 138 },
mapping.getdnaToProt()[0].getToRanges().get(0));
}
/**
* Test processing one PASA GFF line giving a match from forward strand to
* reverse strand
*
* @throws IOException
*/
@Test(groups = "Functional")
public void testProcessCdnaMatch_forwardToReverse() throws IOException
{
GffHelperBase testee = new Gff3Helper();
List newseqs = new ArrayList();
String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t+\t.\tID=align_68;Target=gi|N37351 1 138 -"
.split("\\t");
SequenceI seq = new Sequence("gi|68711",
"GAATTCGTTCATGTAGGTTGATTTTTATT");
seq.createDatasetSequence();
AlignmentI align = new Alignment(new SequenceI[] {});
/*
* this should create a mapping from gi|68711/12923-13060
* to virtual sequence gi|N37351 (added to newseqs) positions 138-1
*/
testee.processGff(seq, gff, align, newseqs, false);
assertEquals(1, newseqs.size());
assertTrue(newseqs.get(0) instanceof SequenceDummy);
assertEquals("gi|N37351", newseqs.get(0).getName());
assertEquals(1, align.getCodonFrames().size());
AlignedCodonFrame mapping = align.getCodonFrames().iterator().next();
/*
* 'dnaseqs' (map from) is here [gi|68711]
* 'aaseqs' (map to) is here [gi|N37351]
*/
// TODO use more suitable naming in AlignedCodonFrame
assertEquals(1, mapping.getAaSeqs().length);
assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
assertEquals(1, mapping.getdnaSeqs().length);
assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
assertEquals(1, mapping.getdnaToProt().length);
assertEquals(1, mapping.getdnaToProt()[0].getFromRanges().size());
assertArrayEquals(new int[] { 12923, 13060 },
mapping.getdnaToProt()[0].getFromRanges().get(0));
assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
assertArrayEquals(new int[] { 138, 1 },
mapping.getdnaToProt()[0].getToRanges().get(0));
}
/**
* Test processing one PASA GFF line giving a match from reverse complement
* strand to forward strand
*
* @throws IOException
*/
@Test(groups = "Functional")
public void testProcessCdnaMatch_reverseToForward() throws IOException
{
GffHelperBase testee = new Gff3Helper();
List newseqs = new ArrayList();
String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t-\t.\tID=align_68;Target=gi|N37351 1 138 +"
.split("\\t");
SequenceI seq = new Sequence("gi|68711",
"GAATTCGTTCATGTAGGTTGATTTTTATT");
seq.createDatasetSequence();
AlignmentI align = new Alignment(new SequenceI[] {});
/*
* (For now) we don't process reverse complement mappings; to do this
* would require (a) creating a virtual sequence placeholder for the
* reverse complement (b) resolving the sequence by its id from some
* source (GFF ##FASTA or other) (c) creating the reverse complement
* sequence (d) updating the mapping to be to the reverse complement
*/
SequenceFeature sf = testee.processGff(seq, gff, align, newseqs, false);
assertNull(sf);
assertTrue(newseqs.isEmpty());
}
/**
* Test processing two PASA GFF lines representing a spliced mapping
*
* @throws IOException
*/
@Test(groups = "Functional")
public void testProcessCdnaMatch_spliced() throws IOException
{
GffHelperBase testee = new Gff3Helper();
List newseqs = new ArrayList();
SequenceI seq = new Sequence("gi|68711",
"GAATTCGTTCATGTAGGTTGATTTTTATT");
seq.createDatasetSequence();
AlignmentI align = new Alignment(new SequenceI[] {});
// mapping from gi|68711 12923-13060 to gi|N37351 1-138
String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t+\t.\tID=align_68;Target=gi|N37351 1 138 +"
.split("\\t");
testee.processGff(seq, gff, align, newseqs, false);
// mapping from gi|68711 13411-13550 to gi|N37351 139-278
gff = "gi|68711\tblat-pasa\tcDNA_match\t13411\t13550\t98.55\t+\t.\tID=align_68;Target=gi|N37351 139 278 +"
.split("\\t");
testee.processGff(seq, gff, align, newseqs, false);
assertEquals(1, newseqs.size());
assertTrue(newseqs.get(0) instanceof SequenceDummy);
assertEquals("gi|N37351", newseqs.get(0).getName());
// only 1 AlignedCodonFrame added to the alignment with both mappings!
// (this is important for 'align cdna to genome' to work correctly)
assertEquals(1, align.getCodonFrames().size());
AlignedCodonFrame mapping = align.getCodonFrames().get(0);
/*
* 'dnaseqs' (map from) is here [gi|68711]
* 'aaseqs' (map to) is here [gi|N37351]
*/
// TODO use more suitable naming in AlignedCodonFrame
assertEquals(1, mapping.getAaSeqs().length);
assertSame(seq.getDatasetSequence(), mapping.getdnaSeqs()[0]);
assertEquals(1, mapping.getdnaSeqs().length);
assertSame(newseqs.get(0), mapping.getAaSeqs()[0]);
assertEquals(1, mapping.getdnaToProt().length);
assertEquals(2, mapping.getdnaToProt()[0].getFromRanges().size());
// the two spliced dna ranges are combined in one MapList
assertArrayEquals(new int[] { 12923, 13060 },
mapping.getdnaToProt()[0].getFromRanges().get(0));
assertArrayEquals(new int[] { 13411, 13550 },
mapping.getdnaToProt()[0].getFromRanges().get(1));
assertEquals(1, mapping.getdnaToProt()[0].getToRanges().size());
// the two cdna ranges are merged into one contiguous region
assertArrayEquals(new int[] { 1, 278 },
mapping.getdnaToProt()[0].getToRanges().get(0));
}
@Test(groups = "Functional")
public void testGetDescription()
{
Gff3Helper testee = new Gff3Helper();
SequenceFeature sf = new SequenceFeature("type", "desc", 10, 20, 3f,
"group");
Map> attributes = new HashMap>();
assertNull(testee.getDescription(sf, attributes));
// ID if any is a fall-back for description
sf.setValue("ID", "Patrick");
assertEquals("Patrick", testee.getDescription(sf, attributes));
// Target is set by Exonerate
sf.setValue("Target", "Destination Moon");
assertEquals("Destination", testee.getDescription(sf, attributes));
// Ensembl variant feature - extract "alleles" value
// may be sequence_variant or a sub-type in the sequence ontology
sf = new SequenceFeature("feature_variant", "desc", 10, 20, 3f,
"group");
List atts = new ArrayList();
atts.add("A");
atts.add("C");
atts.add("T");
attributes.put("alleles", atts);
assertEquals("A,C,T", testee.getDescription(sf, attributes));
// Ensembl transcript or exon feature - extract Name
List atts2 = new ArrayList();
atts2.add("ENSE00001871077");
attributes.put("Name", atts2);
sf = new SequenceFeature("transcript", "desc", 10, 20, 3f, "group");
assertEquals("ENSE00001871077", testee.getDescription(sf, attributes));
// transcript sub-type in SO
sf = new SequenceFeature("mRNA", "desc", 10, 20, 3f, "group");
assertEquals("ENSE00001871077", testee.getDescription(sf, attributes));
// special usage of feature by Ensembl
sf = new SequenceFeature("NMD_transcript_variant", "desc", 10, 20, 3f,
"group");
assertEquals("ENSE00001871077", testee.getDescription(sf, attributes));
// exon feature
sf = new SequenceFeature("exon", "desc", 10, 20, 3f, "group");
assertEquals("ENSE00001871077", testee.getDescription(sf, attributes));
}
}