/* * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$) * Copyright (C) $$Year-Rel$$ The Jalview Authors * * This file is part of Jalview. * * Jalview is free software: you can redistribute it and/or * modify it under the terms of the GNU General Public License * as published by the Free Software Foundation, either version 3 * of the License, or (at your option) any later version. * * Jalview is distributed in the hope that it will be useful, but * WITHOUT ANY WARRANTY; without even the implied warranty * of MERCHANTABILITY or FITNESS FOR A PARTICULAR * PURPOSE. See the GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with Jalview. If not, see . * The Jalview Authors are detailed in the 'AUTHORS' file. */ package jalview.io.gff; import static org.testng.AssertJUnit.assertEquals; import static org.testng.AssertJUnit.assertSame; import static org.testng.AssertJUnit.assertTrue; import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals; import jalview.datamodel.AlignedCodonFrame; import jalview.datamodel.Alignment; import jalview.datamodel.AlignmentI; import jalview.datamodel.Mapping; import jalview.datamodel.Sequence; import jalview.datamodel.SequenceDummy; import jalview.datamodel.SequenceI; import jalview.gui.AlignFrame; import jalview.gui.JvOptionPane; import jalview.io.DataSourceType; import jalview.io.FileLoader; import java.util.List; import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; /** * Tests of use cases that include parsing GFF (version 2 or 3) features that * describe mappings between protein and cDNA. The format of the GFF varies * depending on which tool generated it. */ public class GffTests { @BeforeClass(alwaysRun = true) public void setUpJvOptionPane() { JvOptionPane.setInteractiveMode(false); JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION); } /** * Test the case where we load a protein ('query') sequence, then exonerateGff * describing its mapping to cDNA, and then a DNA sequence including the * mapped region */ @Test(groups = "Functional") public void testResolveExonerateGff() { String proteinSeq = ">prot1/10-16\nYCWRSGA"; AlignFrame af = new FileLoader(false).LoadFileWaitTillLoaded( proteinSeq, DataSourceType.PASTE); /* * exonerate GFF output mapping residues 11-15 (CWRSG) * to bases 24-10 in sequence 'dna1' (reverse strand) */ String exonerateGff = "##gff-version 2\n" + "prot1\tprotein2genome\tsimilarity\t11\t15\t99\t-\t.\talignment_id 0 ; Target dna1 ; Align 11 24 5"; af.loadJalviewDataFile(exonerateGff, DataSourceType.PASTE, null, null); /* * check we have a mapping from prot1 to SequenceDummy 'dna1' */ AlignmentI dataset = af.getViewport().getAlignment().getDataset(); assertEquals(1, dataset.getSequences().size()); assertEquals("prot1", dataset.getSequenceAt(0).getName()); assertEquals("YCWRSGA", dataset.getSequenceAt(0).getSequenceAsString()); List mappings = dataset.getCodonFrames(); assertEquals(1, mappings.size()); AlignedCodonFrame mapping = mappings.iterator().next(); SequenceI mappedDna = mapping.getDnaForAaSeq(dataset.getSequenceAt(0)); assertTrue(mappedDna instanceof SequenceDummy); assertEquals("dna1", mappedDna.getName()); Mapping[] mapList = mapping.getProtMappings(); assertEquals(1, mapList.length); // 11 in protein should map to codon [24, 23, 22] in dna int[] mappedRegion = mapList[0].getMap().locateInFrom(11, 11); assertArrayEquals(new int[] { 24, 22 }, mappedRegion); // 15 in protein should map to codon [12, 11, 10] in dna mappedRegion = mapList[0].getMap().locateInFrom(15, 15); assertArrayEquals(new int[] { 12, 10 }, mappedRegion); SequenceI dna1 = new Sequence("dna1", "AAACCCGGGTTTAAACCCGGGTTT"); AlignmentI al = new Alignment(new SequenceI[] { dna1 }); al.setDataset(null); /* * Now 'realise' the virtual mapping to the real DNA sequence; * interactively this could be by a drag or fetch of the sequence data * on to the alignment */ mapping.realiseWith(dna1); // verify the mapping is now from the real, not the dummy sequence assertSame(dna1.getDatasetSequence(), mapping.getDnaForAaSeq(dataset.getSequenceAt(0))); } }