package jalview.io.vcf; import static org.testng.Assert.assertEquals; import jalview.datamodel.AlignmentI; import jalview.datamodel.DBRefEntry; import jalview.datamodel.Mapping; import jalview.datamodel.Sequence; import jalview.datamodel.SequenceFeature; import jalview.datamodel.SequenceI; import jalview.gui.AlignFrame; import jalview.io.DataSourceType; import jalview.io.FileLoader; import jalview.io.gff.Gff3Helper; import jalview.io.gff.SequenceOntologyI; import jalview.util.MapList; import java.io.File; import java.io.IOException; import java.io.PrintWriter; import java.util.List; import org.testng.annotations.Test; public class VCFLoaderTest { // columns 9717- of gene P30419 from Ensembl (modified) private static final String FASTA = // forward strand 'gene' ">gene1/1-25 chromosome:GRCh38:17:45051610:45051634:1\n" + "CAAGCTGGCGGACGAGAGTGTGACA\n" // and a 'made up' mini-transcript with two exons + ">transcript1/1-18\n--AGCTGGCG----AGAGTGTGAC-\n" + // 'reverse strand' gene (reverse complement) ">gene2/1-25 chromosome:GRCh38:17:45051610:45051634:-1\n" + "TGTCACACTCTCGTCCGCCAGCTTG\n" // and its 'transcript' + ">transcript2/1-18\n" + "-GTCACACTCT----CGCCAGCT--\n"; private static final String[] VCF = { "##fileformat=VCFv4.2", "##INFO=", "##reference=GRCh38", "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO", // SNP A/T in position 2 of gene sequence (precedes transcript) "17\t45051611\t.\tA\tT\t1666.64\tRF\tAC=15;AF=5.08130e-03", // SNP G/C in position 4 of gene sequence, position 2 of transcript // this is a mixed variant, the insertion G/GA is not transferred "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.08130e-03" }; @Test(groups = "Functional") public void testLoadVCF() throws IOException { AlignmentI al = buildAlignment(); VCFLoader loader = new VCFLoader(al); File f = makeVcf(); loader.loadVCF(f.getPath(), null); /* * verify variant feature(s) added to gene */ List geneFeatures = al.getSequenceAt(0) .getSequenceFeatures(); assertEquals(geneFeatures.size(), 2); SequenceFeature sf = geneFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 2); assertEquals(sf.getEnd(), 2); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 5.08130e-03, 0.000001f); assertEquals(sf.getValue(Gff3Helper.ALLELES), "A,T"); sf = geneFeatures.get(1); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 4); assertEquals(sf.getEnd(), 4); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 3.08130e-03, 0.000001f); assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C"); /* * verify variant feature(s) added to transcript */ List transcriptFeatures = al.getSequenceAt(1) .getSequenceFeatures(); assertEquals(transcriptFeatures.size(), 1); sf = transcriptFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 2); assertEquals(sf.getEnd(), 2); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 3.08130e-03, 0.000001f); assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,C"); /* * verify variant feature(s) computed and added to protein * first codon AGC varies to ACC giving S/T */ DBRefEntry[] dbRefs = al.getSequenceAt(1).getDBRefs(); SequenceI peptide = null; for (DBRefEntry dbref : dbRefs) { if (dbref.getMap().getMap().getFromRatio() == 3) { peptide = dbref.getMap().getTo(); } } List proteinFeatures = peptide.getSequenceFeatures(); assertEquals(proteinFeatures.size(), 1); sf = proteinFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 1); assertEquals(sf.getEnd(), 1); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getDescription(), "p.Ser1Thr"); } private File makeVcf() throws IOException { File f = File.createTempFile("Test", ".vcf"); f.deleteOnExit(); PrintWriter pw = new PrintWriter(f); for (String vcfLine : VCF) { pw.println(vcfLine); } pw.close(); return f; } /** * Make a simple alignment with one 'gene' and one 'transcript' * * @return */ private AlignmentI buildAlignment() { AlignFrame af = new FileLoader().LoadFileWaitTillLoaded(FASTA, DataSourceType.PASTE); /* * map gene1 sequence to chromosome (normally done when the sequence is fetched * from Ensembl and transcripts computed) */ AlignmentI alignment = af.getViewport().getAlignment(); SequenceI gene1 = alignment.getSequenceAt(0); int[] to = new int[] { 45051610, 45051634 }; int[] from = new int[] { gene1.getStart(), gene1.getEnd() }; gene1.