/*
- * Jalview - A Sequence Alignment Editor and Viewer (Version 2.8.0b1)
- * Copyright (C) 2014 The Jalview Authors
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
*
* This file is part of Jalview.
*
* Jalview is free software: you can redistribute it and/or
* modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
*
* Jalview is distributed in the hope that it will be useful, but
* WITHOUT ANY WARRANTY; without even the implied warranty
* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
* PURPOSE. See the GNU General Public License for more details.
*
- * You should have received a copy of the GNU General Public License along with Jalview. If not, see <http://www.gnu.org/licenses/>.
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see <http://www.gnu.org/licenses/>.
* The Jalview Authors are detailed in the 'AUTHORS' file.
*/
package jalview.gui;
+import jalview.datamodel.SequenceI;
+import jalview.ext.varna.JalviewVarnaBinding;
+import jalview.structure.AtomSpec;
+import jalview.util.MessageManager;
+
import java.awt.BorderLayout;
import java.awt.Color;
import java.awt.Component;
import java.awt.Dimension;
-import java.awt.Font;
-import java.awt.GridLayout;
import java.awt.datatransfer.DataFlavor;
import java.awt.datatransfer.Transferable;
import java.awt.dnd.DnDConstants;
import java.awt.dnd.DropTarget;
-import java.awt.dnd.DropTargetDragEvent;
+import java.awt.dnd.DropTargetAdapter;
import java.awt.dnd.DropTargetDropEvent;
-import java.awt.dnd.DropTargetEvent;
-import java.awt.dnd.DropTargetListener;
-import java.awt.event.ActionEvent;
-import java.awt.event.ActionListener;
import java.awt.event.ComponentEvent;
+import java.awt.event.MouseAdapter;
import java.awt.event.MouseEvent;
-import java.awt.event.MouseListener;
import java.io.File;
+import java.io.IOException;
import java.util.ArrayList;
import java.util.Collection;
import java.util.List;
import javax.swing.DefaultListModel;
import javax.swing.DefaultListSelectionModel;
-import javax.swing.Icon;
-import javax.swing.JButton;
-import javax.swing.JFrame;
import javax.swing.JLabel;
import javax.swing.JList;
-import javax.swing.JOptionPane;
import javax.swing.JPanel;
import javax.swing.JScrollPane;
-import javax.swing.JSplitPane;
-import javax.swing.JTextField;
import javax.swing.ListModel;
import javax.swing.ListSelectionModel;
-import javax.swing.UIManager;
-import javax.swing.UnsupportedLookAndFeelException;
import javax.swing.event.ListSelectionEvent;
import javax.swing.event.ListSelectionListener;
import fr.orsay.lri.varna.VARNAPanel;
import fr.orsay.lri.varna.components.ReorderableJList;
-import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed;
+import fr.orsay.lri.varna.exceptions.ExceptionNAViewAlgorithm;
import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
-import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
-import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;
import fr.orsay.lri.varna.models.FullBackup;
import fr.orsay.lri.varna.models.VARNAConfig;
-import fr.orsay.lri.varna.models.rna.Mapping;
import fr.orsay.lri.varna.models.rna.RNA;
-public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding
- implements DropTargetListener, InterfaceVARNAListener,
- MouseListener
+public class AppVarnaBinding extends JalviewVarnaBinding
{
-
- /**
- *
- */
- // private static final long serialVersionUID = -790155708306987257L;
-
- private String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
-
- private String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
-
- private String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
-
public VARNAPanel vp;
