X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;ds=sidebyside;f=test%2Fjalview%2Fanalysis%2FAlignmentUtilsTests.java;h=128bc5c8e994369b950840d62d35f0cb093546f0;hb=4f936503eb2c2122f5034b82ceb0d5253778d98b;hp=8bdd7403bf34d573b8052608d20dbd85019cc106;hpb=6c52cc0b81ae3abdc3c5f6f88a23364a0246351a;p=jalview.git diff --git a/test/jalview/analysis/AlignmentUtilsTests.java b/test/jalview/analysis/AlignmentUtilsTests.java index 8bdd740..128bc5c 100644 --- a/test/jalview/analysis/AlignmentUtilsTests.java +++ b/test/jalview/analysis/AlignmentUtilsTests.java @@ -22,79 +22,59 @@ package jalview.analysis; import static org.testng.AssertJUnit.assertEquals; import static org.testng.AssertJUnit.assertFalse; +import static org.testng.AssertJUnit.assertNotNull; import static org.testng.AssertJUnit.assertNull; import static org.testng.AssertJUnit.assertSame; import static org.testng.AssertJUnit.assertTrue; +import jalview.analysis.AlignmentUtils.DnaVariant; import jalview.datamodel.AlignedCodonFrame; import jalview.datamodel.Alignment; import jalview.datamodel.AlignmentAnnotation; import jalview.datamodel.AlignmentI; import jalview.datamodel.Annotation; import jalview.datamodel.DBRefEntry; +import jalview.datamodel.GeneLociI; import jalview.datamodel.Mapping; -import jalview.datamodel.SearchResults; -import jalview.datamodel.SearchResults.Match; +import jalview.datamodel.SearchResultMatchI; +import jalview.datamodel.SearchResultsI; import jalview.datamodel.Sequence; import jalview.datamodel.SequenceFeature; import jalview.datamodel.SequenceI; +import jalview.datamodel.features.SequenceFeatures; +import jalview.gui.JvOptionPane; import jalview.io.AppletFormatAdapter; +import jalview.io.DataSourceType; +import jalview.io.FileFormat; +import jalview.io.FileFormatI; import jalview.io.FormatAdapter; +import jalview.io.gff.SequenceOntologyI; import jalview.util.MapList; import jalview.util.MappingUtils; import java.io.IOException; import java.util.ArrayList; import java.util.Arrays; -import java.util.HashSet; -import java.util.Iterator; import java.util.LinkedHashMap; import java.util.List; import java.util.Map; -import java.util.Set; +import java.util.TreeMap; +import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; public class AlignmentUtilsTests { - // @formatter:off - private static final String TEST_DATA = - "# STOCKHOLM 1.0\n" + - "#=GS D.melanogaster.1 AC AY119185.1/838-902\n" + - "#=GS D.melanogaster.2 AC AC092237.1/57223-57161\n" + - "#=GS D.melanogaster.3 AC AY060611.1/560-627\n" + - "D.melanogaster.1 G.AGCC.CU...AUGAUCGA\n" + - "#=GR D.melanogaster.1 SS ................((((\n" + - "D.melanogaster.2 C.AUUCAACU.UAUGAGGAU\n" + - "#=GR D.melanogaster.2 SS ................((((\n" + - "D.melanogaster.3 G.UGGCGCU..UAUGACGCA\n" + - "#=GR D.melanogaster.3 SS (.(((...(....(((((((\n" + - "//"; - - private static final String AA_SEQS_1 = - ">Seq1Name\n" + - "K-QY--L\n" + - ">Seq2Name\n" + - "-R-FP-W-\n"; - - private static final String CDNA_SEQS_1 = - ">Seq1Name\n" + - "AC-GG--CUC-CAA-CT\n" + - ">Seq2Name\n" + - "-CG-TTA--ACG---AAGT\n"; - - private static final String CDNA_SEQS_2 = - ">Seq1Name\n" + - "GCTCGUCGTACT\n" + - ">Seq2Name\n" + - "GGGTCAGGCAGT\n"; - // @formatter:on - - // public static Sequence ts=new - // Sequence("short","ASDASDASDASDASDASDASDASDASDASDASDASDASD"); - public static Sequence ts = new Sequence("short", + private static Sequence ts = new Sequence("short", "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklm"); + @BeforeClass(alwaysRun = true) + public void setUpJvOptionPane() + { + JvOptionPane.setInteractiveMode(false); + JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION); + } + @Test(groups = { "Functional" }) public void testExpandContext() { @@ -104,14 +84,15 @@ public class AlignmentUtilsTests SequenceI s1 = ts.deriveSequence().getSubSequence(i, i + 7); al.addSequence(s1); } - System.out.println(new AppletFormatAdapter().formatSequences("Clustal", + System.out.println(new AppletFormatAdapter().formatSequences( + FileFormat.Clustal, al, true)); for (int flnk = -1; flnk < 25; flnk++) { AlignmentI exp = AlignmentUtils.expandContext(al, flnk); System.out.println("\nFlank size: " + flnk); System.out.println(new AppletFormatAdapter().formatSequences( - "Clustal", exp, true)); + FileFormat.Clustal, exp, true)); if (flnk == -1) { /* @@ -244,7 +225,7 @@ public class AlignmentUtilsTests { final String data = ">Seq1Name\nKQYL\n" + ">Seq2Name\nRFPW\n" + ">Seq1Name\nABCD\n"; - AlignmentI al = loadAlignment(data, "FASTA"); + AlignmentI al = loadAlignment(data, FileFormat.Fasta); Map> map = AlignmentUtils .getSequencesByName(al); assertEquals(2, map.keySet().size()); @@ -264,11 +245,11 @@ public class AlignmentUtilsTests * @return * @throws IOException */ - protected AlignmentI loadAlignment(final String data, String format) + protected AlignmentI loadAlignment(final String data, FileFormatI format) throws IOException { AlignmentI a = new FormatAdapter().readFile(data, - AppletFormatAdapter.PASTE, format); + DataSourceType.PASTE, format); a.setDataset(null); return a; } @@ -283,14 +264,14 @@ public class AlignmentUtilsTests @Test(groups = { "Functional" }) public void testMapProteinAlignmentToCdna_noXrefs() throws IOException { - List protseqs = new ArrayList(); + List protseqs = new ArrayList<>(); protseqs.add(new Sequence("UNIPROT|V12345", "EIQ")); protseqs.add(new Sequence("UNIPROT|V12346", "EIQ")); protseqs.add(new Sequence("UNIPROT|V12347", "SAR")); AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3])); protein.setDataset(null); - List dnaseqs = new ArrayList(); + List dnaseqs = new ArrayList<>(); dnaseqs.add(new Sequence("EMBL|A11111", "TCAGCACGC")); // = SAR dnaseqs.add(new Sequence("EMBL|A22222", "GAGATACAA")); // = EIQ dnaseqs.add(new Sequence("EMBL|A33333", "GAAATCCAG")); // = EIQ @@ -474,7 +455,8 @@ public class AlignmentUtilsTests SequenceI alignFrom = new Sequence("Seq2", alignModel); alignFrom.createDatasetSequence(); AlignedCodonFrame acf = new AlignedCodonFrame(); - acf.addMap(alignMe.getDatasetSequence(), alignFrom.getDatasetSequence(), map); + acf.addMap(alignMe.getDatasetSequence(), + alignFrom.getDatasetSequence(), map); AlignmentUtils.alignSequenceAs(alignMe, alignFrom, acf, "---", '-', preserveMappedGaps, preserveUnmappedGaps); @@ -498,30 +480,6 @@ public class AlignmentUtilsTests } /** - * Test for the method that generates an aligned translated sequence from one - * mapping. - */ - @Test(groups = { "Functional" }) - public void testGetAlignedTranslation_dnaLikeProtein() - { - // dna alignment will be replaced - SequenceI dna = new Sequence("Seq1", "T-G-CC-A--T-TAC-CAG-"); - dna.createDatasetSequence(); - // protein alignment will be 'applied' to dna - SequenceI protein = new Sequence("Seq1", "-CH-Y--Q-"); - protein.createDatasetSequence(); - MapList map = new MapList(new int[] { 1, 12 }, new int[] { 1, 4 }, 3, 1); - AlignedCodonFrame acf = new AlignedCodonFrame(); - acf.addMap(dna.getDatasetSequence(), protein.getDatasetSequence(), map); - - final SequenceI aligned = AlignmentUtils.getAlignedTranslation(protein, - '-', acf); - assertEquals("---TGCCAT---TAC------CAG---", - aligned.getSequenceAsString()); - assertSame(aligned.getDatasetSequence(), dna.getDatasetSequence()); - } - - /** * Test the method that realigns protein to match mapped codon alignment. */ @Test(groups = { "Functional" }) @@ -550,7 +508,7 @@ public class AlignmentUtilsTests acf.addMap(dna1.getDatasetSequence(), prot1.getDatasetSequence(), map); acf.addMap(dna2.getDatasetSequence(), prot2.getDatasetSequence(), map); acf.addMap(dna3.getDatasetSequence(), prot3.getDatasetSequence(), map); - ArrayList acfs = new ArrayList(); + ArrayList acfs = new ArrayList<>(); acfs.add(acf); protein.setCodonFrames(acfs); @@ -648,14 +606,14 @@ public class AlignmentUtilsTests public void testMapProteinAlignmentToCdna_withStartAndStopCodons() throws IOException { - List