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1)); /* * map 'transcript1' to chromosome via 'gene1' * transcript1/1-18 is gene1/3-10,15-24 * which is chromosome 45051612-45051619,45051624-45051633 */ to = new int[] { 45051612, 45051619, 45051624, 45051633 }; SequenceI transcript1 = alignment.getSequenceAt(1); from = new int[] { transcript1.getStart(), transcript1.getEnd() }; transcript1.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1)); /* * map gene2 to chromosome reverse strand */ SequenceI gene2 = alignment.getSequenceAt(2); to = new int[] { 45051634, 45051610 }; from = new int[] { gene2.getStart(), gene2.getEnd() }; gene2.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1)); /* * map 'transcript2' to chromosome via 'gene2' * transcript2/1-18 is gene2/2-11,16-23 * which is chromosome 45051633-45051624,45051619-45051612 */ to = new int[] { 45051633, 45051624, 45051619, 45051612 }; SequenceI transcript2 = alignment.getSequenceAt(3); from = new int[] { transcript2.getStart(), transcript2.getEnd() }; transcript2.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1)); /* * add a protein product as a DBRef on transcript1 */ SequenceI peptide1 = new Sequence("ENSP001", "SWRECD"); MapList mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1); Mapping map = new Mapping(peptide1, mapList); DBRefEntry product = new DBRefEntry("", "", "ENSP001", map); transcript1.addDBRef(product); /* * add a protein product as a DBRef on transcript2 */ SequenceI peptide2 = new Sequence("ENSP002", "VTLSPA"); mapList = new MapList(new int[] { 1, 18 }, new int[] { 1, 6 }, 3, 1); map = new Mapping(peptide2, mapList); product = new DBRefEntry("", "", "ENSP002", map); transcript2.addDBRef(product); return alignment; } /** * Test with 'gene' and 'transcript' mapped to the reverse strand of the * chromosome. The VCF variant positions (in forward coordinates) should get * correctly located on sequence positions. * * @throws IOException */ @Test(groups = "Functional") public void testLoadVCF_reverseStrand() throws IOException { AlignmentI al = buildAlignment(); VCFLoader loader = new VCFLoader(al); File f = makeVcf(); loader.loadVCF(f.getPath(), null); /* * verify variant feature(s) added to gene2 * gene/1-25 maps to chromosome 45051634- reverse strand * variants A/T at 45051611 and G/C at 45051613 map to * T/A and C/G at gene positions 24 and 22 respectively */ List geneFeatures = al.getSequenceAt(2) .getSequenceFeatures(); assertEquals(geneFeatures.size(), 2); SequenceFeature sf = geneFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 22); assertEquals(sf.getEnd(), 22); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 3.08130e-03, 0.000001f); assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES)); sf = geneFeatures.get(1); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 24); assertEquals(sf.getEnd(), 24); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 5.08130e-03, 0.000001f); assertEquals("T,A", sf.getValue(Gff3Helper.ALLELES)); /* * verify variant feature(s) added to transcript2 * variant C/G at position 22 of gene overlaps and maps to * position 17 of transcript */ List transcriptFeatures = al.getSequenceAt(3) .getSequenceFeatures(); assertEquals(transcriptFeatures.size(), 1); sf = transcriptFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 17); assertEquals(sf.getEnd(), 17); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 3.08130e-03, 0.000001f); assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES)); /* * verify variant feature(s) computed and added to protein * last codon GCT varies to GGT giving A/G in the last peptide position */ DBRefEntry[] dbRefs = al.getSequenceAt(3).getDBRefs(); SequenceI peptide = null; for (DBRefEntry dbref : dbRefs) { if (dbref.getMap().getMap().getFromRatio() == 3) { peptide = dbref.getMap().getTo(); } } List proteinFeatures = peptide.getSequenceFeatures(); assertEquals(proteinFeatures.size(), 1); sf = proteinFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 6); assertEquals(sf.getEnd(), 6); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getDescription(), "p.Ala6Gly"); } }