X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;ds=sidebyside;f=src%2Fjalview%2Fgui%2FAppVarnaBinding.java;h=521bb3eb9c8414561a1ec101e22b03a9f37a15d3;hb=3446323f14bb8a2842cb83f74ed3f41c99b62759;hp=1d2d8fd432d14fe76e990045873d5433f2f2cc89;hpb=d6f9234284710c0f6eaa1c51626dde81c4db103a;p=jalview.git
diff --git a/src/jalview/gui/AppVarnaBinding.java b/src/jalview/gui/AppVarnaBinding.java
index 1d2d8fd..521bb3e 100644
--- a/src/jalview/gui/AppVarnaBinding.java
+++ b/src/jalview/gui/AppVarnaBinding.java
@@ -1,868 +1,577 @@
/*
- * Jalview - A Sequence Alignment Editor and Viewer (Version 2.6)
- * Copyright (C) 2010 J Procter, AM Waterhouse, G Barton, M Clamp, S Searle
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
*
* This file is part of Jalview.
*
* Jalview is free software: you can redistribute it and/or
* modify it under the terms of the GNU General Public License
- * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
- *
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *
* Jalview is distributed in the hope that it will be useful, but
* WITHOUT ANY WARRANTY; without even the implied warranty
* of MERCHANTABILITY or FITNESS FOR A PARTICULAR
* PURPOSE. See the GNU General Public License for more details.
*
- * You should have received a copy of the GNU General Public License along with Jalview. If not, see .
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see .
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
*/
package jalview.gui;
+import jalview.datamodel.SequenceI;
+import jalview.ext.varna.JalviewVarnaBinding;
+import jalview.structure.AtomSpec;
+import jalview.util.MessageManager;
+
import java.awt.BorderLayout;
import java.awt.Color;
import java.awt.Component;
import java.awt.Dimension;
-import java.awt.Font;
-import java.awt.GridLayout;
import java.awt.datatransfer.DataFlavor;
import java.awt.datatransfer.Transferable;
import java.awt.dnd.DnDConstants;
import java.awt.dnd.DropTarget;
-import java.awt.dnd.DropTargetDragEvent;
+import java.awt.dnd.DropTargetAdapter;
import java.awt.dnd.DropTargetDropEvent;
-import java.awt.dnd.DropTargetEvent;
-import java.awt.dnd.DropTargetListener;
-import java.awt.event.ActionEvent;
-import java.awt.event.ActionListener;
import java.awt.event.ComponentEvent;
+import java.awt.event.MouseAdapter;
import java.awt.event.MouseEvent;
-import java.awt.event.MouseListener;
import java.io.File;
-import java.text.DateFormat;
+import java.io.IOException;
import java.util.ArrayList;
-import java.util.Date;
+import java.util.Collection;
import java.util.List;
import javax.swing.DefaultListModel;
import javax.swing.DefaultListSelectionModel;
-import javax.swing.Icon;
-import javax.swing.JButton;
-import javax.swing.JFrame;
import javax.swing.JLabel;
import javax.swing.JList;
-import javax.swing.JOptionPane;
import javax.swing.JPanel;
import javax.swing.JScrollPane;
-import javax.swing.JSplitPane;
-import javax.swing.JTextField;
import javax.swing.ListModel;
import javax.swing.ListSelectionModel;
-import javax.swing.UIManager;
-import javax.swing.UnsupportedLookAndFeelException;
import javax.swing.event.ListSelectionEvent;
import javax.swing.event.ListSelectionListener;
import fr.orsay.lri.varna.VARNAPanel;
import fr.orsay.lri.varna.components.ReorderableJList;