protseqs = new ArrayList(); + List protseqs = new ArrayList<>(); protseqs.add(new Sequence("UNIPROT|V12345", "EIQ")); protseqs.add(new Sequence("UNIPROT|V12346", "EIQ")); protseqs.add(new Sequence("UNIPROT|V12347", "SAR")); AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3])); protein.setDataset(null); - List dnaseqs = new ArrayList(); + List dnaseqs = new ArrayList<>(); // start + SAR: dnaseqs.add(new Sequence("EMBL|A11111", "ATGTCAGCACGC")); // = EIQ + stop @@ -740,14 +698,14 @@ public class AlignmentUtilsTests @Test(groups = { "Functional" }) public void testMapProteinAlignmentToCdna_withXrefs() throws IOException { - List protseqs = new ArrayList(); + List protseqs = new ArrayList<>(); protseqs.add(new Sequence("UNIPROT|V12345", "EIQ")); protseqs.add(new Sequence("UNIPROT|V12346", "EIQ")); protseqs.add(new Sequence("UNIPROT|V12347", "SAR")); AlignmentI protein = new Alignment(protseqs.toArray(new SequenceI[3])); protein.setDataset(null); - List dnaseqs = new ArrayList(); + List dnaseqs = new ArrayList<>(); dnaseqs.add(new Sequence("EMBL|A11111", "TCAGCACGC")); // = SAR dnaseqs.add(new Sequence("EMBL|A22222", "ATGGAGATACAA")); // = start + EIQ dnaseqs.add(new Sequence("EMBL|A33333", "GAAATCCAG")); // = EIQ @@ -817,14 +775,14 @@ public class AlignmentUtilsTests public void testMapProteinAlignmentToCdna_prioritiseXrefs() throws IOException { - List protseqs = new ArrayList(); + List protseqs = new ArrayList<>(); protseqs.add(new Sequence("UNIPROT|V12345", "EIQ")); protseqs.add(new Sequence("UNIPROT|V12346", "EIQ")); AlignmentI protein = new Alignment( protseqs.toArray(new SequenceI[protseqs.size()])); protein.setDataset(null); - List dnaseqs = new ArrayList(); + List dnaseqs = new ArrayList<>(); dnaseqs.add(new Sequence("EMBL|A11111", "GAAATCCAG")); // = EIQ dnaseqs.add(new Sequence("EMBL|A22222", "GAAATTCAG")); // = EIQ AlignmentI cdna = new Alignment(dnaseqs.toArray(new SequenceI[dnaseqs @@ -891,8 +849,8 @@ public class AlignmentUtilsTests al.addAnnotation(ann4); // Temp for seq1 al.addAnnotation(ann5); // Temp for seq2 al.addAnnotation(ann6); // Temp for no sequence - List types = new ArrayList(); - List scope = new ArrayList(); + List types = new ArrayList<>(); + List scope = new ArrayList<>(); /* * Set all sequence related Structure to hidden (ann1, ann2) @@ -1033,157 +991,238 @@ public class AlignmentUtilsTests @Test(groups = { "Functional" }) public void testMakeCdsAlignment() { + /* + * scenario: + * dna1 --> [4, 6] [10,12] --> pep1 + * dna2 --> [1, 3] [7, 9] [13,15] --> pep2 + */ SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa"); SequenceI dna2 = new Sequence("dna2", "GGGcccTTTaaaCCC"); SequenceI pep1 = new Sequence("pep1", "GF"); SequenceI pep2 = new Sequence("pep2", "GFP"); + pep1.addDBRef(new DBRefEntry("UNIPROT", "0", "pep1")); + pep2.addDBRef(new DBRefEntry("UNIPROT", "0", "pep2")); dna1.createDatasetSequence(); dna2.createDatasetSequence(); pep1.createDatasetSequence(); pep2.createDatasetSequence(); - dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 6, 0f, - null)); - dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 10, 12, 0f, - null)); - dna2.addSequenceFeature(new SequenceFeature("CDS", "cds3", 1, 3, 0f, - null)); - dna2.addSequenceFeature(new SequenceFeature("CDS", "cds4", 7, 9, 0f, - null)); - dna2.addSequenceFeature(new SequenceFeature("CDS", "cds5", 13, 15, 0f, - null)); AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2 }); dna.setDataset(null); - List mappings = new ArrayList(); - MapList map = new MapList(new int[] { 4, 6, 10, 12 }, - new int[] { 1, 2 }, 3, 1); + /* + * put a variant feature on dna2 base 8 + * - should transfer to cds2 base 5 + */ + dna2.addSequenceFeature(new SequenceFeature("variant", "hgmd", 8, 8, + 0f, null)); + + /* + * need a sourceDbRef if we are to construct dbrefs to the CDS + * sequence from the dna contig sequences + */ + DBRefEntry dbref = new DBRefEntry("ENSEMBL", "0", "dna1"); + dna1.getDatasetSequence().addDBRef(dbref); + org.testng.Assert.assertEquals(dbref, dna1.getPrimaryDBRefs().get(0)); + dbref = new DBRefEntry("ENSEMBL", "0", "dna2"); + dna2.getDatasetSequence().addDBRef(dbref); + org.testng.Assert.assertEquals(dbref, dna2.getPrimaryDBRefs().get(0)); + + /* + * CDS sequences are 'discovered' from dna-to-protein mappings on the alignment + * dataset (e.g. added from dbrefs by CrossRef.findXrefSequences) + */ + MapList mapfordna1 = new MapList(new int[] { 4, 6, 10, 12 }, new int[] { + 1, 2 }, 3, 1); AlignedCodonFrame acf = new AlignedCodonFrame(); - acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map); - mappings.add(acf); - map = new MapList(new int[] { 1, 3, 7, 9, 13, 15 }, new int[] { 1, 3 }, - 3, 1); + acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), + mapfordna1); + dna.addCodonFrame(acf); + MapList mapfordna2 = new MapList(new int[] { 1, 3, 7, 9, 13, 15 }, + new int[] { 1, 3 }, 3, 1); acf = new AlignedCodonFrame(); - acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), map); - mappings.add(acf); + acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), + mapfordna2); + dna.addCodonFrame(acf); + + /* + * In this case, mappings originally came from matching Uniprot accessions + * - so need an xref on dna involving those regions. + * These are normally constructed from CDS annotation + */ + DBRefEntry dna1xref = new DBRefEntry("UNIPROT", "ENSEMBL", "pep1", + new Mapping(mapfordna1)); + dna1.addDBRef(dna1xref); + assertEquals(2, dna1.getDBRefs().length); // to self and to pep1 + DBRefEntry dna2xref = new DBRefEntry("UNIPROT", "ENSEMBL", "pep2", + new Mapping(mapfordna2)); + dna2.addDBRef(dna2xref); + assertEquals(2, dna2.getDBRefs().length); // to self and to pep2 + /* + * execute method under test: + */ AlignmentI cds = AlignmentUtils.makeCdsAlignment(new SequenceI[] { - dna1, dna2 }, mappings, dna); + dna1, dna2 }, dna.getDataset(), null); + + /* + * verify cds sequences + */ assertEquals(2, cds.getSequences().size()); - assertEquals("---GGG---TTT---", cds.getSequenceAt(0) - .getSequenceAsString()); - assertEquals("GGG---TTT---CCC", cds.getSequenceAt(1) - .getSequenceAsString()); + assertEquals("GGGTTT", cds.getSequenceAt(0).getSequenceAsString()); + assertEquals("GGGTTTCCC", cds.getSequenceAt(1).getSequenceAsString()); /* * verify shared, extended alignment dataset */ assertSame(dna.getDataset(), cds.getDataset()); - assertTrue(dna.getDataset().getSequences() - .contains(cds.getSequenceAt(0).getDatasetSequence())); - assertTrue(dna.getDataset().getSequences() - .contains(cds.getSequenceAt(1).getDatasetSequence())); + SequenceI cds1Dss = cds.getSequenceAt(0).getDatasetSequence(); + SequenceI cds2Dss = cds.getSequenceAt(1).getDatasetSequence(); + assertTrue(dna.getDataset().getSequences().contains(cds1Dss)); + assertTrue(dna.getDataset().getSequences().contains(cds2Dss)); + + /* + * verify CDS has a dbref with mapping to peptide + */ + assertNotNull(cds1Dss.getDBRefs()); + assertEquals(2, cds1Dss.getDBRefs().length); + dbref = cds1Dss.getDBRefs()[0]; + assertEquals(dna1xref.getSource(), dbref.getSource()); + // version is via ensembl's primary ref + assertEquals(dna1xref.getVersion(), dbref.getVersion()); + assertEquals(dna1xref.getAccessionId(), dbref.getAccessionId()); + assertNotNull(dbref.getMap()); + assertSame(pep1.getDatasetSequence(), dbref.getMap().getTo()); + MapList cdsMapping = new MapList(new int[] { 1, 6 }, + new int[] { 1, 2 }, 3, 1); + assertEquals(cdsMapping, dbref.getMap().getMap()); /* - * Verify updated mappings + * verify peptide has added a dbref with reverse mapping to CDS */ - assertEquals(2, mappings.size()); + assertNotNull(pep1.getDBRefs()); + // FIXME pep1.getDBRefs() is 1 - is that the correct behaviour ? + assertEquals(2, pep1.getDBRefs().length); + dbref = pep1.getDBRefs()[1]; + assertEquals("ENSEMBL", dbref.getSource()); + assertEquals("0", dbref.getVersion()); + assertEquals("CDS|dna1", dbref.getAccessionId()); + assertNotNull(dbref.getMap()); + assertSame(cds1Dss, dbref.getMap().getTo()); + assertEquals(cdsMapping.getInverse(), dbref.getMap().getMap()); /* + * verify