/*
* Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
* Copyright (C) $$Year-Rel$$ The Jalview Authors
*
* This file is part of Jalview.
*
* Jalview is free software: you can redistribute it and/or
* modify it under the terms of the GNU General Public License
* as published by the Free Software Foundation, either version 3
* of the License, or (at your option) any later version.
*
* Jalview is distributed in the hope that it will be useful, but
* WITHOUT ANY WARRANTY; without even the implied warranty
* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
* PURPOSE. See the GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License
* along with Jalview. If not, see .
* The Jalview Authors are detailed in the 'AUTHORS' file.
*/
package jalview.io.vcf;
import static jalview.io.gff.SequenceOntologyI.SEQUENCE_VARIANT;
import static org.testng.Assert.assertEquals;
import static org.testng.Assert.assertNull;
import static org.testng.Assert.assertTrue;
import jalview.bin.Cache;
import jalview.bin.Console;
import jalview.datamodel.AlignmentI;
import jalview.datamodel.DBRefEntry;
import jalview.datamodel.Mapping;
import jalview.datamodel.Sequence;
import jalview.datamodel.SequenceFeature;
import jalview.datamodel.SequenceI;
import jalview.datamodel.features.FeatureAttributes;
import jalview.datamodel.features.SequenceFeatures;
import jalview.gui.AlignFrame;
import jalview.io.DataSourceType;
import jalview.io.FileLoader;
import jalview.io.gff.Gff3Helper;
import jalview.util.MapList;
import java.io.File;
import java.io.IOException;
import java.io.PrintWriter;
import java.util.List;
import java.util.Map;
import org.testng.annotations.BeforeClass;
import org.testng.annotations.BeforeTest;
import org.testng.annotations.Test;
public class VCFLoaderTest
{
private static final float DELTA = 0.00001f;
// columns 9717- of gene P30419 from Ensembl (much modified)
private static final String FASTA = "" +
/*
* forward strand 'gene' and 'transcript' with two exons
*/
">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n"
+ "CAAGCTGGCGGACGAGAGTGTGACA\n"
+ ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
/*
* reverse strand gene and transcript (reverse complement alleles!)
*/
+ ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n"
+ "TGTCACACTCTCGTCCGCCAGCTTG\n" + ">transcript2/1-18\n"
+ "-GTCACACTCT----CGCCAGCT--\n"
/*
* 'gene' on chromosome 5 with two transcripts
*/
+ ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n"
+ "CAAGCTGGCGGACGAGAGTGTGACA\n"
+ ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n"
+ ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n";
private static final String[] VCF = { "##fileformat=VCFv4.2",
// fields other than AF are ignored when parsing as they have no INFO
// definition
"##INFO=",
"##INFO= geneFeatures = al.getSequenceAt(0)
.getSequenceFeatures();
SequenceFeatures.sortFeatures(geneFeatures, true);
assertEquals(geneFeatures.size(), 5);
SequenceFeature sf = geneFeatures.get(0);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 2);
assertEquals(sf.getEnd(), 2);
assertEquals(sf.getScore(), 0f);
assertEquals(sf.getValue("AF"), "4.0e-03");
assertEquals(sf.getValue("AF_AFR"), "2.3e-4");
assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C");
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getValue("POS"), "45051611");
assertEquals(sf.getValue("ID"), "rs384765");
assertEquals(sf.getValue("QUAL"), "1666.64");
assertEquals(sf.getValue("FILTER"), "RF;XYZ");
// malformed integer for AC_Female is ignored (JAL-3375)
assertNull(sf.getValue("AC_Female"));
sf = geneFeatures.get(1);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 2);
assertEquals(sf.getEnd(), 2);
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
DELTA);
assertEquals(sf.getValue("AC_Female"), "12");
// malformed float for AF_AFR is ignored (JAL-3375)
assertNull(sf.getValue("AC_AFR"));
assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T");
sf = geneFeatures.get(2);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 4);
assertEquals(sf.getEnd(), 4);
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
DELTA);
assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
sf = geneFeatures.get(3);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 4);
assertEquals(sf.getEnd(), 4);
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
DELTA);
assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
assertNull(sf.getValue("ID")); // '.' is ignored
assertNull(sf.getValue("FILTER")); // '.' is ignored
sf = geneFeatures.get(4);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 6);
assertEquals(sf.getEnd(), 6);
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getScore(), 0f);
// AF=. should not have been captured
assertNull(sf.getValue("AF"));
assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
/*
* verify variant feature(s) added to transcript
*/
List transcriptFeatures = al.getSequenceAt(1)
.getSequenceFeatures();
assertEquals(transcriptFeatures.size(), 3);