-import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed;
+import fr.orsay.lri.varna.exceptions.ExceptionNAViewAlgorithm;
import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
-import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
-import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;
import fr.orsay.lri.varna.models.FullBackup;
import fr.orsay.lri.varna.models.VARNAConfig;
-import fr.orsay.lri.varna.models.rna.Mapping;
import fr.orsay.lri.varna.models.rna.RNA;
-public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding implements DropTargetListener, InterfaceVARNAListener, MouseListener {
-
- /**
- *
- */
- //private static final long serialVersionUID = -790155708306987257L;
-
- private String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA";
- private String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
- private String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...)))))..";
- public VARNAPanel vp;
-
- protected JPanel _tools = new JPanel();
- private JPanel _input = new JPanel();
-
- private JPanel _seqPanel = new JPanel();
- private JPanel _strPanel = new JPanel();
- private JLabel _info = new JLabel();
- private JTextField _str = new JTextField();
- private JTextField _seq = new JTextField();
- private JLabel _strLabel = new JLabel(" Str:");
- private JLabel _seqLabel = new JLabel(" Seq:");
- private JButton _createButton = new JButton("Create");
- private JButton _deleteButton = new JButton("Delete");
- private JButton _duplicateButton = new JButton("Snapshot");
-
- protected JPanel _listPanel = new JPanel();
- private ReorderableJList _sideList = null;
-
-
- private static String errorOpt = "error";
- @SuppressWarnings("unused")
- private boolean _error;
-
- private Color _backgroundColor = Color.white;
-
- private static int _nextID = 1;
- @SuppressWarnings("unused")
- private int _algoCode;
-
- private BackupHolder _rnaList;
-
-
- /*public AppVarnaBinding() {
- //super("VARNA in Jalview");
- //this.set_seq("ATGC");
- //this.set_str(".().");
- //RNAPanelDemoInit();
-
- //initVarna("ATGCATGATATATATATAT","....((((...))))....");
- initVarna(this.DEFAULT_SEQUENCE,this.DEFAULT_STRUCTURE1);
- }*/
-
- public AppVarnaBinding(String seq,String struc){
- //super("VARNA in Jalview");
- initVarna(seq,struc);
- }
-
- public AppVarnaBinding(ArrayList rnaList){
- //super("VARNA in Jalview");
- initVarnaEdit(rnaList);
- }
-
-
-
- private void initVarna(String seq, String str){
- DefaultListModel dlm = new DefaultListModel();
-
- DefaultListSelectionModel m = new DefaultListSelectionModel();
- m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
- m.setLeadAnchorNotificationEnabled(false);
-
- _sideList = new ReorderableJList();
- _sideList.setModel(dlm);
- _sideList.addMouseListener(this);
- _sideList.setSelectionModel(m);
- _sideList.setPreferredSize(new Dimension(100, 0));
- _sideList.addListSelectionListener( new ListSelectionListener(){
- public void valueChanged(ListSelectionEvent arg0) {
- if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
- {
- FullBackup sel = (FullBackup) _sideList.getSelectedValue();
- Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize());
- vp.showRNAInterpolated(sel.rna,sel.config,map);