cDNA has added a dbref with mapping to CDS + */ + assertEquals(3, dna1.getDBRefs().length); + DBRefEntry dbRefEntry = dna1.getDBRefs()[2]; + assertSame(cds1Dss, dbRefEntry.getMap().getTo()); + MapList dnaToCdsMapping = new MapList(new int[] { 4, 6, 10, 12 }, + new int[] { 1, 6 }, 1, 1); + assertEquals(dnaToCdsMapping, dbRefEntry.getMap().getMap()); + assertEquals(3, dna2.getDBRefs().length); + dbRefEntry = dna2.getDBRefs()[2]; + assertSame(cds2Dss, dbRefEntry.getMap().getTo()); + dnaToCdsMapping = new MapList(new int[] { 1, 3, 7, 9, 13, 15 }, + new int[] { 1, 9 }, 1, 1); + assertEquals(dnaToCdsMapping, dbRefEntry.getMap().getMap()); + + /* + * verify CDS has added a dbref with mapping to cDNA + */ + assertEquals(2, cds1Dss.getDBRefs().length); + dbRefEntry = cds1Dss.getDBRefs()[1]; + assertSame(dna1.getDatasetSequence(), dbRefEntry.getMap().getTo()); + MapList cdsToDnaMapping = new MapList(new int[] { 1, 6 }, new int[] { + 4, 6, 10, 12 }, 1, 1); + assertEquals(cdsToDnaMapping, dbRefEntry.getMap().getMap()); + assertEquals(2, cds2Dss.getDBRefs().length); + dbRefEntry = cds2Dss.getDBRefs()[1]; + assertSame(dna2.getDatasetSequence(), dbRefEntry.getMap().getTo()); + cdsToDnaMapping = new MapList(new int[] { 1, 9 }, new int[] { 1, 3, 7, + 9, 13, 15 }, 1, 1); + assertEquals(cdsToDnaMapping, dbRefEntry.getMap().getMap()); + + /* + * Verify mappings from CDS to peptide, cDNA to CDS, and cDNA to peptide + * the mappings are on the shared alignment dataset + * 6 mappings, 2*(DNA->CDS), 2*(DNA->Pep), 2*(CDS->Pep) + */ + List cdsMappings = cds.getDataset().getCodonFrames(); + assertEquals(6, cdsMappings.size()); + + /* + * verify that mapping sets for dna and cds alignments are different + * [not current behaviour - all mappings are on the alignment dataset] + */ + // select -> subselect type to test. + // Assert.assertNotSame(dna.getCodonFrames(), cds.getCodonFrames()); + // assertEquals(4, dna.getCodonFrames().size()); + // assertEquals(4, cds.getCodonFrames().size()); + + /* + * Two mappings involve pep1 (dna to pep1, cds to pep1) * Mapping from pep1 to GGGTTT in first new exon sequence */ - List pep1Mapping = MappingUtils - .findMappingsForSequence(pep1, mappings); - assertEquals(1, pep1Mapping.size()); + List pep1Mappings = MappingUtils + .findMappingsForSequence(pep1, cdsMappings); + assertEquals(2, pep1Mappings.size()); + List mappings = MappingUtils + .findMappingsForSequence(cds.getSequenceAt(0), pep1Mappings); + assertEquals(1, mappings.size()); + // map G to GGG - SearchResults sr = MappingUtils.buildSearchResults(pep1, 1, mappings); + SearchResultsI sr = MappingUtils.buildSearchResults(pep1, 1, mappings); assertEquals(1, sr.getResults().size()); - Match m = sr.getResults().get(0); - assertSame(cds.getSequenceAt(0).getDatasetSequence(), - m.getSequence()); + SearchResultMatchI m = sr.getResults().get(0); + assertSame(cds1Dss, m.getSequence()); assertEquals(1, m.getStart()); assertEquals(3, m.getEnd()); // map F to TTT sr = MappingUtils.buildSearchResults(pep1, 2, mappings); m = sr.getResults().get(0); - assertSame(cds.getSequenceAt(0).getDatasetSequence(), - m.getSequence()); + assertSame(cds1Dss, m.getSequence()); assertEquals(4, m.getStart()); assertEquals(6, m.getEnd()); /* - * Mapping from pep2 to GGGTTTCCC in second new exon sequence + * Two mappings involve pep2 (dna to pep2, cds to pep2) + * Verify mapping from pep2 to GGGTTTCCC in second new exon sequence */ - List pep2Mapping = MappingUtils - .findMappingsForSequence(pep2, mappings); - assertEquals(1, pep2Mapping.size()); + List pep2Mappings = MappingUtils + .findMappingsForSequence(pep2, cdsMappings); + assertEquals(2, pep2Mappings.size()); + mappings = MappingUtils.findMappingsForSequence(cds.getSequenceAt(1), + pep2Mappings); + assertEquals(1, mappings.size()); // map G to GGG sr = MappingUtils.buildSearchResults(pep2, 1, mappings); assertEquals(1, sr.getResults().size()); m = sr.getResults().get(0); - assertSame(cds.getSequenceAt(1).getDatasetSequence(), - m.getSequence()); + assertSame(cds2Dss, m.getSequence()); assertEquals(1, m.getStart()); assertEquals(3, m.getEnd()); // map F to TTT sr = MappingUtils.buildSearchResults(pep2, 2, mappings); m = sr.getResults().get(0); - assertSame(cds.getSequenceAt(1).getDatasetSequence(), - m.getSequence()); + assertSame(cds2Dss, m.getSequence()); assertEquals(4, m.getStart()); assertEquals(6, m.getEnd()); // map P to CCC sr = MappingUtils.buildSearchResults(pep2, 3, mappings); m = sr.getResults().get(0); - assertSame(cds.getSequenceAt(1).getDatasetSequence(), - m.getSequence()); + assertSame(cds2Dss, m.getSequence()); assertEquals(7, m.getStart()); assertEquals(9, m.getEnd()); - } - - /** - * Test the method that makes a cds-only sequence from a DNA sequence and its - * product mapping. Test includes the expected case that the DNA sequence - * already has a protein product (Uniprot translation) which in turn has an - * x-ref to the EMBLCDS record. - */ - @Test(groups = { "Functional" }) - public void testMakeCdsSequences() - { - SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa"); - SequenceI pep1 = new Sequence("pep1", "GF"); - dna1.createDatasetSequence(); - pep1.createDatasetSequence(); - pep1.getDatasetSequence().addDBRef( - new DBRefEntry("EMBLCDS", "2", "A12345")); /* - * Make the mapping from dna to protein. The protein sequence has a DBRef to - * EMBLCDS|A12345. + * check cds2 acquired a variant feature in position 5 */ - Set mappings = new HashSet(); - MapList map = new MapList(new int[] { 4, 6, 10, 12 }, - new int[] { 1, 2 }, 3, 1); - AlignedCodonFrame acf = new AlignedCodonFrame(); - acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map); - mappings.add(acf); - - AlignedCodonFrame newMapping = new AlignedCodonFrame(); - List ungappedColumns = new ArrayList(); - ungappedColumns.add(new int[] { 4, 6 }); - ungappedColumns.add(new int[] { 10, 12 }); - List cdsSeqs = AlignmentUtils.makeCdsSequences(dna1, acf, - ungappedColumns, - newMapping, '-'); - assertEquals(1, cdsSeqs.size()); - SequenceI cdsSeq = cdsSeqs.get(0); - - assertEquals("GGGTTT", cdsSeq.getSequenceAsString()); - assertEquals("dna1|A12345", cdsSeq.getName()); - assertEquals(1, cdsSeq.getDBRefs().length); - DBRefEntry cdsRef = cdsSeq.getDBRefs()[0]; - assertEquals("EMBLCDS", cdsRef.getSource()); - assertEquals("2", cdsRef.getVersion()); - assertEquals("A12345", cdsRef.getAccessionId()); + List sfs = cds2Dss.getSequenceFeatures(); + assertNotNull(sfs); + assertEquals(1, sfs.size()); + assertEquals("variant", sfs.get(0).type); + assertEquals(5, sfs.get(0).begin); + assertEquals(5, sfs.get(0).end); } /** @@ -1202,18 +1241,6 @@ public class AlignmentUtilsTests pep1.createDatasetSequence(); pep2.createDatasetSequence(); pep3.createDatasetSequence(); - dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 6, 0f, - null)); - dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 10, 12, 0f, - null)); - dna1.addSequenceFeature(new SequenceFeature("CDS", "cds3", 1, 3, 0f, - null)); - dna1.addSequenceFeature(new SequenceFeature("CDS", "cds4", 7, 9, 0f, - null)); - dna1.addSequenceFeature(new SequenceFeature("CDS", "cds5", 1, 3, 0f, - null)); - dna1.addSequenceFeature(new SequenceFeature("CDS", "cds6", 10, 12, 0f, - null)); pep1.getDatasetSequence().addDBRef( new DBRefEntry("EMBLCDS", "2", "A12345")); pep2.getDatasetSequence().addDBRef( @@ -1222,47 +1249,49 @@ public class AlignmentUtilsTests new DBRefEntry("EMBLCDS", "4", "A12347")); /* + * Create the CDS alignment + */ + AlignmentI dna = new Alignment(new SequenceI[] { dna1 }); + dna.setDataset(null); + + /* * Make the mappings from dna to protein */ - List mappings = new ArrayList(); // map ...GGG...TTT to GF MapList map = new MapList(new int[] { 4, 6, 10, 12 }, new int[] { 1, 2 }, 3, 