sf = transcriptFeatures.get(0);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 2);
assertEquals(sf.getEnd(), 2);
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
DELTA);
assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C");
sf = transcriptFeatures.get(1);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 2);
assertEquals(sf.getEnd(), 2);
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
DELTA);
assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA");
/*
* verify SNP variant feature(s) computed and added to protein
* first codon AGC varies to ACC giving S/T
*/
List dbRefs = al.getSequenceAt(1).getDBRefs();
SequenceI peptide = null;
for (DBRefEntry dbref : dbRefs)
{
if (dbref.getMap().getMap().getFromRatio() == 3)
{
peptide = dbref.getMap().getTo();
}
}
List proteinFeatures = peptide.getSequenceFeatures();
/*
* JAL-3187 don't precompute protein features, do dynamically instead
*/
assertTrue(proteinFeatures.isEmpty());
}
private File makeVcfFile() throws IOException
{
File f = File.createTempFile("Test", ".vcf");
f.deleteOnExit();
PrintWriter pw = new PrintWriter(f);
for (String vcfLine : VCF)
{
pw.println(vcfLine);
}
pw.close();
return f;
}
/**
* Make a simple alignment with one 'gene' and one 'transcript'
*
* @return
*/
private AlignmentI buildAlignment()
{
AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(FASTA,
DataSourceType.PASTE);
/*
* map gene1 sequence to chromosome (normally done when the sequence is fetched
* from Ensembl and transcripts computed)
*/
AlignmentI alignment = af.getViewport().getAlignment();
SequenceI gene1 = alignment.findName("gene1");
int[] to = new int[] { 45051610, 45051634 };
int[] from = new int[] { gene1.getStart(), gene1.getEnd() };
gene1.setGeneLoci("homo_sapiens", "GRCh38", "17",
new MapList(from, to, 1, 1));
/*
* map 'transcript1' to chromosome via 'gene1'
* transcript1/1-18 is gene1/3-10,15-24
* which is chromosome 45051612-45051619,45051624-45051633
*/
to = new int[] { 45051612, 45051619, 45051624, 45051633 };
SequenceI transcript1 = alignment.findName("transcript1");
from = new int[] { transcript1.getStart(), transcript1.getEnd() };
transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17",
new MapList(from, to, 1, 1));
/*
* map gene2 to chromosome reverse strand
*/
SequenceI gene2 = alignment.findName("gene2");
to = new int[] { 45051634, 45051610 };
from = new int[] { gene2.getStart(), gene2.getEnd() };
gene2.setGeneLoci("homo_sapiens", "GRCh38", "17",
new MapList(from, to, 1, 1));
/*
* map 'transcript2' to chromosome via 'gene2'
* transcript2/1-18 is gene2/2-11,16-23
* which is chromosome 45051633-45051624,45051619-45051612
*/
to = new int[] { 45051633, 45051624, 45051619, 45051612 };
SequenceI transcript2 = alignment.findName("transcript2");
from = new int[] { transcript2.getStart(), transcript2.getEnd() };
transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17",
new MapList(from, to, 1, 1));
/*
* add a protein product as a DBRef on transcript1
*/
SequenceI peptide1 = new Sequence("ENSP001", "SWRECD");
MapList mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 },
3, 1);
Mapping map = new Mapping(peptide1, mapList);
DBRefEntry product = new DBRefEntry("", "", "ENSP001", map);
transcript1.addDBRef(product);
/*
* add a protein product as a DBRef on transcript2
*/
SequenceI peptide2 = new Sequence("ENSP002", "VTLSPA");
mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
map = new Mapping(peptide2, mapList);
product = new DBRefEntry("", "", "ENSP002", map);
transcript2.addDBRef(product);
/*
* map gene3 to chromosome
*/
SequenceI gene3 = alignment.findName("gene3");
to = new int[] { 45051610, 45051634 };
from = new int[] { gene3.getStart(), gene3.getEnd() };
gene3.setGeneLoci("homo_sapiens", "GRCh38", "5",
new MapList(from, to, 1, 1));
/*
* map 'transcript3' to chromosome
*/
SequenceI transcript3 = alignment.findName("transcript3");
to = new int[] { 45051612, 45051619, 45051624, 45051633 };
from = new int[] { transcript3.getStart(), transcript3.getEnd() };
transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5",
new MapList(from, to, 1, 1));
/*
* map 'transcript4' to chromosome
*/
SequenceI transcript4 = alignment.findName("transcript4");
to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634,
45051634 };
from = new int[] { transcript4.getStart(), transcript4.getEnd() };
transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5",
new MapList(from, to, 1, 1));
/*
* add a protein product as a DBRef on transcript3
*/
SequenceI peptide3 = new Sequence("ENSP003", "SWRECD");
mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1);
map = new Mapping(peptide3, mapList);
product = new DBRefEntry("", "", "ENSP003", map);
transcript3.addDBRef(product);
return alignment;
}
/**
* Test with 'gene' and 'transcript' mapped to the reverse strand of the
* chromosome. The VCF variant positions (in forward coordinates) should get
* correctly located on sequence positions.