- _seq.setText(sel.rna.getSeq());
- _str.setText(sel.rna.getStructDBN());
- }
- }
- });
-
- _rnaList = new BackupHolder(dlm,_sideList);
- RNA _RNA1 = new RNA("User defined 1");
-
- try {
- vp = new VARNAPanel("0",".");
- _RNA1.setRNA(seq, str);
- _RNA1.drawRNARadiate(vp.getConfig());
- } catch (ExceptionNonEqualLength e) {
- vp.errorDialog(e);
- } catch (ExceptionUnmatchedClosingParentheses e2) {
- e2.printStackTrace();
- } catch (ExceptionFileFormatOrSyntax e3) {
- e3.printStackTrace();
- }
- vp.setPreferredSize(new Dimension(400, 400));
- _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true);
-
- //TODO setBackground(_backgroundColor);
- vp.setBackground(_backgroundColor);
-
- //TODO getContentPane().setLayout(new BorderLayout());
- //TODO getContentPane().add(vp, BorderLayout.CENTER);
-
- //setVisible(true);
- vp.addVARNAListener(this);
- }
-
- private void initVarnaEdit(ArrayList rnaInList)
- {
- DefaultListModel dlm = new DefaultListModel();
-
-
- //int marginTools = 40;
-
- DefaultListSelectionModel m = new DefaultListSelectionModel();
- m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
- m.setLeadAnchorNotificationEnabled(false);
-
-
- _sideList = new ReorderableJList();
- _sideList.setModel(dlm);
- _sideList.addMouseListener(this);
- _sideList.setSelectionModel(m);
- _sideList.setPreferredSize(new Dimension(100, 0));
- _sideList.addListSelectionListener( new ListSelectionListener(){
- public void valueChanged(ListSelectionEvent arg0) {
- //System.out.println(arg0);
- if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting())
- {
- FullBackup sel = (FullBackup) _sideList.getSelectedValue();
- Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize());
- vp.showRNAInterpolated(sel.rna,sel.config,map);
- //_seq.setText(sel.rna.getSeq());
- //_str.setText(sel.rna.getStructDBN());
- }
- }
- });
-
- _rnaList = new BackupHolder(dlm,_sideList);
-
- try {
- vp = new VARNAPanel("0",".");
- for(int i=0;i _rnas = new ArrayList();
- JList _l;
-
- public BackupHolder(DefaultListModel rnaList, JList l)
- {
- _rnaList = rnaList;
- _l = l;
- }
-
- public void add(VARNAConfig c, RNA r)
- {
- add(c, r, r.getName(),false);
- }
-
- public void add(VARNAConfig c, RNA r,boolean select)
- {
- add(c, r, r.getName(),select);
- }
-
- public void add(VARNAConfig c, RNA r, String name)
- {
- add(c, r, name,false);
- }
- public void add(VARNAConfig c, RNA r, String name, boolean select)
- {
- if (select){
- _l.removeSelectionInterval(0, _rnaList.size());
- }
- if (name.equals(""))
- {
- name = generateDefaultName();
- }
- FullBackup bck = new FullBackup(c,r,name);
- _rnas.add(0, r);
- _rnaList.add(0,bck);
- if (select){
- _l.setSelectedIndex(0);
- }
- }
-
- public void remove(int i)
- {
- _rnas.remove(i);
- _rnaList.remove(i);
-
- }
- public DefaultListModel getModel()
- {
- return _rnaList;
- }
- public boolean contains(RNA r)
- {
- return _rnas.contains(r);
- }
- /*public int getSize()
- {
- return _rnaList.getSize();
- }*/
- public FullBackup getElementAt(int i)
- {
- return (FullBackup) _rnaList.getElementAt(i);
- }
-
- public void removeSelected()
- {
- int i = _l.getSelectedIndex();
- if (i!=-1)
- {
- if (_rnaList.getSize()==1)
- {
- RNA r = new RNA();
- try {
- r.setRNA(" ", ".");
- } catch (ExceptionUnmatchedClosingParentheses e1) {