- protected JPanel _tools = new JPanel();
-
- private JPanel _input = new JPanel();
-
- private JPanel _seqPanel = new JPanel();
-
- private JPanel _strPanel = new JPanel();
-
- private JLabel _info = new JLabel();
-
- private JTextField _str = new JTextField();
-
- private JTextField _seq = new JTextField();
-
- private JLabel _strLabel = new JLabel(" Str:");
-
- private JLabel _seqLabel = new JLabel(" Seq:");
-
- private JButton _createButton = new JButton("Create");
-
- private JButton _updateButton = new JButton("Update");
-
- private JButton _deleteButton = new JButton("Delete");
-
- private JButton _duplicateButton = new JButton("Snapshot");
-
protected JPanel _listPanel = new JPanel();
private ReorderableJList _sideList = null;
private BackupHolder _rnaList;
- /*
- * public AppVarnaBinding() { //super("VARNA in Jalview");
- * //this.set_seq("ATGC"); //this.set_str(".()."); //RNAPanelDemoInit();
- *
- * //initVarna("ATGCATGATATATATATAT","....((((...))))....");
- * initVarna(this.DEFAULT_SEQUENCE,this.DEFAULT_STRUCTURE1); }
+ /**
+ * Constructor
*/
-
- public AppVarnaBinding(String seq, String struc)
+ public AppVarnaBinding()
{
- // super("VARNA in Jalview");
- initVarna(seq, struc);
+ init();
}
- public AppVarnaBinding(ArrayList<RNA> rnaList)
+ /**
+ * Constructs the VARNAPanel and an (empty) selection list of structures to
+ * show in it
+ */
+ private void init()
{
- // super("VARNA in Jalview");
- initVarnaEdit(rnaList);
- }
+ DefaultListModel<FullBackup> dlm = new DefaultListModel<FullBackup>();
- private void initVarna(String seq, String str)
- {
- DefaultListModel dlm = new DefaultListModel();
+ int marginTools = 40;
DefaultListSelectionModel m = new DefaultListSelectionModel();
m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
_sideList = new ReorderableJList();
_sideList.setModel(dlm);
- _sideList.addMouseListener(this);
- _sideList.setSelectionModel(m);
- _sideList.setPreferredSize(new Dimension(100, 0));
- _sideList.addListSelectionListener(new ListSelectionListener()
+ _sideList.addMouseListener(new MouseAdapter()
{
- public void valueChanged(ListSelectionEvent arg0)
+ @Override
+ public void mouseClicked(MouseEvent e)
{
- if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
- {
- FullBackup sel = (FullBackup) _sideList.getSelectedValue();
- Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA()
- .getSize(), sel.rna.getSize());
- vp.showRNAInterpolated(sel.rna, sel.config, map);
- _seq.setText(sel.rna.getSeq());
- _str.setText(sel.rna.getStructDBN());
- }
+ AppVarnaBinding.this.mouseClicked(e);
}
});
-
- _rnaList = new BackupHolder(dlm, _sideList);
- RNA _RNA1 = new RNA("User defined 1");
-
- try
- {
- vp = new VARNAPanel("0", ".");
- _RNA1.setRNA(seq, str);
- _RNA1.drawRNARadiate(vp.getConfig());
- } catch (ExceptionNonEqualLength e)
- {
- vp.errorDialog(e);
- } catch (ExceptionUnmatchedClosingParentheses e2)
- {
- e2.printStackTrace();
- } catch (ExceptionFileFormatOrSyntax e3)
- {
- e3.printStackTrace();
- }
- vp.setPreferredSize(new Dimension(400, 400));
- _rnaList.add(vp.getConfig().clone(), _RNA1, generateDefaultName(), true);
-
- // TODO setBackground(_backgroundColor);
- vp.setBackground(_backgroundColor);
-
- // TODO getContentPane().setLayout(new BorderLayout());
- // TODO getContentPane().add(vp, BorderLayout.CENTER);
-
- // setVisible(true);
- vp.addVARNAListener(this);
- }
-
- private void initVarnaEdit(ArrayList<RNA> rnaInList)
- {
- DefaultListModel dlm = new DefaultListModel();
-
- int marginTools = 40;
-
- DefaultListSelectionModel m = new DefaultListSelectionModel();
- m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