*
* @throws IOException
*/
@Test(groups = "Functional")
public void testDoLoad_reverseStrand() throws IOException
{
AlignmentI al = buildAlignment();
File f = makeVcfFile();
VCFLoader loader = new VCFLoader(f.getPath());
loader.doLoad(al.getSequencesArray(), null);
/*
* verify variant feature(s) added to gene2
* gene2/1-25 maps to chromosome 45051634- reverse strand
*/
List geneFeatures = al.getSequenceAt(2)
.getSequenceFeatures();
SequenceFeatures.sortFeatures(geneFeatures, true);
assertEquals(geneFeatures.size(), 5);
SequenceFeature sf;
/*
* insertion G/GA at 45051613 maps to an insertion at
* the preceding position (21) on reverse strand gene
* reference: CAAGC -> GCTTG/21-25
* genomic variant: CAAGAC (G/GA)
* gene variant: GTCTTG (G/GT at 21)
*/
sf = geneFeatures.get(1);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 21);
assertEquals(sf.getEnd(), 21);
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getScore(), 0f);
assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
DELTA);
/*
* variant G/C at 45051613 maps to C/G at gene position 22
*/
sf = geneFeatures.get(2);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 22);
assertEquals(sf.getEnd(), 22);
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getScore(), 0f);
assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
DELTA);
/*
* variant A/C at 45051611 maps to T/G at gene position 24
*/
sf = geneFeatures.get(3);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 24);
assertEquals(sf.getEnd(), 24);
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getScore(), 0f);
assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G");
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 4.0e-03,
DELTA);
/*
* variant A/T at 45051611 maps to T/A at gene position 24
*/
sf = geneFeatures.get(4);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 24);
assertEquals(sf.getEnd(), 24);
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getScore(), 0f);
assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A");
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03,
DELTA);
/*
* verify 3 variant features added to transcript2
*/
List transcriptFeatures = al.getSequenceAt(3)
.getSequenceFeatures();
assertEquals(transcriptFeatures.size(), 3);
/*
* insertion G/GT at position 21 of gene maps to position 16 of transcript
*/
sf = transcriptFeatures.get(1);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 16);
assertEquals(sf.getEnd(), 16);
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getScore(), 0f);
assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT");
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03,
DELTA);
/*
* SNP C/G at position 22 of gene maps to position 17 of transcript
*/
sf = transcriptFeatures.get(2);
assertEquals(sf.getFeatureGroup(), "VCF");
assertEquals(sf.getBegin(), 17);
assertEquals(sf.getEnd(), 17);
assertEquals(sf.getType(), SEQUENCE_VARIANT);
assertEquals(sf.getScore(), 0f);
assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G");
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03,
DELTA);
/*
* verify variant feature(s) computed and added to protein
* last codon GCT varies to GGT giving A/G in the last peptide position
*/
List dbRefs = al.getSequenceAt(3).getDBRefs();
SequenceI peptide = null;
for (DBRefEntry dbref : dbRefs)
{
if (dbref.getMap().getMap().getFromRatio() == 3)
{
peptide = dbref.getMap().getTo();
}
}
List proteinFeatures = peptide.getSequenceFeatures();
/*
* JAL-3187 don't precompute protein features, do dynamically instead
*/
assertTrue(proteinFeatures.isEmpty());
}
/**
* Tests that if VEP consequence (CSQ) data is present in the VCF data, then
* it is added to the variant feature, but restricted where possible to the
* consequences for a specific transcript
*
* @throws IOException
*/
@Test(groups = "Functional")
public void testDoLoad_vepCsq() throws IOException
{
AlignmentI al = buildAlignment();
VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf.vcf");
/*
* VCF data file with variants at gene3 positions
* 1 C/A
* 5 C/T