- } catch (ExceptionFileFormatOrSyntax e1) {
- }
- vp.showRNA(r);
- vp.repaint();
- }
- else
- {
- int newi = i+1;
- if (newi==_rnaList.getSize())
- {
- newi = _rnaList.getSize()-2;
- }
- FullBackup bck = (FullBackup) _rnaList.getElementAt(newi);
- _l.setSelectedValue(bck,true);
- }
- _rnaList.remove(i);
- }
-
- }
- }
-
- public void onLayoutChanged() {
- // TODO Auto-generated method stub
-
- }
-
- public void onUINewStructure(VARNAConfig v, RNA r) {
- _rnaList.add(v, r,"",true);
- }
-
- public void onWarningEmitted(String s) {
- // TODO Auto-generated method stub
-
- }
-
- public void mouseClicked(MouseEvent e) {
- if(e.getClickCount() == 2){
- int index = _sideList.locationToIndex(e.getPoint());
- ListModel dlm = _sideList.getModel();
- FullBackup item = (FullBackup) dlm.getElementAt(index);;
- _sideList.ensureIndexIsVisible(index);
- /*TODO Object newName = JOptionPane.showInputDialog(
- this,
- "Specify a new name for this RNA",
- "Rename RNA",
- JOptionPane.QUESTION_MESSAGE,
- (Icon)null,
- null,
- item.toString());
- if (newName!=null)
- {
- item.name = newName.toString();
- this._sideList.repaint();
- }*/
- }
- }
-
- public void mouseEntered(MouseEvent arg0) {
- // TODO Auto-generated method stub
-
- }
-
- public void mouseExited(MouseEvent arg0) {
- // TODO Auto-generated method stub
-
- }
-
- public void mousePressed(MouseEvent arg0) {
- // TODO Auto-generated method stub
-
- }
-
- public void mouseReleased(MouseEvent arg0) {
- // TODO Auto-generated method stub
-
- }
-
- @Override
- public Color getColour(int atomIndex, int pdbResNum, String chain,
- String pdbId) {
- // TODO Auto-generated method stub
- return null;
- }
-
- @Override
- public String[] getPdbFile() {
- // TODO Auto-generated method stub
- return null;
- }
-
- @Override
- public void highlightAtom(int atomIndex, int pdbResNum, String chain,
- String pdbId) {
- // TODO Auto-generated method stub
-
- }
-
- @Override
- public void mouseOverStructure(int atomIndex, String strInfo) {
- // TODO Auto-generated method stub
-
- }
-
- @Override
- public void releaseReferences(Object svl) {
- // TODO Auto-generated method stub
-
- }
-
- @Override
- public void updateColours(Object source) {
- // TODO Auto-generated method stub
-
- }
-
- @Override
- public void componentHidden(ComponentEvent e) {
- // TODO Auto-generated method stub
-
- }
-
- @Override
- public void componentMoved(ComponentEvent e) {
- // TODO Auto-generated method stub
-
- }
-
- @Override
- public void componentResized(ComponentEvent e) {
- // TODO Auto-generated method stub
-
- }
-
- @Override
- public void componentShown(ComponentEvent e) {
- // TODO Auto-generated method stub
-
- }
-}
-
-
-/*
- public static void main(String[] args)
- {
- JTextField str = new JTextField("ATGC");
-
- AppVarnaBinding vab = new AppVarnaBinding();
- vab.varnagui.set_seq(str);
- vab.varnagui.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
- vab.varnagui.pack();
- vab.varnagui.setVisible(true);
- }
+public class AppVarnaBinding extends JalviewVarnaBinding
+{
+ public VARNAPanel vp;
+
+ protected JPanel _listPanel = new JPanel();
+
+ private ReorderableJList _sideList = null;
+
+ private static String errorOpt = "error";
+
+ @SuppressWarnings("unused")
