package jalview.io.vcf; import static org.testng.Assert.assertEquals; import jalview.bin.Cache; import jalview.datamodel.AlignmentI; import jalview.datamodel.DBRefEntry; import jalview.datamodel.Mapping; import jalview.datamodel.Sequence; import jalview.datamodel.SequenceFeature; import jalview.datamodel.SequenceI; import jalview.datamodel.features.SequenceFeatures; import jalview.gui.AlignFrame; import jalview.io.DataSourceType; import jalview.io.FileLoader; import jalview.io.gff.Gff3Helper; import jalview.io.gff.SequenceOntologyI; import jalview.util.MapList; import java.io.File; import java.io.IOException; import java.io.PrintWriter; import java.util.List; import java.util.Map; import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; public class VCFLoaderTest { private static final float DELTA = 0.00001f; // columns 9717- of gene P30419 from Ensembl (much modified) private static final String FASTA = "" + /* * forward strand 'gene' and 'transcript' with two exons */ ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n" + "CAAGCTGGCGGACGAGAGTGTGACA\n" + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n" /* * reverse strand gene and transcript (reverse complement alleles!) */ + ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n" + "TGTCACACTCTCGTCCGCCAGCTTG\n" + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n" /* * 'gene' on chromosome 5 with two transcripts */ + ">gene3/1-25 chromosome:GRCh38:5:45051610:45051634:1\n" + "CAAGCTGGCGGACGAGAGTGTGACA\n" + ">transcript3/1-18\n--AGCTGGCG----AGAGTGTGAC-\n" + ">transcript4/1-18\n-----TGG-GGACGAGAGTGTGA-A\n"; private static final String[] VCF = { "##fileformat=VCFv4.2", "##INFO=", "##reference=Homo_sapiens/GRCh38", "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO", // A/T,C variants in position 2 of gene sequence (precedes transcript) // should create 2 variant features with respective scores "17\t45051611\t.\tA\tT,C\t1666.64\tRF\tAC=15;AF=5.0e-03,4.0e-03", // SNP G/C in position 4 of gene sequence, position 2 of transcript // insertion G/GA is transferred to nucleotide but not to peptide "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.0e-03,2.0e-03" }; @BeforeClass(alwaysRun = true) public void setUp() { /* * configure to capture all available VCF and VEP (CSQ) fields */ Cache.loadProperties("test/jalview/io/testProps.jvprops"); Cache.setProperty("VCF_FIELDS", ".*"); Cache.setProperty("VEP_FIELDS", ".*"); Cache.initLogger(); } @Test(groups = "Functional") public void testDoLoad() throws IOException { AlignmentI al = buildAlignment(); File f = makeVcf(); VCFLoader loader = new VCFLoader(f.getPath()); loader.doLoad(al.getSequencesArray(), null); /* * verify variant feature(s) added to gene * NB alleles at a locus may not be processed, and features added, * in the order in which they appear in the VCF record as method * VariantContext.getAlternateAlleles() does not guarantee order * - order of assertions here matches what we find (is not important) */ List geneFeatures = al.getSequenceAt(0) .getSequenceFeatures(); SequenceFeatures.sortFeatures(geneFeatures, true); assertEquals(geneFeatures.size(), 4); SequenceFeature sf = geneFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 2); assertEquals(sf.getEnd(), 2); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 4.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,C"); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); sf = geneFeatures.get(1); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 2); assertEquals(sf.getEnd(), 2); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T"); sf = geneFeatures.get(2); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 4); assertEquals(sf.getEnd(), 4); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C"); sf = geneFeatures.get(3); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 4); assertEquals(sf.getEnd(), 4); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA"); /* * verify variant feature(s) added to transcript */ List transcriptFeatures = al.getSequenceAt(1) .getSequenceFeatures(); assertEquals(transcriptFeatures.size(), 