/* * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$) * Copyright (C) $$Year-Rel$$ The Jalview Authors * * This file is part of Jalview. * * Jalview is free software: you can redistribute it and/or * modify it under the terms of the GNU General Public License * as published by the Free Software Foundation, either version 3 * of the License, or (at your option) any later version. * * Jalview is distributed in the hope that it will be useful, but * WITHOUT ANY WARRANTY; without even the implied warranty * of MERCHANTABILITY or FITNESS FOR A PARTICULAR * PURPOSE. See the GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with Jalview. If not, see . * The Jalview Authors are detailed in the 'AUTHORS' file. */ package jalview.util; import static org.testng.AssertJUnit.assertEquals; import static org.testng.AssertJUnit.assertFalse; import static org.testng.AssertJUnit.assertNull; import static org.testng.AssertJUnit.assertSame; import static org.testng.AssertJUnit.assertTrue; import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals; import java.awt.Color; import java.io.IOException; import java.util.ArrayList; import java.util.Arrays; import java.util.Iterator; import java.util.List; import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; import java.awt.Color; import java.io.IOException; import java.util.ArrayList; import java.util.Arrays; import java.util.Iterator; import java.util.List; import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; import jalview.api.AlignViewportI; import jalview.bin.Cache; import jalview.commands.EditCommand; import jalview.commands.EditCommand.Action; import jalview.commands.EditCommand.Edit; import jalview.datamodel.AlignedCodonFrame; import jalview.datamodel.Alignment; import jalview.datamodel.AlignmentI; import jalview.datamodel.ColumnSelection; import jalview.datamodel.HiddenColumns; import jalview.datamodel.SearchResultMatchI; import jalview.datamodel.SearchResultsI; import jalview.datamodel.Sequence; import jalview.datamodel.SequenceGroup; import jalview.datamodel.SequenceI; import jalview.gui.AlignViewport; import jalview.gui.JvOptionPane; import jalview.io.DataSourceType; import jalview.io.FileFormat; import jalview.io.FileFormatI; import jalview.io.FormatAdapter; public class MappingUtilsTest { @BeforeClass(alwaysRun = true) public void setUp() { Cache.initLogger(); } @BeforeClass(alwaysRun = true) public void setUpJvOptionPane() { JvOptionPane.setInteractiveMode(false); JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION); } private AlignViewportI dnaView; private AlignViewportI proteinView; /** * Simple test of mapping with no intron involved. */ @Test(groups = { "Functional" }) public void testBuildSearchResults() { final Sequence seq1 = new Sequence("Seq1/5-10", "C-G-TA-GC"); seq1.createDatasetSequence(); final Sequence aseq1 = new Sequence("Seq1/12-13", "-P-R"); aseq1.createDatasetSequence(); /* * Map dna bases 5-10 to protein residues 12-13 */ AlignedCodonFrame acf = new AlignedCodonFrame(); MapList map = new MapList(new int[] { 5, 10 }, new int[] { 12, 13 }, 3, 1); acf.addMap(seq1.getDatasetSequence(), aseq1.getDatasetSequence(), map); List acfList = Arrays .asList(new AlignedCodonFrame[] { acf }); /* * Check protein residue 12 maps to codon 5-7, 13 to codon 8-10 */ SearchResultsI sr = MappingUtils.buildSearchResults(aseq1, 12, acfList); assertEquals(1, sr.getResults().size()); SearchResultMatchI m = sr.getResults().get(0); assertEquals(seq1.getDatasetSequence(), m.getSequence()); assertEquals(5, m.getStart()); assertEquals(7, m.getEnd()); sr = MappingUtils.buildSearchResults(aseq1, 13, acfList); assertEquals(1, sr.getResults().size()); m = sr.getResults().get(0); assertEquals(seq1.getDatasetSequence(), m.getSequence()); assertEquals(8, m.getStart()); assertEquals(10, m.getEnd()); /* * Check inverse mappings, from codons 5-7, 8-10 to protein 12, 13 */ for (int i = 5; i < 11; i++) { sr = MappingUtils.buildSearchResults(seq1, i, acfList); assertEquals(1, sr.getResults().size()); m = sr.getResults().get(0); assertEquals(aseq1.getDatasetSequence(), m.getSequence()); int residue = i > 7 ? 13 : 12; assertEquals(residue, m.getStart()); assertEquals(residue, m.getEnd()); } } /** * Simple test of mapping with introns involved. */ @Test(groups = { "Functional" }) public void testBuildSearchResults_withIntron() { final Sequence seq1 = new Sequence("Seq1/5-17", "c-G-tAGa-GcAgCtt"); seq1.createDatasetSequence(); final Sequence aseq1 = new Sequence("Seq1/8-9", "-E-D"); aseq1.createDatasetSequence(); /* * Map dna bases [6, 8, 9], [11, 13, 115] to protein residues 8 and 9 */ AlignedCodonFrame acf = new AlignedCodonFrame(); MapList map = new MapList( new int[] { 6, 6, 8, 9, 11, 11, 13, 13, 15, 15 }, new int[] { 8, 9 }, 3, 1); acf.addMap(seq1.getDatasetSequence(), aseq1.getDatasetSequence(), map); List acfList = Arrays .asList(new AlignedCodonFrame[] { acf }); /* * Check protein residue 8 maps to [6, 8, 9] */ SearchResultsI sr = MappingUtils.buildSearchResults(aseq1, 8, acfList); assertEquals(2, sr.getResults().size()); SearchResultMatchI m = sr.getResults().get(0); assertEquals(seq1.getDatasetSequence(), m.getSequence()); assertEquals(6, m.getStart()); assertEquals(6, m.getEnd()); m = sr.getResults().get(1); assertEquals(seq1.getDatasetSequence(), m.getSequence()); assertEquals(8, m.getStart()); assertEquals(9, m.getEnd()); /* * Check protein residue 9 maps to [11, 13, 15] */ sr = MappingUtils.buildSearchResults(aseq1, 9, acfList); assertEquals(3, sr.getResults().size()); m = sr.getResults().get(0); assertEquals(seq1.getDatasetSequence(), m.getSequence()); assertEquals(11, m.getStart()); assertEquals(11, m.getEnd()); m = sr.getResults().get(1); assertEquals(seq1.getDatasetSequence(), m.getSequence()); assertEquals(13, m.getStart()); assertEquals(13, m.getEnd()); m = sr.getResults().get(2); assertEquals(seq1.getDatasetSequence(), m.getSequence()); assertEquals(15, m.getStart()); assertEquals(15, m.getEnd()); /* * Check inverse mappings, from codons to protein */ for (int i = 5; i < 18; i++) { sr = MappingUtils.buildSearchResults(seq1, i, acfList); int residue = (i == 6 || i == 8 || i == 9) ? 