- m.setLeadAnchorNotificationEnabled(false);
-
- _sideList = new ReorderableJList();
- _sideList.setModel(dlm);
- _sideList.addMouseListener(this);
_sideList.setSelectionModel(m);
_sideList.setPreferredSize(new Dimension(100, 0));
_sideList.addListSelectionListener(new ListSelectionListener()
{
- public void valueChanged(ListSelectionEvent arg0)
+ public void valueChanged(ListSelectionEvent evt)
{
- // System.out.println(arg0);
- if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
- {
- FullBackup sel = (FullBackup) _sideList.getSelectedValue();
- Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA()
- .getSize(), sel.rna.getSize());
- vp.showRNAInterpolated(sel.rna, sel.config, map);
- // _seq.setText(sel.rna.getSeq());
- _str.setText(sel.rna.getStructDBN());
- }
+ changeSelectedStructure_actionPerformed(evt);
}
});
_rnaList = new BackupHolder(dlm, _sideList);
try
{
vp = new VARNAPanel("0", ".");
- for (int i = 0; i < rnaInList.size(); i++)
- {
- rnaInList.get(i).drawRNARadiate(vp.getConfig());
- }
} catch (ExceptionNonEqualLength e)
{
vp.errorDialog(e);
}
vp.setPreferredSize(new Dimension(400, 400));
- for (int i = 0; i < rnaInList.size(); i++)
- {
- if (i < rnaInList.size() - 1)
- {
- _rnaList.add(vp.getConfig().clone(), rnaInList.get(i), rnaInList
- .get(i).getName());
- }
- else
- {
- _rnaList.add(vp.getConfig().clone(), rnaInList.get(i), rnaInList
- .get(i).getName(), true);
- }
- }
-
- /*
- * _rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName());
- * _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
- */
JScrollPane listScroller = new JScrollPane(_sideList);
listScroller.setPreferredSize(new Dimension(150, 0));
vp.setBackground(_backgroundColor);
- Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
+ JLabel j = new JLabel(
+ MessageManager.getString("label.structures_manager"),
+ JLabel.CENTER);
+ _listPanel.setLayout(new BorderLayout());
- // _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
- // _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
- _seq.setFont(textFieldsFont);
- _seq.setText(rnaInList.get(0).getSeq());
+ _listPanel.add(j, BorderLayout.NORTH);
+ _listPanel.add(listScroller, BorderLayout.CENTER);
- _updateButton.addActionListener(new ActionListener()
+ new DropTarget(vp, new DropTargetAdapter()
{
- public void actionPerformed(ActionEvent e)
+ @Override
+ public void drop(DropTargetDropEvent dtde)
{
- FullBackup sel = (FullBackup) _sideList.getSelectedValue();
- sel.rna.setSequence("A");
+ AppVarnaBinding.this.drop(dtde);
}
});
-
- // _seqPanel.setLayout(new BorderLayout());
- // _seqPanel.add(_seqLabel, BorderLayout.WEST);
- // _seqPanel.add(_seq, BorderLayout.CENTER);
-
- _strLabel.setPreferredSize(new Dimension(marginTools, 15));
- _strLabel.setHorizontalTextPosition(JLabel.LEFT);
- _str.setFont(textFieldsFont);
- _strPanel.setLayout(new BorderLayout());
- _strPanel.add(_strLabel, BorderLayout.WEST);
- _strPanel.add(_str, BorderLayout.CENTER);
-
- _input.setLayout(new GridLayout(1, 0));
- // _input.add(_seqPanel);
- _input.add(_strPanel);
-
- JPanel goPanel = new JPanel();
- goPanel.setLayout(new BorderLayout());
-
- _tools.setLayout(new BorderLayout());
- _tools.add(_input, BorderLayout.CENTER);
- // _tools.add(_info, BorderLayout.SOUTH);
- _tools.add(goPanel, BorderLayout.EAST);
-
- /*
- * _deleteButton.addActionListener(new ActionListener() { public void
- * actionPerformed(ActionEvent e) { _rnaList.removeSelected(); } });
- * _duplicateButton.addActionListener(new ActionListener() { public void
- * actionPerformed(ActionEvent e) {
- * _rnaList.add((VARNAConfig)vp.getConfig().