2); sf = transcriptFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 2); assertEquals(sf.getEnd(), 2); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C"); sf = transcriptFeatures.get(1); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 2); assertEquals(sf.getEnd(), 2); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GA"); /* * verify SNP variant feature(s) computed and added to protein * first codon AGC varies to ACC giving S/T */ List dbRefs = al.getSequenceAt(1).getDBRefs(); SequenceI peptide = null; for (DBRefEntry dbref : dbRefs) { if (dbref.getMap().getMap().getFromRatio() == 3) { peptide = dbref.getMap().getTo(); } } List proteinFeatures = peptide.getSequenceFeatures(); assertEquals(proteinFeatures.size(), 1); sf = proteinFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 1); assertEquals(sf.getEnd(), 1); assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT); assertEquals(sf.getDescription(), "p.Ser1Thr"); } private File makeVcf() throws IOException { File f = File.createTempFile("Test", ".vcf"); f.deleteOnExit(); PrintWriter pw = new PrintWriter(f); for (String vcfLine : VCF) { pw.println(vcfLine); } pw.close(); return f; } /** * Make a simple alignment with one 'gene' and one 'transcript' * * @return */ private AlignmentI buildAlignment() { AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(FASTA, DataSourceType.PASTE); /* * map gene1 sequence to chromosome (normally done when the sequence is fetched * from Ensembl and transcripts computed) */ AlignmentI alignment = af.getViewport().getAlignment(); SequenceI gene1 = alignment.findName("gene1"); int[] to = new int[] { 45051610, 45051634 }; int[] from = new int[] { gene1.getStart(), gene1.getEnd() }; gene1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to, 1, 1)); /* * map 'transcript1' to chromosome via 'gene1' * transcript1/1-18 is gene1/3-10,15-24 * which is chromosome 45051612-45051619,45051624-45051633 */ to = new int[] { 45051612, 45051619, 45051624, 45051633 }; SequenceI transcript1 = alignment.findName("transcript1"); from = new int[] { transcript1.getStart(), transcript1.getEnd() }; transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList( from, to, 1, 1)); /* * map gene2 to chromosome reverse strand */ SequenceI gene2 = alignment.findName("gene2"); to = new int[] { 45051634, 45051610 }; from = new int[] { gene2.getStart(), gene2.getEnd() }; gene2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to, 1, 1)); /* * map 'transcript2' to chromosome via 'gene2' * transcript2/1-18 is gene2/2-11,16-23 * which is chromosome 45051633-45051624,45051619-45051612 */ to = new int[] { 45051633, 45051624, 45051619, 45051612 }; SequenceI transcript2 = alignment.findName("transcript2"); from = new int[] { transcript2.getStart(), transcript2.getEnd() }; transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList( from, to, 1, 1)); /* * add a protein product as a DBRef on transcript1 */ SequenceI peptide1 = new Sequence("ENSP001", "SWRECD"); MapList mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1); Mapping map = new Mapping(peptide1, mapList); DBRefEntry product = new DBRefEntry("", "", "ENSP001", map); transcript1.addDBRef(product); /* * add a protein product as a DBRef on transcript2 */ SequenceI peptide2 = new Sequence("ENSP002", "VTLSPA"); mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1); map = new Mapping(peptide2, mapList); product = new DBRefEntry("", "", "ENSP002", map); transcript2.addDBRef(product); /* * map gene3 to chromosome */ SequenceI gene3 = alignment.findName("gene3"); to = new int[] { 45051610, 45051634 }; from = new int[] { gene3.getStart(), gene3.getEnd() }; gene3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(from, to, 1, 1)); /* * map 'transcript3' to chromosome */ SequenceI transcript3 = alignment.findName("transcript3"); to = new int[] { 45051612, 45051619, 45051624, 45051633 }; from = new int[] { transcript3.getStart(), transcript3.getEnd() }; transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList( from, to, 1, 1)); /* * map 'transcript4' to chromosome */ SequenceI