1); AlignedCodonFrame acf = new AlignedCodonFrame(); acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map); - mappings.add(acf); + dna.addCodonFrame(acf); // map aaa...ccc to KP map = new MapList(new int[] { 1, 3, 7, 9 }, new int[] { 1, 2 }, 3, 1); acf = new AlignedCodonFrame(); acf.addMap(dna1.getDatasetSequence(), pep2.getDatasetSequence(), map); - mappings.add(acf); + dna.addCodonFrame(acf); // map aaa......TTT to KF map = new MapList(new int[] { 1, 3, 10, 12 }, new int[] { 1, 2 }, 3, 1); acf = new AlignedCodonFrame(); acf.addMap(dna1.getDatasetSequence(), pep3.getDatasetSequence(), map); - mappings.add(acf); + dna.addCodonFrame(acf); /* - * Create the Exon alignment; also replaces the dna-to-protein mappings with - * exon-to-protein and exon-to-dna mappings + * execute method under test */ - AlignmentI dna = new Alignment(new SequenceI[] { dna1 }); - dna.setDataset(null); - AlignmentI exal = AlignmentUtils.makeCdsAlignment( - new SequenceI[] { dna1 }, mappings, dna); + AlignmentI cdsal = AlignmentUtils.makeCdsAlignment( + new SequenceI[] { dna1 }, dna.getDataset(), null); /* * Verify we have 3 cds sequences, mapped to pep1/2/3 respectively */ - List cds = exal.getSequences(); + List cds = cdsal.getSequences(); assertEquals(3, cds.size()); /* * verify shared, extended alignment dataset */ - assertSame(exal.getDataset(), dna.getDataset()); + assertSame(cdsal.getDataset(), dna.getDataset()); assertTrue(dna.getDataset().getSequences() .contains(cds.get(0).getDatasetSequence())); assertTrue(dna.getDataset().getSequences() @@ -1274,74 +1303,106 @@ public class AlignmentUtilsTests * verify aligned cds sequences and their xrefs */ SequenceI cdsSeq = cds.get(0); - assertEquals("---GGG---TTT", cdsSeq.getSequenceAsString()); - assertEquals("dna1|A12345", cdsSeq.getName()); - assertEquals(1, cdsSeq.getDBRefs().length); - DBRefEntry cdsRef = cdsSeq.getDBRefs()[0]; - assertEquals("EMBLCDS", cdsRef.getSource()); - assertEquals("2", cdsRef.getVersion()); - assertEquals("A12345", cdsRef.getAccessionId()); + assertEquals("GGGTTT", cdsSeq.getSequenceAsString()); + // assertEquals("dna1|A12345", cdsSeq.getName()); + assertEquals("CDS|dna1", cdsSeq.getName()); + // assertEquals(1, cdsSeq.getDBRefs().length); + // DBRefEntry cdsRef = cdsSeq.getDBRefs()[0]; + // assertEquals("EMBLCDS", cdsRef.getSource()); + // assertEquals("2", cdsRef.getVersion()); + // assertEquals("A12345", cdsRef.getAccessionId()); cdsSeq = cds.get(1); - assertEquals("aaa---ccc---", cdsSeq.getSequenceAsString()); - assertEquals("dna1|A12346", cdsSeq.getName()); - assertEquals(1, cdsSeq.getDBRefs().length); - cdsRef = cdsSeq.getDBRefs()[0]; - assertEquals("EMBLCDS", cdsRef.getSource()); - assertEquals("3", cdsRef.getVersion()); - assertEquals("A12346", cdsRef.getAccessionId()); + assertEquals("aaaccc", cdsSeq.getSequenceAsString()); + // assertEquals("dna1|A12346", cdsSeq.getName()); + assertEquals("CDS|dna1", cdsSeq.getName()); + // assertEquals(1, cdsSeq.getDBRefs().length); + // cdsRef = cdsSeq.getDBRefs()[0]; + // assertEquals("EMBLCDS", cdsRef.getSource()); + // assertEquals("3", cdsRef.getVersion()); + // assertEquals("A12346", cdsRef.getAccessionId()); cdsSeq = cds.get(2); - assertEquals("aaa------TTT", cdsSeq.getSequenceAsString()); - assertEquals("dna1|A12347", cdsSeq.getName()); - assertEquals(1, cdsSeq.getDBRefs().length); - cdsRef = cdsSeq.getDBRefs()[0]; - assertEquals("EMBLCDS", cdsRef.getSource()); - assertEquals("4", cdsRef.getVersion()); - assertEquals("A12347", cdsRef.getAccessionId()); + assertEquals("aaaTTT", cdsSeq.getSequenceAsString()); + // assertEquals("dna1|A12347", cdsSeq.getName()); + assertEquals("CDS|dna1", cdsSeq.getName()); + // assertEquals(1, cdsSeq.getDBRefs().length); + // cdsRef = cdsSeq.getDBRefs()[0]; + // assertEquals("EMBLCDS", cdsRef.getSource()); + // assertEquals("4", cdsRef.getVersion()); + // assertEquals("A12347", cdsRef.getAccessionId()); /* * Verify there are mappings from each cds sequence to its protein product * and also to its dna source */ - Iterator newMappingsIterator = mappings.iterator(); - - // mappings for dna1 - exon1 - pep1 - AlignedCodonFrame cdsMapping = newMappingsIterator.next(); - List dnaMappings = cdsMapping.getMappingsForSequence(dna1); - assertEquals(1, dnaMappings.size()); - assertSame(cds.get(0).getDatasetSequence(), dnaMappings.get(0) - .getTo()); - assertEquals("G(1) in CDS should map to G(4) in DNA", 4, dnaMappings - .get(0).getMap().getToPosition(1)); - List peptideMappings = cdsMapping - .getMappingsForSequence(pep1); - assertEquals(1, peptideMappings.size()); - assertSame(pep1.getDatasetSequence(), peptideMappings.get(0).getTo()); - - // mappings for dna1 - cds2 - pep2 - cdsMapping = newMappingsIterator.next(); - dnaMappings = cdsMapping.getMappingsForSequence(dna1); - assertEquals(1, dnaMappings.size()); - assertSame(cds.get(1).getDatasetSequence(), dnaMappings.get(0) - .getTo()); - assertEquals("c(4) in CDS should map to c(7) in DNA", 7, dnaMappings - .get(0).getMap().getToPosition(4)); - peptideMappings = cdsMapping.getMappingsForSequence(pep2); - assertEquals(1, peptideMappings.size()); - assertSame(pep2.getDatasetSequence(), peptideMappings.get(0).getTo()); - - // mappings for dna1 - cds3 - pep3 - cdsMapping = newMappingsIterator.next(); - dnaMappings = cdsMapping.getMappingsForSequence(dna1); - assertEquals(1, dnaMappings.size()); - assertSame(cds.get(2).getDatasetSequence(), dnaMappings.get(0) - .getTo()); - assertEquals("T(4) in CDS should map to T(10) in DNA", 10, dnaMappings - .get(0).getMap().getToPosition(4)); - peptideMappings = cdsMapping.getMappingsForSequence(pep3); - assertEquals(1, peptideMappings.size()); - assertSame(pep3.getDatasetSequence(), peptideMappings.get(0).getTo()); + List newMappings = cdsal.getCodonFrames(); + + /* + * 6 mappings involve dna1 (to pep1/2/3, cds1/2/3) + */ + List dnaMappings = MappingUtils + .findMappingsForSequence(dna1, newMappings); + assertEquals(6, dnaMappings.size()); + + /* + * dna1 to pep1 + */ + List mappings = MappingUtils + .findMappingsForSequence(pep1, dnaMappings); + assertEquals(1, mappings.size()); + assertEquals(1, mappings.get(0).getMappings().size()); + assertSame(pep1.getDatasetSequence(), mappings.get(0).getMappings() + .get(0).getMapping().getTo()); + + /* + * dna1 to cds1 + */ + List dnaToCds1Mappings = MappingUtils + .findMappingsForSequence(cds.get(0), dnaMappings); + Mapping mapping = dnaToCds1Mappings.get(0).getMappings().get(0) + .getMapping(); + assertSame(cds.get(0).getDatasetSequence(), mapping.getTo()); + assertEquals("G(1) in CDS should map to G(4) in DNA", 4, mapping + .getMap().getToPosition(1)); + + /* + * dna1 to pep2 + */ + mappings = MappingUtils.findMappingsForSequence(pep2, dnaMappings); + assertEquals(1, mappings.size()); + assertEquals(1, mappings.get(0).getMappings().size()); + assertSame(pep2.getDatasetSequence(), mappings.get(0).getMappings() + .get(0).getMapping().getTo()); + + /* + * dna1 to cds2 + */ + List dnaToCds2Mappings = MappingUtils + .findMappingsForSequence(cds.get(1), dnaMappings); + mapping = dnaToCds2Mappings.get(0).getMappings().get(0).getMapping(); + assertSame(cds.get(1).getDatasetSequence(), mapping.getTo()); + assertEquals("c(4) in CDS should map to c(7) in DNA", 7, mapping + .getMap().getToPosition(4)); + + /* + * dna1 to pep3 + */ + mappings = MappingUtils.findMappingsForSequence(pep3, dnaMappings); + assertEquals(1, mappings.size()); + assertEquals(1, mappings.get(0).getMappings().size()); + assertSame(pep3.getDatasetSequence(), mappings.get(0).getMappings() + .get(0).getMapping().getTo()); + + /* + * dna1 to cds3 + */ + List dnaToCds3Mappings = MappingUtils + .findMappingsForSequence(cds.get(2), dnaMappings); + mapping = dnaToCds3Mappings.get(0).getMappings().get(0).getMapping(); + assertSame(cds.get(2).getDatasetSequence(), mapping.getTo()); + assertEquals("T(4) in CDS should map to T(10) in DNA", 10, mapping + .getMap().getToPosition(4)); } @Test(groups = { "Functional" }) @@ -1369,8 +1430,7 @@ public class AlignmentUtilsTests * @throws IOException */ @Test(groups = { "Functional" }) - public void testMapCdnaToProtein_forSubsequence() - throws IOException + public void testMapCdnaToProtein_forSubsequence() throws IOException { SequenceI prot = new Sequence("UNIPROT|V12345", "E-I--Q", 10, 12); prot.createDatasetSequence(); @@ -1391,7 +1451,7 @@ public class AlignmentUtilsTests @Test(groups = { "Functional" }) public void testAlignSequenceAs_mappedProteinProtein() { - + SequenceI alignMe = new Sequence("Match", "MGAASEV"); alignMe.createDatasetSequence(); SequenceI alignFrom = new Sequence("Query", "LQTGYMGAASEVMFSPTRR"); @@ -1402,7 +1462,7 @@ public class AlignmentUtilsTests MapList map = new MapList(new int[] { 6, 12 }, new int[] { 1, 7 }, 1, 1); acf.addMap(alignFrom.getDatasetSequence(), alignMe.getDatasetSequence(), map); - + AlignmentUtils.alignSequenceAs(alignMe, alignFrom, acf, "-", '-', true, true); assertEquals("-----MGAASEV-------", alignMe.getSequenceAsString()); @@ -1417,7 +1477,7 @@ public class AlignmentUtilsTests { // map first 3 codons to KPF; G is a trailing unmapped residue MapList map = new MapList(new int[] { 1, 9 }, new int[] { 1, 3 }, 3, 1); - + checkAlignSequenceAs("AAACCCTTT", "K-PFG", true, true, map, "AAA---CCCTTT---"); } @@ -1467,39 +1527,39 @@ public class AlignmentUtilsTests * that partially overlap 5' or 3' (start or end) of target sequence */ AlignmentUtils.transferFeatures(dna, cds, map, null); - SequenceFeature[] sfs = cds.getSequenceFeatures(); - assertEquals(6, sfs.length); + List sfs = cds.getSequenceFeatures(); + assertEquals(6, sfs.size()); - SequenceFeature sf = sfs[0]; + SequenceFeature sf = sfs.get(0); assertEquals("type2", sf.getType()); assertEquals("desc2", sf.getDescription()); assertEquals(2f, sf.getScore()); assertEquals(1, sf.getBegin()); assertEquals(1, sf.getEnd()); - sf = sfs[1]; + sf = sfs.get(1); assertEquals("type3", sf.getType()); assertEquals("desc3", sf.getDescription()); assertEquals(3f, sf.getScore()); assertEquals(1, sf.getBegin()); assertEquals(3, sf.getEnd()); - sf = sfs[2]; + sf = sfs.get(2); assertEquals("type4", sf.getType()); assertEquals(2, sf.getBegin()); assertEquals(5, sf.getEnd()); - sf = sfs[3]; + sf = sfs.get(3); assertEquals("type5", sf.getType()); assertEquals(1, sf.getBegin()); assertEquals(6, sf.getEnd()); - sf = sfs[4]; + sf = sfs.get(4); assertEquals("type8", sf.getType()); assertEquals(6, sf.getBegin()); assertEquals(6, sf.getEnd()); - sf = sfs[5]; + sf = sfs.get(5); assertEquals("type9", sf.getType()); assertEquals(6, sf.getBegin()); assertEquals(6, sf.getEnd()); @@ -1516,7 +1576,7 @@ public class AlignmentUtilsTests MapList map = new MapList(new int[] { 4, 6, 10, 12 }, new int[] { 1, 6 }, 1, 1); - + // [5, 11] maps to [2, 5] dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f, null)); @@ -1526,13 +1586,13 @@ public class AlignmentUtilsTests // [12, 12] maps to [6, 6] dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12, 8f, null)); - + // desc4 and desc8 are the 'omit these' varargs AlignmentUtils.transferFeatures(dna, cds, map, null, "type4", "type8"); - SequenceFeature[] sfs = cds.getSequenceFeatures(); - assertEquals(1, sfs.length); - - SequenceFeature sf = sfs[0]; + List sfs = cds.getSequenceFeatures(); + assertEquals(1, sfs.size()); + + SequenceFeature sf = sfs.get(0); assertEquals("type5", sf.getType()); assertEquals(1, sf.getBegin()); assertEquals(6, sf.getEnd()); @@ -1546,10 +1606,10 @@ public class AlignmentUtilsTests { SequenceI dna = new Sequence("dna/20-34", "acgTAGcaaGCCcgt"); SequenceI cds = new Sequence("cds/10-15", "TAGGCC"); - + MapList map = new MapList(new int[] { 4, 6, 10, 12 }, new int[] { 1, 6 }, 1, 1); - + // [5, 11] maps to [2, 5] dna.addSequenceFeature(new SequenceFeature("type4", "desc4", 5, 11, 4f, null)); @@ -1559,13 +1619,13 @@ public class AlignmentUtilsTests // [12, 12] maps to [6, 6] dna.addSequenceFeature(new SequenceFeature("type8", "desc8", 12, 12, 8f, null)); - + // "type5" is the 'select this type' argument AlignmentUtils.transferFeatures(dna, cds, map, "type5"); - SequenceFeature[] sfs = cds.getSequenceFeatures(); - assertEquals(1, sfs.length); - - SequenceFeature sf = sfs[0]; + List sfs = cds.getSequenceFeatures(); + assertEquals(1, sfs.size()); + + SequenceFeature sf = sfs.get(0); assertEquals("type5", sf.getType()); assertEquals(1, sf.getBegin()); assertEquals(6, sf.getEnd()); @@ -1590,41 +1650,28 @@ public class AlignmentUtilsTests dna3.createDatasetSequence(); pep1.createDatasetSequence(); pep2.createDatasetSequence(); - dna1.addSequenceFeature(new SequenceFeature("CDS", "cds1", 4, 8, 0f, - null)); - dna1.addSequenceFeature(new SequenceFeature("CDS", "cds2", 9, 12, 0f, - null)); - dna1.addSequenceFeature(new SequenceFeature("CDS", "cds3", 16, 18, 0f, - null)); - dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 4, 8, 0f, - null)); - dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 12, 12, 0f, - null)); - dna2.addSequenceFeature(new SequenceFeature("CDS", "cds", 16, 18, 0f, - null)); - - List mappings = new ArrayList(); + + AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 }); + dna.setDataset(null); + MapList map = new MapList(new int[] { 4, 12, 16, 18 }, new int[] { 1, 4 }, 3, 1); AlignedCodonFrame acf = new AlignedCodonFrame(); acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map); - mappings.add(acf); + dna.addCodonFrame(acf); map = new MapList(new int[] { 4, 8, 12, 12, 16, 18 }, - new int[] { 1, 3 }, - 3, 1); + new int[] { 1, 3 }, 3, 1); acf = new AlignedCodonFrame(); acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), map); - mappings.add(acf); - - AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 }); - dna.setDataset(null); + dna.addCodonFrame(acf); + AlignmentI cds = AlignmentUtils.makeCdsAlignment(new SequenceI[] { - dna1, dna2, dna3 }, mappings, dna); + dna1, dna2, dna3 }, dna.getDataset(), null); List cdsSeqs = cds.getSequences(); assertEquals(2, cdsSeqs.size()); assertEquals("GGGCCCTTTGGG", cdsSeqs.get(0).getSequenceAsString()); - assertEquals("GGGCC---TGGG", cdsSeqs.get(1).getSequenceAsString()); - + assertEquals("GGGCCTGGG", cdsSeqs.get(1).getSequenceAsString()); + /* * verify shared, extended alignment dataset */ @@ -1635,135 +1682,73 @@ public class AlignmentUtilsTests .contains(cdsSeqs.get(1).getDatasetSequence())); /* - * Verify updated mappings + * Verify 6 mappings: dna1 to cds1, cds1 to pep1, dna1 to pep1 + * and the same for dna2/cds2/pep2 */ - assertEquals(2, mappings.size()); - + List mappings = cds.getCodonFrames(); + assertEquals(6, mappings.size()); + /* - * Mapping from pep1 to GGGTTT in first new CDS sequence + * 2 mappings involve pep1 */ - List pep1Mapping = MappingUtils + List pep1Mappings = MappingUtils .findMappingsForSequence(pep1, mappings); - assertEquals(1, pep1Mapping.size()); + assertEquals(2, pep1Mappings.size()); + /* + * Get mapping of pep1 to cds1 and verify it * maps GPFG to 1-3,4-6,7-9,10-12 */ - SearchResults sr = MappingUtils.buildSearchResults(pep1, 1, mappings); + List pep1CdsMappings = MappingUtils + .findMappingsForSequence(cds.getSequenceAt(0), pep1Mappings); + assertEquals(1, pep1CdsMappings.size()); + SearchResultsI sr = MappingUtils.buildSearchResults(pep1, 1, + pep1CdsMappings); assertEquals(1, sr.getResults().size()); - Match m = sr.getResults().get(0); - assertEquals(cds.getSequenceAt(0).getDatasetSequence(), - m.getSequence()); + SearchResultMatchI m = sr.getResults().get(0); + assertEquals(cds.getSequenceAt(0).getDatasetSequence(), m.getSequence()); assertEquals(1, m.getStart()); assertEquals(3, m.getEnd()); - sr = MappingUtils.buildSearchResults(pep1, 2, mappings); + sr = MappingUtils.buildSearchResults(pep1, 2, pep1CdsMappings); m = sr.getResults().get(0); assertEquals(4, m.getStart()); assertEquals(6, m.getEnd()); - sr = MappingUtils.buildSearchResults(pep1, 