- * clone(),vp.getRNA().clone(),vp.getRNA
- * ().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new
- * Date()),true); }});
- */
- goPanel.add(_updateButton, BorderLayout.CENTER);
-
- JPanel ops = new JPanel();
- ops.setLayout(new GridLayout(1, 2));
- ops.add(_deleteButton);
- ops.add(_duplicateButton);
-
- JLabel j = new JLabel("Structures Manager", JLabel.CENTER);
- _listPanel.setLayout(new BorderLayout());
-
- // _listPanel.add(ops, BorderLayout.SOUTH);
- _listPanel.add(j, BorderLayout.NORTH);
- _listPanel.add(listScroller, BorderLayout.CENTER);
-
- // JSplitPane split = new
- // JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp);
- /**
- * TODO getContentPane().setLayout(new BorderLayout());
- * getContentPane().add(split, BorderLayout.CENTER);
- * getContentPane().add(_tools, BorderLayout.NORTH);
- */
-
- // TODO setVisible(true);
- DropTarget dt = new DropTarget(vp, this);
-
- vp.addVARNAListener(this);
- }
-
- public JPanel getTools()
- {
- return _tools;
}
public JPanel getListPanel()
}
/**
- * TODO: Is it effective to transfer the whole RNA?
+ * Returns the currently selected RNA, or null if none selected
*
- * @return Currently selected RNA
+ * @return
*/
public RNA getSelectedRNA()
{
- return _rnaList.getElementAt(_sideList.getSelectedIndex()).rna;
+ int selectedIndex = _sideList.getSelectedIndex();
+ if (selectedIndex < 0)
+ {
+ return null;
+ }
+ FullBackup selected = _rnaList.getElementAt(selectedIndex);
+ return selected.rna;
}
/**
vp.showRNA(rnaEdit);
}
- /*
- * private void RNAPanelDemoInit() { DefaultListModel dlm = new
- * DefaultListModel();
- *
- *
- * int marginTools = 40;
- *
- * DefaultListSelectionModel m = new DefaultListSelectionModel();
- * m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
- * m.setLeadAnchorNotificationEnabled(false);
- *
- *
- * _sideList = new ReorderableJList(); _sideList.setModel(dlm);
- * _sideList.addMouseListener(this); _sideList.setSelectionModel(m);
- * _sideList.setPreferredSize(new Dimension(100, 0));
- * _sideList.addListSelectionListener( new ListSelectionListener(){ public
- * void valueChanged(ListSelectionEvent arg0) { //System.out.println(arg0); if
- * (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting()) { FullBackup
- * sel = (FullBackup) _sideList.getSelectedValue(); Mapping map =
- * Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize());
- * vp.showRNAInterpolated(sel.rna,sel.config,map);
- * _seq.setText(sel.rna.getSeq()); _str.setText(sel.rna.getStructDBN()); } }
- * });
- *
- * _rnaList = new BackupHolder(dlm,_sideList); RNA _RNA1 = new
- * RNA("User defined 1"); RNA _RNA2 = new RNA("User defined 2"); try { vp =
- * new VARNAPanel("0","."); _RNA1.setRNA(DEFAULT_SEQUENCE,
- * DEFAULT_STRUCTURE1); _RNA1.drawRNARadiate(vp.getConfig());
- * _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2);
- * _RNA2.drawRNARadiate(vp.getConfig()); } catch (ExceptionNonEqualLength e) {
- * vp.errorDialog(e); } catch (ExceptionUnmatchedClosingParentheses e2) {
- * e2.printStackTrace(); } catch (ExceptionFileFormatOrSyntax e3) {
- * e3.printStackTrace(); } vp.setPreferredSize(new Dimension(400, 400));
- * _rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName());
- * _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
- *
- * JScrollPane listScroller = new JScrollPane(_sideList);
- * listScroller.setPreferredSize(new Dimension(150, 0));
- *