transcript4 = alignment.findName("transcript4"); to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634, 45051634 }; from = new int[] { transcript4.getStart(), transcript4.getEnd() }; transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList( from, to, 1, 1)); /* * add a protein product as a DBRef on transcript3 */ SequenceI peptide3 = new Sequence("ENSP003", "SWRECD"); mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1); map = new Mapping(peptide3, mapList); product = new DBRefEntry("", "", "ENSP003", map); transcript3.addDBRef(product); return alignment; } /** * Test with 'gene' and 'transcript' mapped to the reverse strand of the * chromosome. The VCF variant positions (in forward coordinates) should get * correctly located on sequence positions. * * @throws IOException */ @Test(groups = "Functional") public void testDoLoad_reverseStrand() throws IOException { AlignmentI al = buildAlignment(); File f = makeVcf(); VCFLoader loader = new VCFLoader(f.getPath()); loader.doLoad(al.getSequencesArray(), null); /* * verify variant feature(s) added to gene2 * gene2/1-25 maps to chromosome 45051634- reverse strand */ List geneFeatures = al.getSequenceAt(2) .getSequenceFeatures(); SequenceFeatures.sortFeatures(geneFeatures, true); assertEquals(geneFeatures.size(), 4); /* * variant A/T at 45051611 maps to T/A at gene position 24 */ SequenceFeature sf = geneFeatures.get(3); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 24); assertEquals(sf.getEnd(), 24); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 5.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A"); /* * variant A/C at 45051611 maps to T/G at gene position 24 */ sf = geneFeatures.get(2); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 24); assertEquals(sf.getEnd(), 24); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 4.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G"); /* * variant G/C at 45051613 maps to C/G at gene position 22 */ sf = geneFeatures.get(1); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 22); assertEquals(sf.getEnd(), 22); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G"); /* * insertion G/GA at 45051613 maps to an insertion at * the preceding position (21) on reverse strand gene * reference: CAAGC -> GCTTG/21-25 * genomic variant: CAAGAC (G/GA) * gene variant: GTCTTG (G/GT at 21) */ sf = geneFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 21); assertEquals(sf.getEnd(), 21); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT"); /* * verify 2 variant features added to transcript2 */ List transcriptFeatures = al.getSequenceAt(3) .getSequenceFeatures(); assertEquals(transcriptFeatures.size(), 2); /* * insertion G/GT at position 21 of gene maps to position 16 of transcript */ sf = transcriptFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 16); assertEquals(sf.getEnd(), 16); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 3.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT"); /* * SNP C/G at position 22 of gene maps to position 17 of transcript */ sf = transcriptFeatures.get(1); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 17); assertEquals(sf.getEnd(), 17); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 2.0e-03, DELTA); assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G"); /* * verify variant feature(s) computed and added to protein * last codon GCT varies to GGT giving A/G in the last peptide position */ List dbRefs = al.getSequenceAt(3).getDBRefs(); SequenceI peptide = null; for (DBRefEntry dbref : dbRefs) { if (dbref.getMap().getMap().getFromRatio() == 3) { peptide = dbref.getMap().getTo(); } } List proteinFeatures = peptide.getSequenceFeatures(); assertEquals(proteinFeatures.size(), 1); sf = proteinFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 6); assertEquals(sf.getEnd(), 6); assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT); assertEquals(sf.getDescription(), "p.Ala6Gly"); } /** * Tests that if VEP consequence (CSQ) data is present in the VCF data, then * it is added to the variant feature, but restricted where possible to the * consequences for a specific transcript * * @throws IOException */ @Test(groups = "Functional") public void testDoLoad_vepCsq() throws IOException { AlignmentI al = buildAlignment(); VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf.vcf"); /* * VCF data file with variants at gene3 positions * 1 C/A * 5 C/T * 9 CGT/C (deletion) * 13 C/G, C/T * 17 A/AC (insertion), A/G */ loader.doLoad(al.getSequencesArray(), null); /* * verify variant feature(s) added to gene3 */ List geneFeatures = al.findName("gene3") .getSequenceFeatures(); SequenceFeatures.sortFeatures(geneFeatures, true); assertEquals(geneFeatures.size(), 7); SequenceFeature sf = geneFeatures.get(0); assertEquals(sf.getBegin(), 1); assertEquals(sf.getEnd(), 1); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.1f, DELTA); assertEquals(sf.getValue("alleles"), "C,A"); // gene features include Consequence for all transcripts Map map = (Map) sf.getValue("CSQ"); assertEquals(map.size(), 9); sf = geneFeatures.get(1); assertEquals(sf.getBegin(), 5); assertEquals(sf.getEnd(), 5); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA); assertEquals(sf.getValue("alleles"), "C,T"); map = (Map) sf.getValue("CSQ"); assertEquals(map.size(), 9); sf = geneFeatures.get(2); assertEquals(sf.getBegin(), 9); assertEquals(sf.getEnd(), 11); // deletion over 3 positions assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.3f, DELTA); assertEquals(sf.getValue("alleles"), "CGG,C"); map = (Map) sf.getValue("CSQ"); assertEquals(map.size(), 9); sf = geneFeatures.get(3); assertEquals(sf.getBegin(), 13); assertEquals(sf.getEnd(), 13); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA); assertEquals(sf.getValue("alleles"), "C,T"); map = (Map) sf.getValue("CSQ"); assertEquals(map.size(), 9); sf = geneFeatures.get(4); assertEquals(sf.getBegin(), 13); assertEquals(sf.getEnd(), 13); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA); assertEquals(sf.getValue("alleles"), "C,G"); map = (Map) sf.getValue("CSQ"); assertEquals(map.size(), 9); sf = geneFeatures.get(5); assertEquals(sf.getBegin(), 17); assertEquals(sf.getEnd(), 17); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA); assertEquals(sf.getValue("alleles"), "A,G"); map = (Map) sf.getValue("CSQ"); assertEquals(map.size(), 9); sf = geneFeatures.get(6); assertEquals(sf.getBegin(), 17); assertEquals(sf.getEnd(), 17); // insertion assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA); assertEquals(sf.getValue("alleles"), "A,AC"); map = (Map) sf.getValue("CSQ"); assertEquals(map.size(), 9); /* * verify variant feature(s) added to transcript3 * at columns 5 (1), 17 (2), positions 3, 11 * note the deletion at columns 9-11 is not transferred since col 11 * has no mapping to transcript 3 */ List transcriptFeatures = al.findName("transcript3") .getSequenceFeatures(); SequenceFeatures.sortFeatures(transcriptFeatures, true); assertEquals(transcriptFeatures.size(), 3); sf = transcriptFeatures.get(0); assertEquals(sf.getBegin(), 3); assertEquals(sf.getEnd(), 3); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.2f, DELTA); assertEquals(sf.getValue("alleles"), "C,T"); // transcript features only have Consequence for that transcripts map = (Map) sf.getValue("CSQ"); assertEquals(map.size(), 9); assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3"); sf = transcriptFeatures.get(1); assertEquals(sf.getBegin(), 11); assertEquals(sf.getEnd(), 11); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA); assertEquals(sf.getValue("alleles"), "A,G"); assertEquals(map.size(), 9); assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3"); sf = transcriptFeatures.get(2); assertEquals(sf.getBegin(), 11); assertEquals(sf.getEnd(), 11); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA); assertEquals(sf.getValue("alleles"), "A,AC"); assertEquals(map.size(), 9); assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3"); /* * verify variants computed on protein product for transcript3 * peptide is SWRECD * codon variants are AGC/AGT position 1 which is synonymous * and GAG/GGG which is E/G in position 4 * the insertion variant