* 9 CGT/C (deletion)
* 13 C/G, C/T
* 17 A/AC (insertion), A/G
*/
loader.doLoad(al.getSequencesArray(), null);
/*
* verify variant feature(s) added to gene3
*/
List geneFeatures = al.findName("gene3")
.getSequenceFeatures();
SequenceFeatures.sortFeatures(geneFeatures, true);
assertEquals(geneFeatures.size(), 7);
SequenceFeature sf = geneFeatures.get(0);
assertEquals(sf.getBegin(), 1);
assertEquals(sf.getEnd(), 1);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.1f, DELTA);
assertEquals(sf.getValue("alleles"), "C,A");
// gene features include Consequence for all transcripts
Map map = (Map) sf.getValue("CSQ");
assertEquals(map.size(), 9);
assertEquals(map.get("PolyPhen"), "Bad");
sf = geneFeatures.get(1);
assertEquals(sf.getBegin(), 5);
assertEquals(sf.getEnd(), 5);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA);
assertEquals(sf.getValue("alleles"), "C,T");
map = (Map) sf.getValue("CSQ");
assertEquals(map.size(), 9);
assertEquals(map.get("PolyPhen"), "Bad;;"); // %3B%3B decoded
sf = geneFeatures.get(2);
assertEquals(sf.getBegin(), 9);
assertEquals(sf.getEnd(), 11); // deletion over 3 positions
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.3f, DELTA);
assertEquals(sf.getValue("alleles"), "CGG,C");
map = (Map) sf.getValue("CSQ");
assertEquals(map.size(), 9);
sf = geneFeatures.get(3);
assertEquals(sf.getBegin(), 13);
assertEquals(sf.getEnd(), 13);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA);
assertEquals(sf.getValue("alleles"), "C,T");
map = (Map) sf.getValue("CSQ");
assertEquals(map.size(), 9);
sf = geneFeatures.get(4);
assertEquals(sf.getBegin(), 13);
assertEquals(sf.getEnd(), 13);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA);
assertEquals(sf.getValue("alleles"), "C,G");
map = (Map) sf.getValue("CSQ");
assertEquals(map.size(), 9);
sf = geneFeatures.get(5);
assertEquals(sf.getBegin(), 17);
assertEquals(sf.getEnd(), 17);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
assertEquals(sf.getValue("alleles"), "A,G");
map = (Map) sf.getValue("CSQ");
assertEquals(map.size(), 9);
sf = geneFeatures.get(6);
assertEquals(sf.getBegin(), 17);
assertEquals(sf.getEnd(), 17); // insertion
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
assertEquals(sf.getValue("alleles"), "A,AC");
map = (Map) sf.getValue("CSQ");
assertEquals(map.size(), 9);
/*
* verify variant feature(s) added to transcript3
* at columns 5 (1), 17 (2), positions 3, 11
* note the deletion at columns 9-11 is not transferred since col 11
* has no mapping to transcript 3
*/
List transcriptFeatures = al.findName("transcript3")
.getSequenceFeatures();
SequenceFeatures.sortFeatures(transcriptFeatures, true);
assertEquals(transcriptFeatures.size(), 3);
sf = transcriptFeatures.get(0);
assertEquals(sf.getBegin(), 3);
assertEquals(sf.getEnd(), 3);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA);
assertEquals(sf.getValue("alleles"), "C,T");
// transcript features only have Consequence for that transcripts
map = (Map) sf.getValue("CSQ");
assertEquals(map.size(), 9);
assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
sf = transcriptFeatures.get(1);
assertEquals(sf.getBegin(), 11);
assertEquals(sf.getEnd(), 11);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
assertEquals(sf.getValue("alleles"), "A,G");
assertEquals(map.size(), 9);
assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
sf = transcriptFeatures.get(2);
assertEquals(sf.getBegin(), 11);
assertEquals(sf.getEnd(), 11);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
assertEquals(sf.getValue("alleles"), "A,AC");
assertEquals(map.size(), 9);
assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3");
/*
* verify variants computed on protein product for transcript3
* peptide is SWRECD
* codon variants are AGC/AGT position 1 which is synonymous
* and GAG/GGG which is E/G in position 4
* the insertion variant is not transferred to the peptide
*/
List dbRefs = al.findName("transcript3").getDBRefs();
SequenceI peptide = null;
for (DBRefEntry dbref : dbRefs)
{
if (dbref.getMap().getMap().getFromRatio() == 3)