- * setBackground(_backgroundColor); vp.setBackground(_backgroundColor);
- *
- *
- * Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
- *
- * _seqLabel.setHorizontalTextPosition(JLabel.LEFT);
- * _seqLabel.setPreferredSize(new Dimension(marginTools, 15));
- * _seq.setFont(textFieldsFont); _seq.setText(DEFAULT_SEQUENCE);
- *
- * _createButton.addActionListener(new ActionListener() { public void
- * actionPerformed(ActionEvent e) { try { RNA nRNA = new
- * RNA(generateDefaultName()); nRNA.setRNA(_seq.getText(), _str.getText());
- * nRNA.drawRNARadiate(vp.getConfig()); _rnaList.add(new
- * VARNAConfig(),nRNA,true); } catch (ExceptionUnmatchedClosingParentheses e1)
- * { JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error",
- * JOptionPane.ERROR_MESSAGE); } catch (ExceptionFileFormatOrSyntax e1) {
- * JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error",
- * JOptionPane.ERROR_MESSAGE); } } });
- *
- *
- * _seqPanel.setLayout(new BorderLayout()); _seqPanel.add(_seqLabel,
- * BorderLayout.WEST); _seqPanel.add(_seq, BorderLayout.CENTER);
- *
- * _strLabel.setPreferredSize(new Dimension(marginTools, 15));
- * _strLabel.setHorizontalTextPosition(JLabel.LEFT);
- * _str.setFont(textFieldsFont); _strPanel.setLayout(new BorderLayout());
- * _strPanel.add(_strLabel, BorderLayout.WEST); _strPanel.add(_str,
- * BorderLayout.CENTER);
- *
- * _input.setLayout(new GridLayout(2, 0)); _input.add(_seqPanel);
- * _input.add(_strPanel);
- *
- * JPanel goPanel = new JPanel(); goPanel.setLayout(new BorderLayout());
- *
- * _tools.setLayout(new BorderLayout()); _tools.add(_input,
- * BorderLayout.CENTER); _tools.add(_info, BorderLayout.SOUTH);
- * _tools.add(goPanel, BorderLayout.EAST);
- *
- * _deleteButton.addActionListener(new ActionListener() { public void
- * actionPerformed(ActionEvent e) { _rnaList.removeSelected(); } });
- * _duplicateButton.addActionListener(new ActionListener() { public void
- * actionPerformed(ActionEvent e) {
- * _rnaList.add((VARNAConfig)vp.getConfig().clone
- * (),vp.getRNA().clone(),vp.getRNA
- * ().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new
- * Date()),true); }});
- *
- * JPanel ops = new JPanel(); ops.setLayout(new GridLayout(1,2));
- * ops.add(_deleteButton); ops.add(_duplicateButton);
- *
- * JLabel j = new JLabel("Structures Manager",JLabel.CENTER);
- * _listPanel.setLayout(new BorderLayout());
- *
- * _listPanel.add(ops,BorderLayout.SOUTH);
- * _listPanel.add(j,BorderLayout.NORTH);
- * _listPanel.add(listScroller,BorderLayout.CENTER);
- *
- * goPanel.add(_createButton, BorderLayout.CENTER);
- *
- * JSplitPane split = new
- * JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp);
- * getContentPane().setLayout(new BorderLayout()); getContentPane().add(split,
- * BorderLayout.CENTER); getContentPane().add(_tools, BorderLayout.NORTH);
- *
- * setVisible(true); DropTarget dt = new DropTarget(vp, this);
- *
- * vp.addVARNAListener(this); }
- */
public static String generateDefaultName()
{
return "User file #" + _nextID++;
}
- public RNA getRNA()
- {
- return (RNA) _sideList.getSelectedValue();
- }
-
public String[][] getParameterInfo()
{
- String[][] info =
- {
+ String[][] info = {
// Parameter Name Kind of Value Description,
{ "sequenceDBN", "String", "A raw RNA sequence" },
{ "structureDBN", "String",
return info;
}
- public void init()
- {
- vp.setBackground(_backgroundColor);
- _error = true;
- }
-