8 : (i == 11 || i == 13 || i == 15 ? 9 : 0); if (residue == 0) { assertEquals(0, sr.getResults().size()); continue; } assertEquals(1, sr.getResults().size()); m = sr.getResults().get(0); assertEquals(aseq1.getDatasetSequence(), m.getSequence()); assertEquals(residue, m.getStart()); assertEquals(residue, m.getEnd()); } } /** * Test mapping a sequence group made of entire sequences. * * @throws IOException */ @Test(groups = { "Functional" }) public void testMapSequenceGroup_sequences() throws IOException { /* * Set up dna and protein Seq1/2/3 with mappings (held on the protein * viewport). */ AlignmentI cdna = loadAlignment(">Seq1\nACG\n>Seq2\nTGA\n>Seq3\nTAC\n", FileFormat.Fasta); cdna.setDataset(null); AlignmentI protein = loadAlignment(">Seq1\nK\n>Seq2\nL\n>Seq3\nQ\n", FileFormat.Fasta); protein.setDataset(null); AlignedCodonFrame acf = new AlignedCodonFrame(); MapList map = new MapList(new int[] { 1, 3 }, new int[] { 1, 1 }, 3, 1); for (int seq = 0; seq < 3; seq++) { acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), protein.getSequenceAt(seq).getDatasetSequence(), map); } List acfList = Arrays .asList(new AlignedCodonFrame[] { acf }); AlignViewportI dnaView = new AlignViewport(cdna); AlignViewportI proteinView = new AlignViewport(protein); protein.setCodonFrames(acfList); /* * Select Seq1 and Seq3 in the protein */ SequenceGroup sg = new SequenceGroup(); sg.setColourText(true); sg.setIdColour(Color.GREEN); sg.setOutlineColour(Color.LIGHT_GRAY); sg.addSequence(protein.getSequenceAt(0), false); sg.addSequence(protein.getSequenceAt(2), false); sg.setEndRes(protein.getWidth() - 1); /* * Verify the mapped sequence group in dna */ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, proteinView, dnaView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); assertEquals(2, mappedGroup.getSequences().size()); assertSame(cdna.getSequenceAt(0), mappedGroup.getSequences().get(0)); assertSame(cdna.getSequenceAt(2), mappedGroup.getSequences().get(1)); assertEquals(0, mappedGroup.getStartRes()); assertEquals(2, mappedGroup.getEndRes()); // 3 columns (1 codon) /* * Verify mapping sequence group from dna to protein */ sg.clear(); sg.addSequence(cdna.getSequenceAt(1), false); sg.addSequence(cdna.getSequenceAt(0), false); sg.setStartRes(0); sg.setEndRes(2); mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); assertEquals(2, mappedGroup.getSequences().size()); assertSame(protein.getSequenceAt(1), mappedGroup.getSequences().get(0)); assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(1)); assertEquals(0, mappedGroup.getStartRes()); assertEquals(0, mappedGroup.getEndRes()); } /** * Helper method to load an alignment and ensure dataset sequences are set up. * * @param data * @param format * TODO * @return * @throws IOException */ protected AlignmentI loadAlignment(final String data, FileFormatI format) throws IOException { AlignmentI a = new FormatAdapter().readFile(data, DataSourceType.PASTE, format); a.setDataset(null); return a; } /** * Test mapping a column selection in protein to its dna equivalent * * @throws IOException */ @Test(groups = { "Functional" }) public void testMapColumnSelection_proteinToDna() throws IOException { setupMappedAlignments(); ColumnSelection colsel = new ColumnSelection(); HiddenColumns hidden = new HiddenColumns(); /* * Column 0 in protein picks up Seq2/L, Seq3/G which map to cols 0-4 and 0-3 * in dna respectively, overall 0-4 */ colsel.addElement(0); ColumnSelection cs = new ColumnSelection(); HiddenColumns hs = new HiddenColumns(); MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView, cs, hs); assertEquals("[0, 1, 2, 3, 4]", cs.getSelected().toString()); /* * Column 1 in protein picks up Seq1/K which maps to cols 0-3 in dna */ cs.clear(); colsel.clear(); colsel.addElement(1); MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView, cs, hs); assertEquals("[0, 1, 2, 3]", cs.getSelected().toString()); /* * Column 2 in protein picks up gaps only - no mapping */ cs.clear(); colsel.clear(); colsel.addElement(2); MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView, cs, hs); assertEquals("[]", cs.getSelected().toString()); /* * Column 3 in protein picks up Seq1/P, Seq2/Q, Seq3/S which map to columns * 6-9, 6-10, 5-8 respectively, overall to 5-10 */ cs.clear(); colsel.clear(); colsel.addElement(3); MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView, cs, hs); assertEquals("[5, 6, 7, 8, 9, 10]", cs.getSelected().toString()); /* * Combine selection of columns 1 and 3 to get a discontiguous mapped * selection */ cs.clear(); colsel.clear(); colsel.addElement(1); colsel.addElement(3); MappingUtils.mapColumnSelection(colsel, hidden, proteinView, dnaView, cs, hs); assertEquals("[0, 1, 2, 3, 5, 6, 7, 8, 9, 10]", cs.getSelected().toString()); } /** * Set up mappings for tests from 3 dna to 3 protein sequences. Sequences have * offset start positions for a