3, mappings); + sr = MappingUtils.buildSearchResults(pep1, 3, pep1CdsMappings); m = sr.getResults().get(0); assertEquals(7, m.getStart()); assertEquals(9, m.getEnd()); - sr = MappingUtils.buildSearchResults(pep1, 4, mappings); + sr = MappingUtils.buildSearchResults(pep1, 4, pep1CdsMappings); m = sr.getResults().get(0); assertEquals(10, m.getStart()); assertEquals(12, m.getEnd()); - + /* - * GPG in pep2 map to 1-3,4-6,7-9 in second CDS sequence + * Get mapping of pep2 to cds2 and verify it + * maps GPG in pep2 to 1-3,4-6,7-9 in second CDS sequence */ - List pep2Mapping = MappingUtils + List pep2Mappings = MappingUtils .findMappingsForSequence(pep2, mappings); - assertEquals(1, pep2Mapping.size()); - sr = MappingUtils.buildSearchResults(pep2, 1, mappings); + assertEquals(2, pep2Mappings.size()); + List pep2CdsMappings = MappingUtils + .findMappingsForSequence(cds.getSequenceAt(1), pep2Mappings); + assertEquals(1, pep2CdsMappings.size()); + sr = MappingUtils.buildSearchResults(pep2, 1, pep2CdsMappings); assertEquals(1, sr.getResults().size()); m = sr.getResults().get(0); - assertEquals(cds.getSequenceAt(1).getDatasetSequence(), - m.getSequence()); + assertEquals(cds.getSequenceAt(1).getDatasetSequence(), m.getSequence()); assertEquals(1, m.getStart()); assertEquals(3, m.getEnd()); - sr = MappingUtils.buildSearchResults(pep2, 2, mappings); + sr = MappingUtils.buildSearchResults(pep2, 2, pep2CdsMappings); m = sr.getResults().get(0); assertEquals(4, m.getStart()); assertEquals(6, m.getEnd()); - sr = MappingUtils.buildSearchResults(pep2, 3, mappings); + sr = MappingUtils.buildSearchResults(pep2, 3, pep2CdsMappings); m = sr.getResults().get(0); assertEquals(7, m.getStart()); assertEquals(9, m.getEnd()); } /** - * Tests for gapped column in sequences - */ - @Test(groups = { "Functional" }) - public void testIsGappedColumn() - { - SequenceI seq1 = new Sequence("Seq1", "a--c.tc-a-g"); - SequenceI seq2 = new Sequence("Seq2", "aa---t--a-g"); - SequenceI seq3 = new Sequence("Seq3", "ag-c t-g-"); - List seqs = Arrays - .asList(new SequenceI[] { seq1, seq2, seq3 }); - // the column number is base 1 - assertFalse(AlignmentUtils.isGappedColumn(seqs, 1)); - assertFalse(AlignmentUtils.isGappedColumn(seqs, 2)); - assertTrue(AlignmentUtils.isGappedColumn(seqs, 3)); - assertFalse(AlignmentUtils.isGappedColumn(seqs, 4)); - assertTrue(AlignmentUtils.isGappedColumn(seqs, 5)); - assertFalse(AlignmentUtils.isGappedColumn(seqs, 6)); - assertFalse(AlignmentUtils.isGappedColumn(seqs, 7)); - assertFalse(AlignmentUtils.isGappedColumn(seqs, 8)); - assertFalse(AlignmentUtils.isGappedColumn(seqs, 9)); - assertTrue(AlignmentUtils.isGappedColumn(seqs, 10)); - assertFalse(AlignmentUtils.isGappedColumn(seqs, 11)); - // out of bounds: - assertTrue(AlignmentUtils.isGappedColumn(seqs, 0)); - assertTrue(AlignmentUtils.isGappedColumn(seqs, 100)); - assertTrue(AlignmentUtils.isGappedColumn(seqs, -100)); - assertTrue(AlignmentUtils.isGappedColumn(null, 0)); - } - - @Test(groups = { "Functional" }) - public void testFindCdsColumns() - { - // TODO target method belongs in a general-purpose alignment - // analysis method to find columns for feature - - /* - * NB this method assumes CDS ranges are contiguous (no introns) - */ - SequenceI gene = new Sequence("gene", "aaacccgggtttaaacccgggttt"); - SequenceI seq1 = new Sequence("Seq1", "--ac-cgGG-GGaaACC--GGtt-"); - SequenceI seq2 = new Sequence("Seq2", "AA--CCGG--g-AAA--cG-GTTt"); - seq1.createDatasetSequence(); - seq2.createDatasetSequence(); - seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 5, 6, 0f, - null)); - seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 7, 8, 0f, - null)); - seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 11, 13, 0f, - null)); - seq1.addSequenceFeature(new SequenceFeature("CDS", "cds", 14, 15, 0f, - null)); - seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 1, 2, 0f, - null)); - seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 3, 6, 0f, - null)); - seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 8, 10, 0f, - null)); - seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 12, 12, 0f, - null)); - seq2.addSequenceFeature(new SequenceFeature("CDS", "cds", 13, 15, 0f, - null)); - - List cdsColumns = AlignmentUtils.findCdsColumns(new SequenceI[] { - seq1, seq2 }); - assertEquals(4, cdsColumns.size()); - assertEquals("[1, 2]", Arrays.toString(cdsColumns.get(0))); - assertEquals("[5, 9]", Arrays.toString(cdsColumns.get(1))); - assertEquals("[11, 17]", Arrays.toString(cdsColumns.get(2))); - assertEquals("[19, 23]", Arrays.toString(cdsColumns.get(3))); - } - - /** * Test the method that realigns protein to match mapped codon alignment. */ @Test(groups = { "Functional" }) @@ -1777,7 +1762,7 @@ public class AlignmentUtilsTests SequenceI dna3 = new Sequence("Seq3", "ccaaa-ttt-GGG-"); AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2, dna3 }); dna.setDataset(null); - + // prot1 has 'X' for incomplete start codon (not mapped) SequenceI prot1 = new Sequence("Seq1", "XKFG"); // X for incomplete start SequenceI prot2 = new Sequence("Seq2", "NG"); @@ -1785,7 +1770,7 @@ public class AlignmentUtilsTests AlignmentI protein = new Alignment(new SequenceI[] { prot1, prot2, prot3 }); protein.setDataset(null); - + // map dna1 [3, 11] to prot1 [2, 4] KFG MapList map = new MapList(new int[] { 3, 11 }, new int[] { 2, 4 }, 3, 1); AlignedCodonFrame acf = new AlignedCodonFrame(); @@ -1799,7 +1784,7 @@ public class AlignmentUtilsTests map = new MapList(new int[] { 9, 11 }, new int[] { 2, 2 }, 3, 1); acf.addMap(dna3.getDatasetSequence(), prot3.getDatasetSequence(), map); - ArrayList acfs = new ArrayList(); + ArrayList acfs = new ArrayList<>(); acfs.add(acf); protein.setCodonFrames(acfs); @@ -1819,12 +1804,12 @@ public class AlignmentUtilsTests * (or subtype) feature - case where the start codon is incomplete. */ @Test(groups = "Functional") - public void testGetCdsRanges_fivePrimeIncomplete() + public void testFindCdsPositions_fivePrimeIncomplete() { SequenceI dnaSeq = new Sequence("dna", "aaagGGCCCaaaTTTttt"); dnaSeq.createDatasetSequence(); SequenceI ds = dnaSeq.getDatasetSequence(); - + // CDS for dna 5-6 (incomplete codon), 7-9 SequenceFeature sf = new SequenceFeature("CDS", "", 5, 9, 0f, null); sf.setPhase("2"); // skip 2 bases to start of next codon @@ -1832,9 +1817,9 @@ public class AlignmentUtilsTests // CDS for dna 13-15 sf = new SequenceFeature("CDS_predicted", "", 13, 15, 0f, null); ds.addSequenceFeature(sf); - + List ranges = AlignmentUtils.findCdsPositions(dnaSeq); - + /* * check the mapping starts with the first complete codon */ @@ -1851,23 +1836,31 @@ public class AlignmentUtilsTests * (or subtype) feature. */ @Test(groups = "Functional") - public void testGetCdsRanges() + public void testFindCdsPositions() { SequenceI dnaSeq = new Sequence("dna", "aaaGGGcccAAATTTttt"); dnaSeq.createDatasetSequence(); SequenceI ds = dnaSeq.getDatasetSequence(); - - // CDS for dna 3-6 - SequenceFeature sf = new SequenceFeature("CDS", "", 4, 6, 0f, null); + + // CDS for dna 10-12 + SequenceFeature sf = new SequenceFeature("CDS_predicted", "", 10, 12, + 0f, null); + sf.setStrand("+"); + ds.addSequenceFeature(sf); + // CDS for dna 4-6 + sf = new SequenceFeature("CDS", "", 4, 6, 0f, null); + sf.setStrand("+"); ds.addSequenceFeature(sf); // exon feature should be ignored here sf = new SequenceFeature("exon", "", 7, 9, 0f, null); ds.addSequenceFeature(sf); - // CDS for dna 10-12 - sf = new SequenceFeature("CDS_predicted", "", 10, 12, 0f, null); - ds.addSequenceFeature(sf); - + List ranges = AlignmentUtils.findCdsPositions(dnaSeq); + /* + * verify ranges { [4-6], [12-10] } + * note CDS ranges are ordered ascending even if the CDS + * features are not + */ assertEquals(6, MappingUtils.getLength(ranges)); assertEquals(2, ranges.size()); assertEquals(4, ranges.get(0)[0]); @@ -1877,133 +1870,693 @@ public class AlignmentUtilsTests } /** - * Test the method that computes a map of codon variants for each protein - * position from "sequence_variant" features on dna + * Tests for the method that maps the subset of a dna sequence that has CDS + * (or subtype) feature, with CDS strand = '-' (reverse) + */ + // test turned off as currently findCdsPositions is not strand-dependent + // left in case it comes around again... + @Test(groups = "Functional", enabled = false) + public void testFindCdsPositions_reverseStrand() + { + SequenceI dnaSeq = new Sequence("dna", "aaaGGGcccAAATTTttt"); + dnaSeq.createDatasetSequence(); + SequenceI ds = dnaSeq.getDatasetSequence(); + + // CDS for dna 4-6 + SequenceFeature sf = new SequenceFeature("CDS", "", 4, 6, 0f, null); + sf.setStrand("-"); + ds.addSequenceFeature(sf); + // exon feature should be ignored here + sf = new SequenceFeature("exon", "", 7, 9, 0f, null); + ds.addSequenceFeature(sf); + // CDS for dna 10-12 + sf = new SequenceFeature("CDS_predicted", "", 10, 12, 0f, null); + sf.setStrand("-"); + ds.addSequenceFeature(sf); + + List ranges = AlignmentUtils.findCdsPositions(dnaSeq); + /* + * verify ranges { [12-10], [6-4] } + */ + assertEquals(6, MappingUtils.getLength(ranges)); + assertEquals(2, ranges.size()); + assertEquals(12, ranges.get(0)[0]); + assertEquals(10, ranges.get(0)[1]); + assertEquals(6, ranges.get(1)[0]); + assertEquals(4, ranges.get(1)[1]); + } + + /** + * Tests for the method that maps the subset of a dna sequence that has CDS + * (or subtype) feature - reverse strand case where the start codon is + * incomplete. */ + @Test(groups = "Functional", enabled = false) + // test turned off as currently findCdsPositions is not strand-dependent + // left in case it comes around again... + public void testFindCdsPositions_reverseStrandThreePrimeIncomplete() + { + SequenceI dnaSeq = new Sequence("dna", "aaagGGCCCaaaTTTttt"); + dnaSeq.createDatasetSequence(); + SequenceI ds = dnaSeq.getDatasetSequence(); + + // CDS for dna 5-9 + SequenceFeature sf = new SequenceFeature("CDS", "", 5, 9, 0f, null); + sf.setStrand("-"); + ds.addSequenceFeature(sf); + // CDS for dna 13-15 + sf = new SequenceFeature("CDS_predicted", "", 13, 15, 0f, null); + sf.setStrand("-"); + sf.setPhase("2"); // skip 2 bases to start of next codon + ds.addSequenceFeature(sf); + + List ranges = AlignmentUtils.findCdsPositions(dnaSeq); + + /* + * check the mapping starts with the first complete codon + * expect ranges [13, 13], [9, 5] + */ + assertEquals(6, MappingUtils.getLength(ranges)); + assertEquals(2, ranges.size()); + assertEquals(13, ranges.get(0)[0]); + assertEquals(13, ranges.get(0)[1]); + assertEquals(9, ranges.get(1)[0]); + assertEquals(5, ranges.get(1)[1]); + } + @Test(groups = "Functional") - public void testBuildDnaVariantsMap() + public void testAlignAs_alternateTranscriptsUngapped() { - SequenceI dna = new Sequence("dna", "atgAAATTTGGGCCCtag"); - MapList map = new MapList(new int[] { 1, 18 }, new int[] { 1, 5 }, 3, 1); + SequenceI dna1 = new Sequence("dna1", "cccGGGTTTaaa"); + SequenceI dna2 = new Sequence("dna2", "CCCgggtttAAA"); + AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2 }); + ((Alignment) dna).createDatasetAlignment(); + SequenceI cds1 = new Sequence("cds1", "GGGTTT"); + SequenceI cds2 = new Sequence("cds2", "CCCAAA"); + AlignmentI cds = new Alignment(new SequenceI[] { cds1, cds2 }); + ((Alignment) cds).createDatasetAlignment(); + + AlignedCodonFrame acf = new AlignedCodonFrame(); + MapList map = new MapList(new int[] { 4, 9 }, new int[] { 1, 6 }, 1, 1); + acf.addMap(dna1.getDatasetSequence(), cds1.getDatasetSequence(), map); + map = new MapList(new int[] { 1, 3, 10, 12 }, new int[] { 1, 6 }, 1, 1); + acf.addMap(dna2.getDatasetSequence(), cds2.getDatasetSequence(), map); /* - * first with no variants on dna + * verify CDS alignment is as: + * cccGGGTTTaaa (cdna) + * CCCgggtttAAA (cdna) + * + * ---GGGTTT--- (cds) + * CCC------AAA (cds) */ - LinkedHashMap variantsMap = AlignmentUtils - .buildDnaVariantsMap(dna, map); - assertTrue(variantsMap.isEmpty()); + dna.addCodonFrame(acf); + AlignmentUtils.alignAs(cds, dna); + assertEquals("---GGGTTT", cds.getSequenceAt(0).getSequenceAsString()); + assertEquals("CCC------AAA", cds.getSequenceAt(1).getSequenceAsString()); + } - // single allele codon 1, on base 1 - SequenceFeature sf = new SequenceFeature("sequence_variant", "", 1, 1, - 0f, null); - sf.setValue("alleles", "T"); - dna.addSequenceFeature(sf); + @Test(groups = { "Functional" }) + public void testAddMappedPositions() + { + SequenceI from = new Sequence("dna", "ggAA-ATcc-TT-g"); + SequenceI seq1 = new Sequence("cds", "AAATTT"); + from.createDatasetSequence(); + seq1.createDatasetSequence(); + Mapping mapping = new Mapping(seq1, new MapList( + new int[] { 3, 6, 9, 10 }, new int[] { 1, 6 }, 1, 1)); + Map> map = new TreeMap<>(); + AlignmentUtils.addMappedPositions(seq1, from, mapping, map); - // two alleles codon 2, on bases 2 and 3 - sf = new SequenceFeature("sequence_variant", "", 5, 5, 0f, null); - sf.setValue("alleles", "T"); - dna.addSequenceFeature(sf); - sf = new SequenceFeature("sequence_variant", "", 6, 6, 0f, null); - sf.setValue("alleles", "G"); - dna.addSequenceFeature(sf); + /* + * verify map has seq1 residues in columns 3,4,6,7,11,12 + */ + assertEquals(6, map.size()); + assertEquals('A', map.get(3).get(seq1).charValue()); + assertEquals('A', map.get(4).get(seq1).charValue()); + assertEquals('A', map.get(6).get(seq1).charValue()); + assertEquals('T', map.get(7).get(seq1).charValue()); + assertEquals('T', map.get(11).get(seq1).charValue()); + assertEquals('T', map.get(12).get(seq1).charValue()); - // two alleles codon 3, both on base 2 - sf = new SequenceFeature("sequence_variant", "", 8, 8, 0f, null); - sf.setValue("alleles", "C, G"); - dna.addSequenceFeature(sf); + /* + * + */ + } - // no alleles on codon 4 - // alleles on codon 5 on all 3 bases - sf = new SequenceFeature("sequence_variant", "", 13, 13, 0f, null); - sf.setValue("alleles", "C, G"); // (C duplicates given base value) - dna.addSequenceFeature(sf); - sf = new SequenceFeature("sequence_variant", "", 14, 14, 0f, null); - sf.setValue("alleles", "g, a"); // should force to upper-case - dna.addSequenceFeature(sf); - sf = new SequenceFeature("sequence_variant", "", 15, 15, 0f, null); - sf.setValue("alleles", "A, T"); - dna.addSequenceFeature(sf); + /** + * Test case where the mapping 'from' range includes a stop codon which is + * absent in the 'to' range + */ + @Test(groups = { "Functional" }) + public void testAddMappedPositions_withStopCodon() + { + SequenceI from = new Sequence("dna", "ggAA-ATcc-TT-g"); + SequenceI seq1 = new Sequence("cds", "AAATTT"); + from.createDatasetSequence(); + seq1.createDatasetSequence(); + Mapping mapping = new Mapping(seq1, new MapList( + new int[] { 3, 6, 9, 10 }, new int[] { 1, 6 }, 1, 1)); + Map> map = new TreeMap<>(); + AlignmentUtils.addMappedPositions(seq1, from, mapping, map); + + /* + * verify map has seq1 residues in columns 3,4,6,7,11,12 + */ + assertEquals(6, map.size()); + assertEquals('A', map.get(3).get(seq1).charValue()); + assertEquals('A', map.get(4).get(seq1).charValue()); + assertEquals('A', map.get(6).get(seq1).charValue()); + assertEquals('T', map.get(7).get(seq1).charValue()); + assertEquals('T', map.get(11).get(seq1).charValue()); + assertEquals('T', map.get(12).get(seq1).charValue()); + } + + /** + * Test for the case where the products for which we want CDS are specified. + * This is to represent the case where EMBL has CDS mappings to both Uniprot + * and EMBLCDSPROTEIN. makeCdsAlignment() should only return the mappings for + * the protein sequences specified. + */ + @Test(groups = { "Functional" }) + public void testMakeCdsAlignment_filterProducts() + { + SequenceI dna1 = new Sequence("dna1", "aaaGGGcccTTTaaa"); + SequenceI dna2 = new Sequence("dna2", "GGGcccTTTaaaCCC"); + SequenceI pep1 = new Sequence("Uniprot|pep1", "GF"); + SequenceI pep2 = new Sequence("Uniprot|pep2", "GFP"); + SequenceI pep3 = new Sequence("EMBL|pep3", "GF"); + SequenceI pep4 = new Sequence("EMBL|pep4", "GFP"); + dna1.createDatasetSequence(); + dna2.createDatasetSequence(); + pep1.createDatasetSequence(); + pep2.createDatasetSequence(); + pep3.createDatasetSequence(); + pep4.createDatasetSequence(); + AlignmentI dna = new Alignment(new SequenceI[] { dna1, dna2 }); + dna.setDataset(null); + AlignmentI emblPeptides = new Alignment(new SequenceI[] { pep3, pep4 }); + emblPeptides.setDataset(null); + + AlignedCodonFrame acf = new AlignedCodonFrame(); + MapList map = new MapList(new int[] { 4, 6, 10, 12 }, + new int[] { 1, 2 }, 3, 1); + acf.