@SuppressWarnings("unused")
private Color getSafeColor(String col, Color def)
{
vp = surface;
}
- public String get_seq()
- {
- return _seq.getText();
- }
-
- public void set_seq(String _seq)
- {
- this._seq.setText(_seq);
- }
-
- public String get_str()
- {
- return _str.getText();
- }
-
- public void set_str(String _str)
- {
- this._str.setText(_str);
- }
-
- public JLabel get_info()
- {
- return _info;
- }
-
- public void set_info(JLabel _info)
- {
- this._info = _info;
- }
-
- /*
- * public static void main(String[] args) { AppVarnaBinding d = new
- * AppVarnaBinding(); d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
- * d.pack(); d.setVisible(true); }
- */
-
- public void dragEnter(DropTargetDragEvent arg0)
- {
- // TODO Auto-generated method stub
-
- }
-
- public void dragExit(DropTargetEvent arg0)
- {
- // TODO Auto-generated method stub
-
- }
-
- public void dragOver(DropTargetDragEvent arg0)
- {
- // TODO Auto-generated method stub
-
- }
-
public void drop(DropTargetDropEvent dtde)
{
try
if (c instanceof VARNAPanel)
{
String path = o.toString();
- VARNAPanel vp = (VARNAPanel) c;
+ VARNAPanel varnaPanel = (VARNAPanel) c;
try
{
FullBackup bck = VARNAPanel.importSession(path);
.loadSecStr(path);
for (RNA r : mdls)
{
- r.drawRNA(vp.getConfig());
+ r.drawRNA(varnaPanel.getConfig());
String name = r.getName();
if (name.equals(""))
{
- name = path.substring(path
- .lastIndexOf(File.separatorChar) + 1);
+ name = path.substring(
+ path.lastIndexOf(File.separatorChar) + 1);
}
if (mdls.size() > 1)
{
name += " (Model " + mn++ + ")";
}
- _rnaList.add(vp.getConfig().clone(), r, name, true);
+ _rnaList.add(varnaPanel.getConfig().clone(), r, name,
+ true);
+ // BH 2018 SwingJS clone of varnaPanel or its config will
+ // be the object itself, not a clone
}
}
}
}
- public void dropActionChanged(DropTargetDragEvent arg0)
- {
- }
-
private class BackupHolder
{
- private DefaultListModel _rnaList;
+ private DefaultListModel<FullBackup> _rnalist;
- private ArrayList<RNA> _rnas = new ArrayList<RNA>();
+ private List<RNA> _rnas = new ArrayList<RNA>();
JList _l;
- public BackupHolder(DefaultListModel rnaList, JList l)
+ public BackupHolder(DefaultListModel<FullBackup> rnaList, JList l)
{
- _rnaList = rnaList;
+ _rnalist = rnaList;
_l = l;
}
- public void add(VARNAConfig c, RNA r)
- {
- add(c, r, r.getName(), false);
- }
-
- public void add(VARNAConfig c, RNA r, boolean select)
- {
- add(c, r, r.getName(), select);
- }
-
public void add(VARNAConfig c, RNA r, String name)
{
add(c, r, name, false);
}
+ /**
+ * Adds an entry to the end of the selection list and (optionally) sets it
+ * as selected
+ *
+ * @param c
+ * @param r
+ * @param name
+ * @param select
+ */
public void add(VARNAConfig c, RNA r, String name, boolean select)
{
if (select)
{
- _l.removeSelectionInterval(0, _rnaList.size());
+ _l.removeSelectionInterval(0, _rnalist.size());
}
if (name.equals(""))
{
name = generateDefaultName();
}
FullBackup bck = new FullBackup(c, r, name);
- _rnas.add(0, r);
- _rnaList.add(0, bck);
+ _rnas.add(r);
+ _rnalist.addElement(bck);
if (select)
{
_l.setSelectedIndex(0);
}
}
- public void remove(int i)
- {
- _rnas.remove(i);
- _rnaList.remove(i);
-
- }
-
- public DefaultListModel getModel()
- {
- return _rnaList;
- }
-
- public boolean contains(RNA r)
- {
- return _rnas.contains(r);
- }
-
- /*
- * public int getSize() { return _rnaList.getSize(); }
- */