more general test case. * * @throws IOException */ protected void setupMappedAlignments() throws IOException { /* * Map (upper-case = coding): * Seq1/10-18 AC-GctGtC-T to Seq1/40 -K-P * Seq2/20-27 Tc-GA-G-T-T to Seq2/20-27 L--Q * Seq3/30-38 TtTT-AaCGg- to Seq3/60-61\nG--S */ AlignmentI cdna = loadAlignment(">Seq1/10-18\nAC-GctGtC-T\n" + ">Seq2/20-27\nTc-GA-G-T-Tc\n" + ">Seq3/30-38\nTtTT-AaCGg-\n", FileFormat.Fasta); cdna.setDataset(null); AlignmentI protein = loadAlignment( ">Seq1/40-41\n-K-P\n>Seq2/50-51\nL--Q\n>Seq3/60-61\nG--S\n", FileFormat.Fasta); protein.setDataset(null); // map first dna to first protein seq AlignedCodonFrame acf = new AlignedCodonFrame(); MapList map = new MapList(new int[] { 10, 12, 15, 15, 17, 18 }, new int[] { 40, 41 }, 3, 1); acf.addMap(cdna.getSequenceAt(0).getDatasetSequence(), protein.getSequenceAt(0).getDatasetSequence(), map); // map second dna to second protein seq map = new MapList(new int[] { 20, 20, 22, 23, 24, 26 }, new int[] { 50, 51 }, 3, 1); acf.addMap(cdna.getSequenceAt(1).getDatasetSequence(), protein.getSequenceAt(1).getDatasetSequence(), map); // map third dna to third protein seq map = new MapList(new int[] { 30, 30, 32, 34, 36, 37 }, new int[] { 60, 61 }, 3, 1); acf.addMap(cdna.getSequenceAt(2).getDatasetSequence(), protein.getSequenceAt(2).getDatasetSequence(), map); List acfList = Arrays .asList(new AlignedCodonFrame[] { acf }); dnaView = new AlignViewport(cdna); proteinView = new AlignViewport(protein); protein.setCodonFrames(acfList); } /** * Test mapping a column selection in dna to its protein equivalent * * @throws IOException */ @Test(groups = { "Functional" }) public void testMapColumnSelection_dnaToProtein() throws IOException { setupMappedAlignments(); ColumnSelection colsel = new ColumnSelection(); HiddenColumns hidden = new HiddenColumns(); /* * Column 0 in dna picks up first bases which map to residue 1, columns 0-1 * in protein. */ ColumnSelection cs = new ColumnSelection(); HiddenColumns hs = new HiddenColumns(); colsel.addElement(0); MappingUtils.mapColumnSelection(colsel, hidden, dnaView, proteinView, cs, hs); assertEquals("[0, 1]", cs.getSelected().toString()); /* * Columns 3-5 in dna map to the first residues in protein Seq1, Seq2, and * the first two in Seq3. Overall to columns 0, 1, 3 (col2 is all gaps). */ colsel.addElement(3); colsel.addElement(4); colsel.addElement(5); cs.clear(); MappingUtils.mapColumnSelection(colsel, hidden, dnaView, proteinView, cs, hs); assertEquals("[0, 1, 3]", cs.getSelected().toString()); } @Test(groups = { "Functional" }) public void testMapColumnSelection_null() throws IOException { setupMappedAlignments(); ColumnSelection cs = new ColumnSelection(); HiddenColumns hs = new HiddenColumns(); MappingUtils.mapColumnSelection(null, null, dnaView, proteinView, cs, hs); assertTrue("mapped selection not empty", cs.getSelected().isEmpty()); } /** * Tests for the method that converts a series of [start, end] ranges to * single positions */ @Test(groups = { "Functional" }) public void testFlattenRanges() { assertEquals("[1, 2, 3, 4]", Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 4 }))); assertEquals("[1, 2, 3, 4]", Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 2, 3, 4 }))); assertEquals("[1, 2, 3, 4]", Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 1, 2, 2, 3, 3, 4, 4 }))); assertEquals("[1, 2, 3, 4, 7, 8, 9, 12]", Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 4, 7, 9, 12, 12 }))); // trailing unpaired start position is ignored: assertEquals("[1, 2, 3, 4, 7, 8, 9, 12]", Arrays.toString(MappingUtils.flattenRanges(new int[] { 1, 4, 7, 9, 12, 12, 15 }))); } /** * Test mapping a sequence group made of entire columns. * * @throws IOException */ @Test(groups = { "Functional" }) public void testMapSequenceGroup_columns() throws IOException { /* * Set up dna and protein Seq1/2/3 with mappings (held on the protein * viewport). */ AlignmentI cdna = loadAlignment( ">Seq1\nACGGCA\n>Seq2\nTGACAG\n>Seq3\nTACGTA\n", FileFormat.Fasta); cdna.setDataset(null); AlignmentI protein = loadAlignment(">Seq1\nKA\n>Seq2\nLQ\n>Seq3\nQV\n", FileFormat.Fasta); protein.setDataset(null); AlignedCodonFrame acf = new AlignedCodonFrame(); MapList map = new MapList(new int[] { 1, 6 }, new int[] { 1, 2 }, 3, 1); for (int seq = 0; seq < 3; seq++) { acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), protein.getSequenceAt(seq).getDatasetSequence(), map); } List acfList = Arrays .asList(new AlignedCodonFrame[] { acf }); AlignViewportI dnaView = new AlignViewport(cdna); AlignViewportI proteinView = new AlignViewport(protein); protein.setCodonFrames(acfList); /* * Select all sequences, column 2 in the protein */ SequenceGroup sg = new SequenceGroup(); sg.setColourText(true); sg.setIdColour(Color.GREEN); sg.setOutlineColour(Color.LIGHT_GRAY); sg.addSequence(protein.getSequenceAt(0), false); sg.addSequence(protein.getSequenceAt(1), false); sg.addSequence(protein.getSequenceAt(2), false); sg.setStartRes(1); sg.setEndRes(1); /* * Verify the mapped sequence group in dna */ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, proteinView, dnaView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); assertEquals(3, mappedGroup.getSequences().size()); assertSame(cdna.getSequenceAt(0), mappedGroup.getSequences().get(0)); assertSame(cdna.getSequenceAt(1), mappedGroup.getSequences().get(1)); assertSame(cdna.getSequenceAt(2), mappedGroup.getSequences().get(2)); assertEquals(3, mappedGroup.getStartRes()); assertEquals(5, mappedGroup.getEndRes()); /* * Verify