is not transferred to the peptide */ List dbRefs = al.findName("transcript3").getDBRefs(); SequenceI peptide = null; for (DBRefEntry dbref : dbRefs) { if (dbref.getMap().getMap().getFromRatio() == 3) { peptide = dbref.getMap().getTo(); } } List proteinFeatures = peptide.getSequenceFeatures(); SequenceFeatures.sortFeatures(proteinFeatures, true); assertEquals(proteinFeatures.size(), 2); sf = proteinFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 1); assertEquals(sf.getEnd(), 1); assertEquals(sf.getType(), SequenceOntologyI.SYNONYMOUS_VARIANT); assertEquals(sf.getDescription(), "agC/agT"); sf = proteinFeatures.get(1); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 4); assertEquals(sf.getEnd(), 4); assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT); assertEquals(sf.getDescription(), "p.Glu4Gly"); /* * verify variant feature(s) added to transcript4 * at columns 13 (2) and 17 (2), positions 7 and 11 */ transcriptFeatures = al.findName("transcript4").getSequenceFeatures(); SequenceFeatures.sortFeatures(transcriptFeatures, true); assertEquals(transcriptFeatures.size(), 4); sf = transcriptFeatures.get(0); assertEquals(sf.getBegin(), 7); assertEquals(sf.getEnd(), 7); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.5f, DELTA); assertEquals(sf.getValue("alleles"), "C,T"); assertEquals(map.size(), 9); assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4"); sf = transcriptFeatures.get(1); assertEquals(sf.getBegin(), 7); assertEquals(sf.getEnd(), 7); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.4f, DELTA); assertEquals(sf.getValue("alleles"), "C,G"); assertEquals(map.size(), 9); assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4"); sf = transcriptFeatures.get(2); assertEquals(sf.getBegin(), 11); assertEquals(sf.getEnd(), 11); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.7f, DELTA); assertEquals(sf.getValue("alleles"), "A,G"); assertEquals(map.size(), 9); assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4"); sf = transcriptFeatures.get(3); assertEquals(sf.getBegin(), 11); assertEquals(sf.getEnd(), 11); assertEquals(sf.getScore(), 0f); assertEquals(Float.parseFloat((String) sf.getValue("AF")), 0.6f, DELTA); assertEquals(sf.getValue("alleles"), "A,AC"); assertEquals(map.size(), 9); assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4"); } /** * A test that demonstrates loading a contig sequence from an indexed sequence * database which is the reference for a VCF file * * @throws IOException */ @Test(groups = "Functional") public void testLoadVCFContig() throws IOException { VCFLoader loader = new VCFLoader( "test/jalview/io/vcf/testVcf2.vcf"); SequenceI seq = loader.loadVCFContig("contig123"); assertEquals(seq.getLength(), 15); assertEquals(seq.getSequenceAsString(), "AAAAACCCCCGGGGG"); List features = seq.getSequenceFeatures(); SequenceFeatures.sortFeatures(features, true); assertEquals(features.size(), 2); SequenceFeature sf = features.get(0); assertEquals(sf.getBegin(), 8); assertEquals(sf.getEnd(), 8); assertEquals(sf.getDescription(), "C,A"); sf = features.get(1); assertEquals(sf.getBegin(), 12); assertEquals(sf.getEnd(), 12); assertEquals(sf.getDescription(), "G,T"); seq = loader.loadVCFContig("contig789"); assertEquals(seq.getLength(), 25); assertEquals(seq.getSequenceAsString(), "GGGGGTTTTTAAAAACCCCCGGGGG"); features = seq.getSequenceFeatures(); SequenceFeatures.sortFeatures(features, true); assertEquals(features.size(), 2); sf = features.get(0); assertEquals(sf.getBegin(), 2); assertEquals(sf.getEnd(), 2); assertEquals(sf.getDescription(), "G,T"); sf = features.get(1); assertEquals(sf.getBegin(), 21); assertEquals(sf.getEnd(), 21); assertEquals(sf.getDescription(), "G,A"); seq = loader.loadVCFContig("contig456"); assertEquals(seq.getLength(), 20); assertEquals(seq.getSequenceAsString(), "CCCCCGGGGGTTTTTAAAAA"); features = seq.getSequenceFeatures(); SequenceFeatures.sortFeatures(features, true); assertEquals(features.size(), 1); sf = features.get(0); assertEquals(sf.getBegin(), 15); assertEquals(sf.getEnd(), 15); assertEquals(sf.getDescription(), "T,C"); } }