{
peptide = dbref.getMap().getTo();
}
}
List proteinFeatures = peptide.getSequenceFeatures();
/*
* JAL-3187 don't precompute protein features, do dynamically instead
*/
assertTrue(proteinFeatures.isEmpty());
// SequenceFeatures.sortFeatures(proteinFeatures, true);
// assertEquals(proteinFeatures.size(), 2);
// sf = proteinFeatures.get(0);
// assertEquals(sf.getFeatureGroup(), "VCF");
// assertEquals(sf.getBegin(), 1);
// assertEquals(sf.getEnd(), 1);
// assertEquals(sf.getType(), SequenceOntologyI.SYNONYMOUS_VARIANT);
// assertEquals(sf.getDescription(), "agC/agT");
// sf = proteinFeatures.get(1);
// assertEquals(sf.getFeatureGroup(), "VCF");
// assertEquals(sf.getBegin(), 4);
// assertEquals(sf.getEnd(), 4);
// assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT);
// assertEquals(sf.getDescription(), "p.Glu4Gly");
/*
* verify variant feature(s) added to transcript4
* at columns 13 (2) and 17 (2), positions 7 and 11
*/
transcriptFeatures = al.findName("transcript4").getSequenceFeatures();
SequenceFeatures.sortFeatures(transcriptFeatures, true);
assertEquals(transcriptFeatures.size(), 4);
sf = transcriptFeatures.get(0);
assertEquals(sf.getBegin(), 7);
assertEquals(sf.getEnd(), 7);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA);
assertEquals(sf.getValue("alleles"), "C,T");
assertEquals(map.size(), 9);
assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
sf = transcriptFeatures.get(1);
assertEquals(sf.getBegin(), 7);
assertEquals(sf.getEnd(), 7);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA);
assertEquals(sf.getValue("alleles"), "C,G");
assertEquals(map.size(), 9);
assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
sf = transcriptFeatures.get(2);
assertEquals(sf.getBegin(), 11);
assertEquals(sf.getEnd(), 11);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA);
assertEquals(sf.getValue("alleles"), "A,G");
assertEquals(map.size(), 9);
assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
sf = transcriptFeatures.get(3);
assertEquals(sf.getBegin(), 11);
assertEquals(sf.getEnd(), 11);
assertEquals(sf.getScore(), 0f);
assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA);
assertEquals(sf.getValue("alleles"), "A,AC");
assertEquals(map.size(), 9);
assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4");
}
/**
* A test that demonstrates loading a contig sequence from an indexed sequence
* database which is the reference for a VCF file
*
* @throws IOException
*/
@Test(groups = "Functional")
public void testLoadVCFContig() throws IOException
{
VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf2.vcf");
SequenceI seq = loader.loadVCFContig("contig123");
assertEquals(seq.getLength(), 15);
assertEquals(seq.getSequenceAsString(), "AAAAACCCCCGGGGG");
List features = seq.getSequenceFeatures();
SequenceFeatures.sortFeatures(features, true);
assertEquals(features.size(), 2);
SequenceFeature sf = features.get(0);
assertEquals(sf.getBegin(), 8);
assertEquals(sf.getEnd(), 8);
assertEquals(sf.getDescription(), "C,A");
sf = features.get(1);
assertEquals(sf.getBegin(), 12);
assertEquals(sf.getEnd(), 12);
assertEquals(sf.getDescription(), "G,T");
seq = loader.loadVCFContig("contig789");
assertEquals(seq.getLength(), 25);
assertEquals(seq.getSequenceAsString(), "GGGGGTTTTTAAAAACCCCCGGGGG");
features = seq.getSequenceFeatures();
SequenceFeatures.sortFeatures(features, true);
assertEquals(features.size(), 2);
sf = features.get(0);
assertEquals(sf.getBegin(), 2);
assertEquals(sf.getEnd(), 2);
assertEquals(sf.getDescription(), "G,T");
sf = features.get(1);
assertEquals(sf.getBegin(), 21);
assertEquals(sf.getEnd(), 21);
assertEquals(sf.getDescription(), "G,A");
seq = loader.loadVCFContig("contig456");
assertEquals(seq.getLength(), 20);
assertEquals(seq.getSequenceAsString(), "CCCCCGGGGGTTTTTAAAAA");
features = seq.getSequenceFeatures();
SequenceFeatures.sortFeatures(features, true);
assertEquals(features.size(), 1);
sf = features.get(0);
assertEquals(sf.getBegin(), 15);
assertEquals(sf.getEnd(), 15);
assertEquals(sf.getDescription(), "T,C");
}
}