mapping sequence group from dna to protein */ sg.clear(); sg.addSequence(cdna.getSequenceAt(0), false); sg.addSequence(cdna.getSequenceAt(1), false); sg.addSequence(cdna.getSequenceAt(2), false); // select columns 2 and 3 in DNA which span protein columns 0 and 1 sg.setStartRes(2); sg.setEndRes(3); mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); assertEquals(3, mappedGroup.getSequences().size()); assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(0)); assertSame(protein.getSequenceAt(1), mappedGroup.getSequences().get(1)); assertSame(protein.getSequenceAt(2), mappedGroup.getSequences().get(2)); assertEquals(0, mappedGroup.getStartRes()); assertEquals(1, mappedGroup.getEndRes()); } /** * Test mapping a sequence group made of a sequences/columns region. * * @throws IOException */ @Test(groups = { "Functional" }) public void testMapSequenceGroup_region() throws IOException { /* * Set up gapped dna and protein Seq1/2/3 with mappings (held on the protein * viewport). */ AlignmentI cdna = loadAlignment( ">Seq1\nA-CG-GC--AT-CA\n>Seq2\n-TG-AC-AG-T-AT\n>Seq3\n-T--ACG-TAAT-G\n", FileFormat.Fasta); cdna.setDataset(null); AlignmentI protein = loadAlignment( ">Seq1\n-KA-S\n>Seq2\n--L-QY\n>Seq3\nQ-V-M\n", FileFormat.Fasta); protein.setDataset(null); AlignedCodonFrame acf = new AlignedCodonFrame(); MapList map = new MapList(new int[] { 1, 9 }, new int[] { 1, 3 }, 3, 1); for (int seq = 0; seq < 3; seq++) { acf.addMap(cdna.getSequenceAt(seq).getDatasetSequence(), protein.getSequenceAt(seq).getDatasetSequence(), map); } List acfList = Arrays .asList(new AlignedCodonFrame[] { acf }); AlignViewportI dnaView = new AlignViewport(cdna); AlignViewportI proteinView = new AlignViewport(protein); protein.setCodonFrames(acfList); /* * Select Seq1 and Seq2 in the protein, column 1 (K/-). Expect mapped * sequence group to cover Seq1, columns 0-3 (ACG). Because the selection * only includes a gap in Seq2 there is no mappable selection region in the * corresponding DNA. */ SequenceGroup sg = new SequenceGroup(); sg.setColourText(true); sg.setIdColour(Color.GREEN); sg.setOutlineColour(Color.LIGHT_GRAY); sg.addSequence(protein.getSequenceAt(0), false); sg.addSequence(protein.getSequenceAt(1), false); sg.setStartRes(1); sg.setEndRes(1); /* * Verify the mapped sequence group in dna */ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, proteinView, dnaView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); assertEquals(1, mappedGroup.getSequences().size()); assertSame(cdna.getSequenceAt(0), mappedGroup.getSequences().get(0)); // Seq2 in protein has a gap in column 1 - ignored // Seq1 has K which should map to columns 0-3 in Seq1 assertEquals(0, mappedGroup.getStartRes()); assertEquals(3, mappedGroup.getEndRes()); /* * Now select cols 2-4 in protein. These cover Seq1:AS Seq2:LQ Seq3:VM which * extend over DNA columns 3-12, 1-7, 6-13 respectively, or 1-13 overall. */ sg.setStartRes(2); sg.setEndRes(4); mappedGroup = MappingUtils.mapSequenceGroup(sg, proteinView, dnaView); assertEquals(1, mappedGroup.getStartRes()); assertEquals(13, mappedGroup.getEndRes()); /* * Verify mapping sequence group from dna to protein */ sg.clear(); sg.addSequence(cdna.getSequenceAt(0), false); // select columns 4,5 - includes Seq1:codon2 (A) only sg.setStartRes(4); sg.setEndRes(5); mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); assertEquals(2, mappedGroup.getStartRes()); assertEquals(2, mappedGroup.getEndRes()); // add Seq2 to dna selection cols 4-5 include codons 1 and 2 (LQ) sg.addSequence(cdna.getSequenceAt(1), false); mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); assertEquals(2, mappedGroup.getStartRes()); assertEquals(4, mappedGroup.getEndRes()); // add Seq3 to dna selection cols 4-5 include codon 1 (Q) sg.addSequence(cdna.getSequenceAt(2), false); mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); assertEquals(0, mappedGroup.getStartRes()); assertEquals(4, mappedGroup.getEndRes()); } @Test(groups = { "Functional" }) public void testFindMappingsForSequence() { SequenceI seq1 = new Sequence("Seq1", "ABC"); SequenceI seq2 = new Sequence("Seq2", "ABC"); SequenceI seq3 = new Sequence("Seq3", "ABC"); SequenceI seq4 = new Sequence("Seq4", "ABC"); seq1.createDatasetSequence(); seq2.createDatasetSequence(); seq3.createDatasetSequence(); seq4.createDatasetSequence(); /* * Create mappings from seq1 to seq2, seq2 to seq1, seq3 to seq1 */ AlignedCodonFrame acf1 = new AlignedCodonFrame(); MapList map = new MapList(new int[] { 1, 3 }, new int[] { 1, 3 }, 1, 1); acf1.addMap(seq1.getDatasetSequence(), seq2.getDatasetSequence(), map); AlignedCodonFrame acf2 = new AlignedCodonFrame(); acf2.addMap(seq2.getDatasetSequence(), seq1.getDatasetSequence(), map); AlignedCodonFrame acf3 = new AlignedCodonFrame(); acf3.addMap(seq3.getDatasetSequence(), seq1.getDatasetSequence(), map); List mappings = new ArrayList<>(); mappings.add(acf1); mappings.add(acf2); mappings.add(acf3); /* * Seq1 has three mappings */ List result = MappingUtils .findMappingsForSequence(seq1, mappings); assertEquals(3, result.size()); assertTrue(result.contains(acf1)); assertTrue(result.contains(acf2)); assertTrue(result.contains(acf3)); /* * Seq2 has two mappings */ result = MappingUtils.findMappingsForSequence(seq2, mappings); assertEquals(2, result.size()); assertTrue(result.contains(acf1)); assertTrue(result.contains(acf2)); /* * Seq3 has one mapping */ result = MappingUtils.findMappingsForSequence(seq3, mappings); assertEquals(1, result.size()); assertTrue(result.contains(acf3)); /* * Seq4 