+ private boolean _error;
+
+ private Color _backgroundColor = Color.white;
+
+ private static int _nextID = 1;
+
+ @SuppressWarnings("unused")
+ private int _algoCode;
+
+ private BackupHolder _rnaList;
+
+ /**
+ * Constructor
+ */
+ public AppVarnaBinding()
+ {
+ init();
+ }
+
+ /**
+ * Constructs the VARNAPanel and an (empty) selection list of structures to
+ * show in it
+ */
+ private void init()
+ {
+ DefaultListModel dlm = new DefaultListModel();
+
+ int marginTools = 40;
+
+ DefaultListSelectionModel m = new DefaultListSelectionModel();
+ m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION);
+ m.setLeadAnchorNotificationEnabled(false);
+
+ _sideList = new ReorderableJList();
+ _sideList.setModel(dlm);
+ _sideList.addMouseListener(new MouseAdapter()
+ {
+ @Override
+ public void mouseClicked(MouseEvent e)
+ {
+ AppVarnaBinding.this.mouseClicked(e);
+ }
+ });
+ _sideList.setSelectionModel(m);
+ _sideList.setPreferredSize(new Dimension(100, 0));
+ _sideList.addListSelectionListener(new ListSelectionListener()
+ {
+ public void valueChanged(ListSelectionEvent evt)
+ {
+ changeSelectedStructure_actionPerformed(evt);
+ }
+ });
+ _rnaList = new BackupHolder(dlm, _sideList);
+
+ try
+ {
+ vp = new VARNAPanel("0", ".");
+ } catch (ExceptionNonEqualLength e)
+ {
+ vp.errorDialog(e);
+ }
+ vp.setPreferredSize(new Dimension(400, 400));
+
+ JScrollPane listScroller = new JScrollPane(_sideList);
+ listScroller.setPreferredSize(new Dimension(150, 0));
+
+ vp.setBackground(_backgroundColor);
+
+ JLabel j = new JLabel(
+ MessageManager.getString("label.structures_manager"),
+ JLabel.CENTER);
+ _listPanel.setLayout(new BorderLayout());
+
+ _listPanel.add(j, BorderLayout.NORTH);
+ _listPanel.add(listScroller, BorderLayout.CENTER);
+
+ new DropTarget(vp, new DropTargetAdapter()
+ {
+ @Override
+ public void drop(DropTargetDropEvent dtde)
+ {
+ AppVarnaBinding.this.drop(dtde);
+ }
+ });
+ }
+
+ public JPanel getListPanel()
+ {
+ return _listPanel;
+ }
+
+ /**
+ * Returns the currently selected RNA, or null if none selected
+ *
+ * @return
+ */
+ public RNA getSelectedRNA()
+ {
+ int selectedIndex = _sideList.getSelectedIndex();
+ if (selectedIndex < 0)
+ {
+ return null;
+ }
+ FullBackup selected = _rnaList.getElementAt(selectedIndex);
+ return selected.rna;
+ }
+
+ /**
+ * Substitute currently selected RNA with the edited one
+ *
+ * @param rnaEdit
+ */
+ public void updateSelectedRNA(RNA rnaEdit)
+ {
+ vp.repaint();
+ vp.showRNA(rnaEdit);
+ }
+
+ public static String generateDefaultName()
+ {
+ return "User file #" + _nextID++;
+ }
+
+ public String[][] getParameterInfo()
+ {
+ String[][] info = {
+ // Parameter Name Kind of Value Description,
+ { "sequenceDBN", "String", "A raw RNA sequence" },
+ { "structureDBN", "String",
+ "An RNA structure in dot bracket notation (DBN)" },
+ { errorOpt, "boolean", "To show errors" }, };
+ return info;
+ }
+
+ @SuppressWarnings("unused")
+ private Color getSafeColor(String col, Color def)
+ {
+ Color result;
+ try
+ {
+ result = Color.decode(col);
+ } catch (Exception e)
+ {
+ try
+ {
+ result = Color.getColor(col, def);
+ } catch (Exception e2)
+ {
+ return def;
+ }
+ }
+ return result;
+ }
+
+ public VARNAPanel get_varnaPanel()
+ {
+ return vp;
+ }
+