public FullBackup getElementAt(int i)
{
- return (FullBackup) _rnaList.getElementAt(i);
- }
-
- public void removeSelected()
- {
- int i = _l.getSelectedIndex();
- if (i != -1)
- {
- if (_rnaList.getSize() == 1)
- {
- RNA r = new RNA();
- try
- {
- r.setRNA(" ", ".");
- } catch (ExceptionUnmatchedClosingParentheses e1)
- {
- } catch (ExceptionFileFormatOrSyntax e1)
- {
- }
- vp.showRNA(r);
- vp.repaint();
- }
- else
- {
- int newi = i + 1;
- if (newi == _rnaList.getSize())
- {
- newi = _rnaList.getSize() - 2;
- }
- FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
- _l.setSelectedValue(bck, true);
- }
- _rnaList.remove(i);
- }
-
+ return _rnalist.getElementAt(i);
}
}
- public void onLayoutChanged()
- {
- // TODO Auto-generated method stub
-
- }
-
- public void onUINewStructure(VARNAConfig v, RNA r)
- {
- _rnaList.add(v, r, "", true);
- }
-
- public void onWarningEmitted(String s)
- {
- // TODO Auto-generated method stub
-
- }
-
public void mouseClicked(MouseEvent e)
{
if (e.getClickCount() == 2)
{
int index = _sideList.locationToIndex(e.getPoint());
- ListModel dlm = _sideList.getModel();
- FullBackup item = (FullBackup) dlm.getElementAt(index);
- ;
+ ListModel<FullBackup> dlm = _sideList.getModel();
+ // FullBackup item = dlm.getElementAt(index);
+
_sideList.ensureIndexIsVisible(index);
/*
- * TODO Object newName = JOptionPane.showInputDialog( this,
+ * TODO Object newName = JvOptionPane.showInputDialog( this,
* "Specify a new name for this RNA", "Rename RNA",
- * JOptionPane.QUESTION_MESSAGE, (Icon)null, null, item.toString()); if
+ * JvOptionPane.QUESTION_MESSAGE, (Icon)null, null, item.toString()); if
* (newName!=null) { item.name = newName.toString();
* this._sideList.repaint(); }
*/
}
}
- public void mouseEntered(MouseEvent arg0)
+ @Override
+ public String[] getStructureFiles()
{
- // TODO Auto-generated method stub
-
+ return null;
}
- public void mouseExited(MouseEvent arg0)
+ @Override
+ public void releaseReferences(Object svl)
{
- // TODO Auto-generated method stub
-
}
- public void mousePressed(MouseEvent arg0)
+ @Override
+ public void updateColours(Object source)
{
- // TODO Auto-generated method stub
-
}
- public void mouseReleased(MouseEvent arg0)
+ @Override
+ public void componentHidden(ComponentEvent e)
{
- // TODO Auto-generated method stub
-
}
@Override
- public Color getColour(int atomIndex, int pdbResNum, String chain,
- String pdbId)
+ public void componentMoved(ComponentEvent e)
{
- // TODO Auto-generated method stub
- return null;
}
@Override
- public String[] getPdbFile()
+ public void componentResized(ComponentEvent e)
{
- // TODO Auto-generated method stub
- return null;
}
@Override
- public void highlightAtom(int atomIndex, int pdbResNum, String chain,
- String pdbId)
+ public void componentShown(ComponentEvent e)
{
- // TODO Auto-generated method stub
-
}
@Override
- public void mouseOverStructure(int atomIndex, String strInfo)
+ public void highlightAtoms(List<AtomSpec> atoms)
{
- // TODO Auto-generated method stub
-
}
@Override
- public void releaseReferences(Object svl)
+ public boolean isListeningFor(SequenceI seq)
{
- // TODO Auto-generated method stub
-
+ return true;
}
- @Override
- public void updateColours(Object source)
+ /**
+ * Returns the path to a temporary file containing a representation of the
+ * state of the Varna display, or null on any error
+ *
+ * @param rna
+ * @param jds
+ *
+ * @return