has no mappings */ result = MappingUtils.findMappingsForSequence(seq4, mappings); assertEquals(0, result.size()); result = MappingUtils.findMappingsForSequence(null, mappings); assertEquals(0, result.size()); result = MappingUtils.findMappingsForSequence(seq1, null); assertEquals(0, result.size()); result = MappingUtils.findMappingsForSequence(null, null); assertEquals(0, result.size()); } /** * just like the one above, but this time, we provide a set of sequences to * subselect the mapping search */ @Test(groups = { "Functional" }) public void testFindMappingsForSequenceAndOthers() { SequenceI seq1 = new Sequence("Seq1", "ABC"); SequenceI seq2 = new Sequence("Seq2", "ABC"); SequenceI seq3 = new Sequence("Seq3", "ABC"); SequenceI seq4 = new Sequence("Seq4", "ABC"); seq1.createDatasetSequence(); seq2.createDatasetSequence(); seq3.createDatasetSequence(); seq4.createDatasetSequence(); /* * Create mappings from seq1 to seq2, seq2 to seq1, seq3 to seq1, seq3 to seq4 */ AlignedCodonFrame acf1 = new AlignedCodonFrame(); MapList map = new MapList(new int[] { 1, 3 }, new int[] { 1, 3 }, 1, 1); acf1.addMap(seq1.getDatasetSequence(), seq2.getDatasetSequence(), map); AlignedCodonFrame acf2 = new AlignedCodonFrame(); acf2.addMap(seq2.getDatasetSequence(), seq1.getDatasetSequence(), map); AlignedCodonFrame acf3 = new AlignedCodonFrame(); acf3.addMap(seq3.getDatasetSequence(), seq1.getDatasetSequence(), map); AlignedCodonFrame acf4 = new AlignedCodonFrame(); acf4.addMap(seq3.getDatasetSequence(), seq4.getDatasetSequence(), map); List mappings = new ArrayList<>(); mappings.add(acf1); mappings.add(acf2); mappings.add(acf3); mappings.add(acf4); /* * test for null args */ List result = MappingUtils .findMappingsForSequenceAndOthers(null, mappings, Arrays.asList(new SequenceI[] { seq1, seq2 })); assertTrue(result.isEmpty()); result = MappingUtils.findMappingsForSequenceAndOthers(seq1, null, Arrays.asList(new SequenceI[] { seq1, seq2 })); assertTrue(result.isEmpty()); /* * Seq1 has three mappings, but filter argument will only accept * those to seq2 */ result = MappingUtils.findMappingsForSequenceAndOthers(seq1, mappings, Arrays.asList(new SequenceI[] { seq1, seq2, seq1.getDatasetSequence() })); assertEquals(2, result.size()); assertTrue(result.contains(acf1)); assertTrue(result.contains(acf2)); assertFalse("Did not expect to find mapping acf3 - subselect failed", result.contains(acf3)); assertFalse( "Did not expect to find mapping acf4 - doesn't involve sequence", result.contains(acf4)); /* * and verify the no filter case */ result = MappingUtils.findMappingsForSequenceAndOthers(seq1, mappings, null); assertEquals(3, result.size()); assertTrue(result.contains(acf1)); assertTrue(result.contains(acf2)); assertTrue(result.contains(acf3)); } @Test(groups = { "Functional" }) public void testMapEditCommand() { SequenceI dna = new Sequence("Seq1", "---ACG---GCATCA", 8, 16); SequenceI protein = new Sequence("Seq2", "-T-AS", 5, 7); dna.createDatasetSequence(); protein.createDatasetSequence(); AlignedCodonFrame acf = new AlignedCodonFrame(); MapList map = new MapList(new int[] { 8, 16 }, new int[] { 5, 7 }, 3, 1); acf.addMap(dna.getDatasetSequence(), protein.getDatasetSequence(), map); List mappings = new ArrayList<>(); mappings.add(acf); AlignmentI prot = new Alignment(new SequenceI[] { protein }); prot.setCodonFrames(mappings); AlignmentI nuc = new Alignment(new SequenceI[] { dna }); /* * construct and perform the edit command to turn "-T-AS" in to "-T-A--S" * i.e. insert two gaps at column 4 */ EditCommand ec = new EditCommand(); final Edit edit = ec.new Edit(Action.INSERT_GAP, new SequenceI[] { protein }, 4, 2, '-'); ec.appendEdit(edit, prot, true, null); /* * the mapped edit command should be to insert 6 gaps before base 4 in the * nucleotide sequence, which corresponds to aligned column 12 in the dna */ EditCommand mappedEdit = MappingUtils.mapEditCommand(ec, false, nuc, '-', mappings); assertEquals(1, mappedEdit.getEdits().size()); Edit e = mappedEdit.getEdits().get(0); assertEquals(1, e.getSequences().length); assertEquals(dna, e.getSequences()[0]); assertEquals(12, e.getPosition()); assertEquals(6, e.getNumber()); } /** * Tests for the method that converts a series of [start, end] ranges to * single positions, where the mapping is to a reverse strand i.e. start is * greater than end point mapped to */ @Test(groups = { "Functional" }) public void testFlattenRanges_reverseStrand() { assertEquals("[4, 3, 2, 1]", Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 1 }))); assertEquals("[4, 3, 2, 1]", Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 3, 2, 1 }))); assertEquals("[4, 3, 2, 1]", Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 4, 3, 3, 2, 2, 1, 1 }))); assertEquals("[12, 9, 8, 7, 4, 3, 2, 1]", Arrays.toString(MappingUtils.flattenRanges(new int[] { 12, 12, 9, 7, 4, 1 }))); // forwards and backwards anyone? assertEquals("[4, 5, 6, 3, 2, 1]", Arrays.toString(MappingUtils.flattenRanges(new int[] { 4, 6, 3, 1 }))); // backwards and forwards assertEquals("[3, 2, 1, 4, 5, 6]", Arrays.toString(MappingUtils.flattenRanges(new int[] { 3, 1, 4, 6 }))); // trailing unpaired start position is ignored: assertEquals("[12, 9, 8, 7, 4, 3, 2]", Arrays.toString(MappingUtils.flattenRanges(new int[] { 12, 12, 9, 7, 4, 2, 1 }))); } /** * Test mapping a column selection including hidden columns * * @throws IOException */ @Test(groups = { "Functional" }) public void testMapColumnSelection_hiddenColumns() throws IOException { setupMappedAlignments(); ColumnSelection proteinSelection = new ColumnSelection(); HiddenColumns hiddenCols = new HiddenColumns(); /* * Column 0 in protein picks up Seq2/L, Seq3/G which map to cols 0-4 and 0-3 * in dna respectively, overall 0-4 */ proteinSelection.hideSelectedColumns(0, hiddenCols); ColumnSelection dnaSelection = new ColumnSelection(); HiddenColumns dnaHidden = new HiddenColumns(); MappingUtils.mapColumnSelection(proteinSelection, hiddenCols, proteinView, dnaView, dnaSelection, dnaHidden); assertEquals("[]", dnaSelection.getSelected().toString()); Iterator regions = dnaHidden.iterator(); assertEquals(1, dnaHidden.getNumberOfRegions()); assertEquals("[0, 4]", Arrays.toString(regions.next())); /* * Column 1 in protein picks up Seq1/K which maps to cols 0-3 in dna */ dnaSelection = new ColumnSelection(); dnaHidden = new HiddenColumns(); hiddenCols.revealAllHiddenColumns(proteinSelection); // the unhidden columns are now marked selected! assertEquals("[0]", proteinSelection.getSelected().toString()); // deselect these or hideColumns will be expanded to include 0 proteinSelection.clear(); proteinSelection.hideSelectedColumns(1, hiddenCols); MappingUtils.mapColumnSelection(proteinSelection, hiddenCols, proteinView, dnaView, dnaSelection, dnaHidden); regions = dnaHidden.iterator(); assertEquals(1, dnaHidden.getNumberOfRegions()); assertEquals("[0, 3]", Arrays.toString(regions.next())); /* * Column 2 in protein picks up gaps only - no mapping */ dnaSelection = new ColumnSelection(); dnaHidden = new HiddenColumns(); hiddenCols.revealAllHiddenColumns(proteinSelection); proteinSelection.clear(); proteinSelection.hideSelectedColumns(2, hiddenCols); MappingUtils.mapColumnSelection(proteinSelection, hiddenCols, proteinView, dnaView, dnaSelection, dnaHidden); assertEquals(0, dnaHidden.getNumberOfRegions()); /* * Column 3 in protein picks up Seq1/P, Seq2/Q, Seq3/S which map to columns * 6-9, 6-10, 5-8 respectively, overall to 5-10 */ dnaSelection = new ColumnSelection(); dnaHidden = new HiddenColumns(); hiddenCols.revealAllHiddenColumns(proteinSelection); proteinSelection.clear(); proteinSelection.hideSelectedColumns(3, hiddenCols); // 5-10 hidden in dna proteinSelection.addElement(1); // 0-3 selected in dna MappingUtils.mapColumnSelection(proteinSelection, hiddenCols, proteinView, dnaView, dnaSelection, dnaHidden); assertEquals("[0, 1, 2, 3]", dnaSelection.getSelected().toString()); regions = dnaHidden.iterator(); assertEquals(1, dnaHidden.getNumberOfRegions()); assertEquals("[5, 10]", Arrays.toString(regions.next())); /* * Combine hiding columns 1 and 3 to get discontiguous hidden columns */ dnaSelection = new ColumnSelection(); dnaHidden = new HiddenColumns(); hiddenCols.revealAllHiddenColumns(proteinSelection); proteinSelection.clear(); proteinSelection.hideSelectedColumns(1, hiddenCols); proteinSelection.hideSelectedColumns(3, hiddenCols); MappingUtils.mapColumnSelection(proteinSelection, hiddenCols, proteinView, dnaView, dnaSelection, dnaHidden); regions = dnaHidden.iterator(); assertEquals(2, dnaHidden.getNumberOfRegions()); assertEquals("[0, 3]", Arrays.toString(regions.next())); assertEquals("[5, 10]", Arrays.toString(regions.next())); } @Test(groups = { "Functional" }) public void testGetLength() { assertEquals(0, MappingUtils.getLength(null)); /* * [start, end] ranges */ List ranges = new ArrayList<>(); assertEquals(0, MappingUtils.getLength(ranges)); ranges.add(new int[] { 1, 1 }); assertEquals(1, MappingUtils.getLength(ranges)); ranges.add(new int[] { 2, 10 }); assertEquals(10, MappingUtils.getLength(ranges)); ranges.add(new int[] { 20, 10 }); assertEquals(21, MappingUtils.getLength(ranges)); /* * [start, end, start, end...] ranges */ ranges.clear(); ranges.add(new int[] { 1, 5, 8, 4 }); ranges.add(new int[] { 8, 2 }); ranges.add(new int[] { 12, 12 }); assertEquals(18, MappingUtils.getLength(ranges)); } @Test(groups = { "Functional" }) public void testContains() { assertFalse(MappingUtils.contains(null, 1)); List ranges = new ArrayList<>(); assertFalse(MappingUtils.contains(ranges, 1)); ranges.add(new int[] { 1, 4 }); ranges.add(new int[] { 6, 6 }); ranges.add(new int[] { 8, 10 }); ranges.add(new int[] { 30, 20 }); ranges.add(new int[] { -16, -44 }); assertFalse(MappingUtils.contains(ranges, 0)); assertTrue(MappingUtils.contains(ranges, 1)); assertTrue(MappingUtils.contains(ranges, 2)); assertTrue(MappingUtils.contains(ranges, 3)); assertTrue(MappingUtils.contains(ranges, 4)); assertFalse(MappingUtils.contains(ranges, 5)); assertTrue(MappingUtils.contains(ranges, 6)); assertFalse(MappingUtils.contains(ranges, 7)); assertTrue(MappingUtils.contains(ranges, 8)); assertTrue(MappingUtils.contains(ranges, 9)); assertTrue(MappingUtils.contains(ranges, 10)); assertFalse(MappingUtils.contains(ranges, 31)); assertTrue(MappingUtils.contains(ranges, 30)); assertTrue(MappingUtils.contains(ranges, 29)); assertTrue(MappingUtils.contains(ranges, 20)); assertFalse(MappingUtils.contains(ranges, 19)); assertFalse(MappingUtils.contains(ranges, -15)); assertTrue(MappingUtils.contains(ranges, -16)); assertTrue(MappingUtils.contains(ranges, -44)); assertFalse(MappingUtils.contains(ranges, -45)); } /** * Test the method that drops positions from the start of a mapped range */ @Test(groups = "Functional") public void testRemoveStartPositions() { int[] ranges = new int[] { 1, 10 }; int[] adjusted = MappingUtils.removeStartPositions(0, ranges); assertEquals("[1, 10]", Arrays.toString(adjusted)); adjusted = MappingUtils.removeStartPositions(1, ranges); assertEquals("[2, 10]", Arrays.toString(adjusted)); assertEquals("[1, 10]", Arrays.toString(ranges)); ranges = adjusted; adjusted = MappingUtils.removeStartPositions(1, ranges); assertEquals("[3, 10]", Arrays.toString(adjusted)); assertEquals("[2, 10]", Arrays.toString(ranges)); ranges = new int[] { 2, 3, 10, 12 }; adjusted = MappingUtils.removeStartPositions(1, ranges); assertEquals("[3, 3, 10, 12]", Arrays.toString(adjusted)); assertEquals("[2, 3, 10, 12]", Arrays.toString(ranges)); ranges = new int[] { 2, 2, 8, 12 }; adjusted = MappingUtils.removeStartPositions(1, ranges); assertEquals("[8, 12]", Arrays.toString(adjusted)); assertEquals("[2, 2, 8, 12]", Arrays.toString(ranges)); ranges = new int[] { 2, 2, 8, 12 }; adjusted = MappingUtils.removeStartPositions(2, ranges); assertEquals("[9, 12]", Arrays.toString(adjusted)); assertEquals("[2, 2, 8, 12]", Arrays.toString(ranges)); ranges = new int[] { 2, 2, 4, 4, 9, 12 }; adjusted = MappingUtils.removeStartPositions(1, ranges); assertEquals("[4, 4, 9, 12]", Arrays.toString(adjusted)); assertEquals("[2, 2, 4, 4, 9, 12]", Arrays.toString(ranges)); ranges = new int[] { 2, 2, 4, 4, 9, 12 }; adjusted = MappingUtils.removeStartPositions(2, ranges); assertEquals("[9, 12]", Arrays.toString(adjusted)); assertEquals("[2, 2, 4, 4, 9, 12]", Arrays.toString(ranges)); ranges = new int[] { 2, 3, 9, 12 }; adjusted = MappingUtils.removeStartPositions(3, ranges); assertEquals("[10, 12]", Arrays.toString(adjusted)); assertEquals("[2, 3, 9, 12]", Arrays.toString(ranges)); } /** * Test the method that drops positions from the start of a mapped range, on * the reverse strand */ @Test(groups = "Functional") public void testRemoveStartPositions_reverseStrand() { int[] ranges = new int[] { 10, 1 }; int[] adjusted = MappingUtils.removeStartPositions(0, ranges); assertEquals("[10, 1]", Arrays.toString(adjusted)); assertEquals("[10, 1]", Arrays.toString(ranges)); ranges = adjusted; adjusted = MappingUtils.removeStartPositions(1, ranges); assertEquals("[9, 1]", Arrays.toString(adjusted)); assertEquals("[10, 1]", Arrays.toString(ranges)); ranges = adjusted; adjusted = MappingUtils.removeStartPositions(1, ranges); assertEquals("[8, 1]", Arrays.toString(adjusted)); assertEquals("[9, 1]", Arrays.toString(ranges)); ranges = new int[] { 12, 11, 9, 6 }; adjusted = MappingUtils.removeStartPositions(1, ranges); assertEquals("[11, 11, 9, 6]", Arrays.toString(adjusted)); assertEquals("[12, 11, 9, 6]", Arrays.toString(ranges)); ranges = new int[] { 12, 12, 8, 4 }; adjusted = MappingUtils.removeStartPositions(1, ranges); assertEquals("[8, 4]", Arrays.toString(adjusted)); assertEquals("[12, 12, 8, 4]", Arrays.toString(ranges)); ranges = new int[] { 12, 12, 8, 4 }; adjusted = MappingUtils.removeStartPositions(2, ranges); assertEquals("[7, 4]", Arrays.toString(adjusted)); assertEquals("[12, 12, 8, 4]", Arrays.toString(ranges)); ranges = new int[] { 12, 12, 10, 10, 8, 4 }; adjusted = MappingUtils.removeStartPositions(1, ranges); assertEquals("[10, 10, 8, 4]", Arrays.toString(adjusted)); assertEquals("[12, 12, 10, 10, 8, 4]", Arrays.toString(ranges)); ranges = new int[] { 12, 12, 10, 10, 8, 4 }; adjusted = MappingUtils.removeStartPositions(2, ranges); assertEquals("[8, 4]", Arrays.toString(adjusted)); assertEquals("[12, 12, 10, 10, 8, 4]", Arrays.toString(ranges)); ranges = new int[] { 12, 11, 8, 4 }; adjusted = MappingUtils.removeStartPositions(3, ranges); assertEquals("[7, 4]", Arrays.toString(adjusted)); assertEquals("[12, 11, 8, 4]", Arrays.toString(ranges)); } @Test(groups = { "Functional" }) public void testRangeContains() { /* * both forward ranges */ assertTrue( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 1, 10 })); assertTrue( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 2, 10 })); assertTrue( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 1, 9 })); assertTrue( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 4, 5 })); assertFalse( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 0, 9 })); assertFalse( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { -10, -9 })); assertFalse( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 1, 11 })); assertFalse( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 11, 12 })); /* * forward range, reverse query */ assertTrue( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 10, 1 })); assertTrue( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 9, 1 })); assertTrue( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 10, 2 })); assertTrue( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 5, 5 })); assertFalse( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 11, 1 })); assertFalse( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 10, 0 })); /* * reverse range, forward query */ assertTrue( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 1, 10 })); assertTrue( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 1, 9 })); assertTrue( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 2, 10 })); assertTrue( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 6, 6 })); assertFalse( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 6, 11 })); assertFalse( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 11, 20 })); assertFalse( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { -3, -2 })); /* * both reverse */ assertTrue( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 10, 1 })); assertTrue( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 9, 1 })); assertTrue( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 10, 2 })); assertTrue( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 3, 3 })); assertFalse( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 11, 1 })); assertFalse( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 10, 0 })); assertFalse( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { 12, 11 })); assertFalse( MappingUtils.rangeContains(new int[] { 10, 1 }, new int[] { -5, -8 })); /* * bad arguments */ assertFalse( MappingUtils.rangeContains(new int[] { 1, 10, 12 }, new int[] { 1, 10 })); assertFalse( MappingUtils.rangeContains(new int[] { 1, 10 }, new int[] { 1 })); assertFalse(MappingUtils.rangeContains(new int[] { 1, 10 }, null)); assertFalse(MappingUtils.rangeContains(null, new int[] { 1, 10 })); } @Test(groups = "Functional") public void testRemoveEndPositions() { List ranges = new ArrayList<>(); /* * case 1: truncate last range */ ranges.add(new int[] { 1, 10 }); ranges.add(new int[] { 20, 30 }); MappingUtils.removeEndPositions(5, ranges); assertEquals(2, ranges.size()); assertEquals(25, ranges.get(1)[1]); /* * case 2: remove last range */ ranges.clear(); ranges.add(new int[] { 1, 10 }); ranges.add(new int[] { 20, 22 }); MappingUtils.removeEndPositions(3, ranges); assertEquals(1, ranges.size()); assertEquals(10, ranges.get(0)[1]); /* * case 3: truncate penultimate range */ ranges.clear(); ranges.add(new int[] { 1, 10 }); ranges.add(new int[] { 20, 21 }); MappingUtils.removeEndPositions(3, ranges); assertEquals(1, ranges.size()); assertEquals(9, ranges.get(0)[1]); /* * case 4: remove last two ranges */ ranges.clear(); ranges.add(new int[] { 1, 10 }); ranges.add(new int[] { 20, 20 }); ranges.add(new int[] { 30, 30 }); MappingUtils.removeEndPositions(3, ranges); assertEquals(1, ranges.size()); assertEquals(9, ranges.get(0)[1]); } @Test(groups = "Functional") public void testFindOverlap() { List ranges = new ArrayList<>(); ranges.add(new int[] { 4, 8 }); ranges.add(new int[] { 10, 12 }); ranges.add(new int[] { 16, 19 }); int[] overlap = MappingUtils.findOverlap(ranges, 5, 13); assertArrayEquals(overlap, new int[] { 5, 12 }); overlap = MappingUtils.findOverlap(ranges, -100, 100); assertArrayEquals(overlap, new int[] { 4, 19 }); overlap = MappingUtils.findOverlap(ranges, 7, 17); assertArrayEquals(overlap, new int[] { 7, 17 }); overlap = MappingUtils.findOverlap(ranges, 13, 15); assertNull(overlap); } /** * Test mapping a sequence group where sequences in and outside the group * share a dataset sequence (e.g. alternative CDS for the same gene) *

* This scenario doesn't arise after JAL-3763 changes, but test left as still valid * @throws IOException */ @Test(groups = { "Functional" }) public void testMapSequenceGroup_sharedDataset() throws IOException { /* * Set up dna and protein Seq1/2/3 with mappings (held on the protein * viewport). CDS sequences share the same 'gene' dataset sequence. */ SequenceI dna = new Sequence("dna", "aaatttgggcccaaatttgggccc"); SequenceI cds1 = new Sequence("cds1/1-6", "aaattt"); SequenceI cds2 = new Sequence("cds1/4-9", "tttggg"); SequenceI cds3 = new Sequence("cds1/19-24", "gggccc"); cds1.setDatasetSequence(dna); cds2.setDatasetSequence(dna); cds3.setDatasetSequence(dna); SequenceI pep1 = new Sequence("pep1", "KF"); SequenceI pep2 = new Sequence("pep2", "FG"); SequenceI pep3 = new Sequence("pep3", "GP"); pep1.createDatasetSequence(); pep2.createDatasetSequence(); pep3.createDatasetSequence(); /* * add mappings from coding positions of dna to respective peptides */ AlignedCodonFrame acf = new AlignedCodonFrame(); acf.addMap(dna, pep1, new MapList(new int[] { 1, 6 }, new int[] { 1, 2 }, 3, 1)); acf.addMap(dna, pep2, new MapList(new int[] { 4, 9 }, new int[] { 1, 2 }, 3, 1)); acf.addMap(dna, pep3, new MapList(new int[] { 19, 24 }, new int[] { 1, 2 }, 3, 1)); List acfList = Arrays .asList(new AlignedCodonFrame[] { acf }); AlignmentI cdna = new Alignment(new SequenceI[] { cds1, cds2, cds3 }); AlignmentI protein = new Alignment( new SequenceI[] { pep1, pep2, pep3 }); AlignViewportI cdnaView = new AlignViewport(cdna); AlignViewportI peptideView = new AlignViewport(protein); protein.setCodonFrames(acfList); /* * Select pep1 and pep3 in the protein alignment */ SequenceGroup sg = new SequenceGroup(); sg.setColourText(true); sg.setIdColour(Color.GREEN); sg.setOutlineColour(Color.LIGHT_GRAY); sg.addSequence(pep1, false); sg.addSequence(pep3, false); sg.setEndRes(protein.getWidth() - 1); /* * Verify the mapped sequence group in dna is cds1 and cds3 */ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, peptideView, cdnaView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); assertEquals(2, mappedGroup.getSequences().size()); assertSame(cds1, mappedGroup.getSequences().get(0)); assertSame(cds3, mappedGroup.getSequences().get(1)); // columns 1-6 selected (0-5 base zero) assertEquals(0, mappedGroup.getStartRes()); assertEquals(5, mappedGroup.getEndRes()); /* * Select mapping sequence group from dna to protein */ sg.clear(); sg.addSequence(cds2, false); sg.addSequence(cds1, false); sg.setStartRes(0); sg.setEndRes(cdna.getWidth() - 1); mappedGroup = MappingUtils.mapSequenceGroup(sg, cdnaView, peptideView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); assertEquals(2, mappedGroup.getSequences().size()); assertSame(protein.getSequenceAt(1), mappedGroup.getSequences().get(0)); assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(1)); assertEquals(0, mappedGroup.getStartRes()); assertEquals(1, mappedGroup.getEndRes()); // two columns } }