+ public void set_varnaPanel(VARNAPanel surface)
+ {
+ vp = surface;
+ }
+
+ public void drop(DropTargetDropEvent dtde)
+ {
+ try
+ {
+ Transferable tr = dtde.getTransferable();
+ DataFlavor[] flavors = tr.getTransferDataFlavors();
+ for (int i = 0; i < flavors.length; i++)
+ {
+ if (flavors[i].isFlavorJavaFileListType())
+ {
+ dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE);
+ Object ob = tr.getTransferData(flavors[i]);
+ if (ob instanceof List)
+ {
+ List list = (List) ob;
+ for (int j = 0; j < list.size(); j++)
+ {
+ Object o = list.get(j);
+
+ if (dtde.getSource() instanceof DropTarget)
+ {
+ DropTarget dt = (DropTarget) dtde.getSource();
+ Component c = dt.getComponent();
+ if (c instanceof VARNAPanel)
+ {
+ String path = o.toString();
+ VARNAPanel varnaPanel = (VARNAPanel) c;
+ try
+ {
+ FullBackup bck = VARNAPanel.importSession(path);
+ _rnaList.add(bck.config, bck.rna, bck.name, true);
+ } catch (ExceptionLoadingFailed e3)
+ {
+ int mn = 1;
+ Collection mdls = fr.orsay.lri.varna.factories.RNAFactory
+ .loadSecStr(path);
+ for (RNA r : mdls)
+ {
+ r.drawRNA(varnaPanel.getConfig());
+ String name = r.getName();
+ if (name.equals(""))
+ {
+ name = path.substring(path
+ .lastIndexOf(File.separatorChar) + 1);
+ }
+ if (mdls.size() > 1)
+ {
+ name += " (Model " + mn++ + ")";
+ }
+ _rnaList.add(varnaPanel.getConfig().clone(), r, name,
+ true);
+ }
+ }
+ }
+ }
+ }
+ }
+ // If we made it this far, everything worked.
+ dtde.dropComplete(true);
+ return;
+ }
+ }
+ // Hmm, the user must not have dropped a file list
+ dtde.rejectDrop();
+ } catch (Exception e)
+ {
+ e.printStackTrace();
+ dtde.rejectDrop();
+ }
+
+ }
+
+ private class BackupHolder
+ {
+ private DefaultListModel _rnalist;
+
+ private List _rnas = new ArrayList();
+
+ JList _l;
+
+ public BackupHolder(DefaultListModel rnaList, JList l)
+ {
+ _rnalist = rnaList;
+ _l = l;
+ }
+
+ public void add(VARNAConfig c, RNA r, String name)
+ {
+ add(c, r, name, false);
+ }
+
+ /**
+ * Adds an entry to the end of the selection list and (optionally) sets it
+ * as selected
+ *
+ * @param c
+ * @param r
+ * @param name
+ * @param select
+ */
+ public void add(VARNAConfig c, RNA r, String name, boolean select)
+ {
+ if (select)
+ {
+ _l.removeSelectionInterval(0, _rnalist.size());
+ }
+ if (name.equals(""))
+ {
+ name = generateDefaultName();
+ }
+ FullBackup bck = new FullBackup(c, r, name);
+ _rnas.add(r);
+ _rnalist.addElement(bck);
+ if (select)
+ {
+ _l.setSelectedIndex(0);
+ }
+ }
+
+ public FullBackup getElementAt(int i)
+ {
+ return _rnalist.getElementAt(i);
+ }
+ }
+
+ public void mouseClicked(MouseEvent e)
+ {
+ if (e.getClickCount() == 2)
+ {
+ int index = _sideList.locationToIndex(e.getPoint());
+ ListModel dlm = _sideList.getModel();
+ // FullBackup item = dlm.getElementAt(index);
+
+ _sideList.ensureIndexIsVisible(index);
+ /*
+ * TODO Object newName = JOptionPane.showInputDialog( this,
+ * "Specify a new name for this RNA", "Rename RNA",
+ * JOptionPane.QUESTION_MESSAGE, (Icon)null, null, item.toString()); if
+ * (newName!=null) { item.name = newName.toString();
+ * this._sideList.repaint(); }
+ */
+ }
+ }
+
+ @Override
+ public String[] getPdbFile()
+ {
+ return null;
+ }
+
+ @Override
+ public void releaseReferences(Object svl)
+ {
+ }
+