+ */
+ public String getStateInfo(RNA rna)
{
- // TODO Auto-generated method stub
+ if (vp == null)
+ {
+ return null;
+ }
- }
+ /*
+ * we have to show the RNA we want to save in the viewer; get the currently
+ * displayed model first so we can restore it
+ */
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
- @Override
- public void componentHidden(ComponentEvent e)
- {
- // TODO Auto-generated method stub
+ FullBackup model = null;
+ ListModel models = _sideList.getModel();
+ for (int i = 0; i < models.getSize(); i++)
+ {
+ model = (FullBackup) models.getElementAt(i);
+ if (model.rna == rna)
+ {
+ break;
+ }
+ }
+ if (model == null)
+ {
+ return null;
+ }
+
+ /*
+ * switch display
+ */
+ vp.showRNA(model.rna, model.config);
+
+ try
+ {
+ File temp;
+ temp = File.createTempFile("varna", null);
+ temp.deleteOnExit();
+ String filePath = temp.getAbsolutePath();
+ vp.toXML(filePath);
+ /*
+ * restore the previous display
+ */
+ vp.showRNA(sel.rna, sel.config);
+
+ return filePath;
+ } catch (IOException e)
+ {
+ return null;
+ }
}
- @Override
- public void componentMoved(ComponentEvent e)
+ public int getSelectedIndex()
{
- // TODO Auto-generated method stub
-
+ return _sideList.getSelectedIndex();
}
- @Override
- public void componentResized(ComponentEvent e)
+ /**
+ * Switch the Varna display to the structure selected in the left hand panel
+ *
+ * @param evt
+ */
+ protected void changeSelectedStructure_actionPerformed(
+ ListSelectionEvent evt)
{
- // TODO Auto-generated method stub
+ if (!evt.getValueIsAdjusting())
+ {
+ showSelectedStructure();
+ }
+ }
+ /**
+ *
+ */
+ protected void showSelectedStructure()
+ {
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+ if (sel != null)
+ {
+ vp.showRNA(sel.rna, sel.config);
+ }
}
- @Override
- public void componentShown(ComponentEvent e)
+ /**
+ * Set and display the selected item in the list of structures
+ *
+ * @param selectedRna
+ */
+ public void setSelectedIndex(final int selectedRna)
{
- // TODO Auto-generated method stub
+ /*
+ * note this does nothing if, say, selecting item 3 when only 1 has been
+ * added on load
+ */
+ _sideList.setSelectedIndex(selectedRna);
+ // TODO ? need a worker thread to get this to happen properly
+ }
+ /**
+ * Add an RNA structure to the selection list
+ *
+ * @param rna
+ */
+ public void addStructure(RNA rna)
+ {
+ VARNAConfig config = vp.getConfig().clone(); // BH 2018 this will NOT be a
+ // clone in SwingJS
+ addStructure(rna, config);
}
- @Override
- public void onStructureRedrawn()
+ /**
+ * @param rna
+ * @param config
+ */
+ protected void addStructure(final RNA rna, final VARNAConfig config)
{
- // TODO Auto-generated method stub
+ drawRna(rna, config);
+ _rnaList.add(config, rna, rna.getName());
+ }
+ /**
+ * @param rna
+ * @param config
+ */
+ protected void drawRna(final RNA rna, final VARNAConfig config)
+ {
+ try
+ {
+ rna.drawRNA(rna.getDrawMode(), config);
+ } catch (ExceptionNAViewAlgorithm e)
+ {
+ // only throwable for draw mode = 3 NAView
+ jalview.bin.Console.errPrintln("Error drawing RNA: " + e.getMessage());
+ }
}
}
-
-/*
- * public static void main(String[] args) { JTextField str = new
- * JTextField("ATGC");
- *
- * AppVarnaBinding vab = new AppVarnaBinding(); vab.varnagui.set_seq(str);
- * vab.varnagui.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
- * vab.varnagui.pack(); vab.varnagui.setVisible(true); } }
- */