+ @Override
+ public void updateColours(Object source)
+ {
+ }
+
+ @Override
+ public void componentHidden(ComponentEvent e)
+ {
+ }
+
+ @Override
+ public void componentMoved(ComponentEvent e)
+ {
+ }
+
+ @Override
+ public void componentResized(ComponentEvent e)
+ {
+ }
+
+ @Override
+ public void componentShown(ComponentEvent e)
+ {
+ }
+
+ @Override
+ public void highlightAtoms(List atoms)
+ {
+ }
+
+ @Override
+ public boolean isListeningFor(SequenceI seq)
+ {
+ return true;
+ }
+
+ /**
+ * Returns the path to a temporary file containing a representation of the
+ * state of the Varna display, or null on any error
+ *
+ * @param rna
+ * @param jds
+ *
+ * @return
+ */
+ public String getStateInfo(RNA rna)
+ {
+ if (vp == null)
+ {
+ return null;
+ }
+
+ /*
+ * we have to show the RNA we want to save in the viewer; get the currently
+ * displayed model first so we can restore it
+ */
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+
+ FullBackup model = null;
+ ListModel models = _sideList.getModel();
+ for (int i = 0; i < models.getSize(); i++)
+ {
+ model = (FullBackup) models.getElementAt(i);
+ if (model.rna == rna)
+ {
+ break;
+ }
+ }
+ if (model == null)
+ {
+ return null;
+ }
+
+ /*
+ * switch display
+ */
+ vp.showRNA(model.rna, model.config);
+
+ try
+ {
+ File temp;
+ temp = File.createTempFile("varna", null);
+ temp.deleteOnExit();
+ String filePath = temp.getAbsolutePath();
+ vp.toXML(filePath);
+
+ /*
+ * restore the previous display
+ */
+ vp.showRNA(sel.rna, sel.config);
+
+ return filePath;
+ } catch (IOException e)
+ {
+ return null;
+ }
+ }
+
+ public int getSelectedIndex()
+ {
+ return _sideList.getSelectedIndex();
+ }
+
+ /**
+ * Switch the Varna display to the structure selected in the left hand panel
+ *
+ * @param evt
+ */
+ protected void changeSelectedStructure_actionPerformed(
+ ListSelectionEvent evt)
+ {
+ if (!evt.getValueIsAdjusting())
+ {
+ showSelectedStructure();
+ }
+ }
+
+ /**
+ *
+ */
+ protected void showSelectedStructure()
+ {
+ FullBackup sel = (FullBackup) _sideList.getSelectedValue();
+ if (sel != null)
+ {
+ vp.showRNA(sel.rna, sel.config);
+ }
+ }
+
+ /**
+ * Set and display the selected item in the list of structures
+ *
+ * @param selectedRna
+ */
+ public void setSelectedIndex(final int selectedRna)
+ {
+ /*
+ * note this does nothing if, say, selecting item 3 when only 1 has been
+ * added on load
+ */
+ _sideList.setSelectedIndex(selectedRna);
+ // TODO ? need a worker thread to get this to happen properly
+ }
+
+ /**
+ * Add an RNA structure to the selection list
+ *
+ * @param rna
+ */
+ public void addStructure(RNA rna)
+ {
+ VARNAConfig config = vp.getConfig().clone();
+ addStructure(rna, config);
+ }
+
+ /**
+ * @param rna
+ * @param config
+ */
+ protected void addStructure(final RNA rna, final VARNAConfig config)
+ {
+ drawRna(rna, config);
+ _rnaList.add(config, rna, rna.getName());
+ }
+
+ /**
+ * @param rna
+ * @param config
+ */
+ protected void drawRna(final RNA rna, final VARNAConfig config)
+ {
+ try
+ {
+ rna.drawRNA(rna.getDrawMode(), config);
+ } catch (ExceptionNAViewAlgorithm e)
+ {
+ // only throwable for draw mode = 3 NAView
+ System.err.println("Error drawing RNA: " + e.getMessage());
+ }
+ }
}
-*/
\ No newline at end of file