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), map); + acf.addMap(dna1.getDatasetSequence(), pep3.getDatasetSequence(), map); + dna.addCodonFrame(acf); + + acf = new AlignedCodonFrame(); + map = new MapList(new int[] { 1, 3, 7, 9, 13, 15 }, new int[] { 1, 3 }, + 3, 1); + acf.addMap(dna2.getDatasetSequence(), pep2.getDatasetSequence(), map); + acf.addMap(dna2.getDatasetSequence(), pep4.getDatasetSequence(), map); + dna.addCodonFrame(acf); + + /* + * execute method under test to find CDS for EMBL peptides only + */ + AlignmentI cds = AlignmentUtils.makeCdsAlignment(new SequenceI[] { + dna1, dna2 }, dna.getDataset(), emblPeptides.getSequencesArray()); + + assertEquals(2, cds.getSequences().size()); + assertEquals("GGGTTT", cds.getSequenceAt(0).getSequenceAsString()); + assertEquals("GGGTTTCCC", cds.getSequenceAt(1).getSequenceAsString()); + + /* + * verify shared, extended alignment dataset + */ + assertSame(dna.getDataset(), cds.getDataset()); + assertTrue(dna.getDataset().getSequences() + .contains(cds.getSequenceAt(0).getDatasetSequence())); + assertTrue(dna.getDataset().getSequences() + .contains(cds.getSequenceAt(1).getDatasetSequence())); + + /* + * Verify mappings from CDS to peptide, cDNA to CDS, and cDNA to peptide + * the mappings are on the shared alignment dataset + */ + List cdsMappings = cds.getDataset().getCodonFrames(); + /* + * 6 mappings, 2*(DNA->CDS), 2*(DNA->Pep), 2*(CDS->Pep) + */ + assertEquals(6, cdsMappings.size()); + + /* + * verify that mapping sets for dna and cds alignments are different + * [not current behaviour - all mappings are on the alignment dataset] + */ + // select -> subselect type to test. + // Assert.assertNotSame(dna.getCodonFrames(), cds.getCodonFrames()); + // assertEquals(4, dna.getCodonFrames().size()); + // assertEquals(4, cds.getCodonFrames().size()); + + /* + * Two mappings involve pep3 (dna to pep3, cds to pep3) + * Mapping from pep3 to GGGTTT in first new exon sequence + */ + List pep3Mappings = MappingUtils + .findMappingsForSequence(pep3, cdsMappings); + assertEquals(2, pep3Mappings.size()); + List mappings = MappingUtils + .findMappingsForSequence(cds.getSequenceAt(0), pep3Mappings); + assertEquals(1, mappings.size()); + + // map G to GGG + SearchResultsI sr = MappingUtils.buildSearchResults(pep3, 1, mappings); + assertEquals(1, sr.getResults().size()); + SearchResultMatchI m = sr.getResults().get(0); + assertSame(cds.getSequenceAt(0).getDatasetSequence(), m.getSequence()); + assertEquals(1, m.getStart()); + assertEquals(3, m.getEnd()); + // map F to TTT + sr = MappingUtils.buildSearchResults(pep3, 2, mappings); + m = sr.getResults().get(0); + assertSame(cds.getSequenceAt(0).getDatasetSequence(), m.getSequence()); + assertEquals(4, m.getStart()); + assertEquals(6, m.getEnd()); - variantsMap = AlignmentUtils.buildDnaVariantsMap(dna, map); - assertEquals(4, variantsMap.size()); - assertTrue(Arrays.deepEquals(new String[][] { { "A", "T" }, { "T" }, - { "G" } }, variantsMap.get(1))); - assertTrue(Arrays.deepEquals(new String[][] { { "A" }, { "A", "T" }, - { "A", "G" } }, variantsMap.get(2))); - assertTrue(Arrays.deepEquals(new String[][] { { "T" }, - { "T", "C", "G" }, { "T" } }, variantsMap.get(3))); - // duplicated bases are not removed here, handled in computePeptideVariants - assertTrue(Arrays.deepEquals(new String[][] { { "C", "C", "G" }, - { "C", "G", "A" }, { "C", "A", "T" } }, variantsMap.get(5))); + /* + * Two mappings involve pep4 (dna to pep4, cds to pep4) + * Verify mapping from pep4 to GGGTTTCCC in second new exon sequence + */ + List pep4Mappings = MappingUtils + .findMappingsForSequence(pep4, cdsMappings); + assertEquals(2, pep4Mappings.size()); + mappings = MappingUtils.findMappingsForSequence(cds.getSequenceAt(1), + pep4Mappings); + assertEquals(1, mappings.size()); + // map G to GGG + sr = MappingUtils.buildSearchResults(pep4, 1, mappings); + assertEquals(1, sr.getResults().size()); + m = sr.getResults().get(0); + assertSame(cds.getSequenceAt(1).getDatasetSequence(), m.getSequence()); + assertEquals(1, m.getStart()); + assertEquals(3, m.getEnd()); + // map F to TTT + sr = MappingUtils.buildSearchResults(pep4, 2, mappings); + m = sr.getResults().get(0); + assertSame(cds.getSequenceAt(1).getDatasetSequence(), m.getSequence()); + assertEquals(4, m.getStart()); + assertEquals(6, m.getEnd()); + // map P to CCC + sr = MappingUtils.buildSearchResults(pep4, 3, mappings); + m = sr.getResults().get(0); + assertSame(cds.getSequenceAt(1).getDatasetSequence(), m.getSequence()); + assertEquals(7, m.getStart()); + assertEquals(9, m.getEnd()); } /** - * Tests for the method that computes all peptide variants given codon - * variants + * Test the method that just copies aligned sequences, provided all sequences + * to be aligned share the aligned sequence's dataset */ @Test(groups = "Functional") - public void testComputePeptideVariants() + public void testAlignAsSameSequences() { - String[][] codonVariants = new String[][] { { "A" }, { "G" }, { "T" } }; - + SequenceI dna1 = new Sequence("dna1", "cccGGGTTTaaa"); + SequenceI dna2 = new Sequence("dna2", "CCCgggtttAAA"); + AlignmentI al1 = new Alignment(new SequenceI[] { dna1, dna2 }); + ((Alignment) al1).createDatasetAlignment(); + + SequenceI dna3 = new Sequence(dna1); + SequenceI dna4 = new Sequence(dna2); + assertSame(dna3.getDatasetSequence(), dna1.getDatasetSequence()); + assertSame(dna4.getDatasetSequence(), dna2.getDatasetSequence()); + String seq1 = "-cc-GG-GT-TT--aaa"; + dna3.setSequence(seq1); + String seq2 = "C--C-Cgg--gtt-tAA-A-"; + dna4.setSequence(seq2); + AlignmentI al2 = new Alignment(new SequenceI[] { dna3, dna4 }); + ((Alignment) al2).createDatasetAlignment(); + /* - * AGT codes for S - this is not included in the variants returned + * alignment removes gapped columns (two internal, two trailing) */ - List variants = AlignmentUtils.computePeptideVariants(codonVariants, "S"); - assertEquals("[]", variants.toString()); - - // S is reported if it differs from the current value (A): - variants = AlignmentUtils.computePeptideVariants(codonVariants, "A"); - assertEquals("[S]", variants.toString()); - + assertTrue(AlignmentUtils.alignAsSameSequences(al1, al2)); + String aligned1 = "-cc-GG-GTTT-aaa"; + assertEquals(aligned1, + al1.getSequenceAt(0).getSequenceAsString()); + String aligned2 = "C--C-Cgg-gtttAAA"; + assertEquals(aligned2, + al1.getSequenceAt(1).getSequenceAsString()); + /* - * synonymous variant is not reported + * add another sequence to 'aligned' - should still succeed, since + * unaligned sequences still share a dataset with aligned sequences */ - codonVariants = new String[][] { { "A" }, { "G" }, { "C", "T" } }; - // AGC and AGT both code for S - variants = AlignmentUtils.computePeptideVariants(codonVariants, "s"); - assertEquals("[]", variants.toString()); - + SequenceI dna5 = new Sequence("dna5", "CCCgggtttAAA"); + dna5.createDatasetSequence(); + al2.addSequence(dna5); + assertTrue(AlignmentUtils.alignAsSameSequences(al1, al2)); + assertEquals(aligned1, al1.getSequenceAt(0).getSequenceAsString()); + assertEquals(aligned2, al1.getSequenceAt(1).getSequenceAsString()); + /* - * equivalent variants are only reported once + * add another sequence to 'unaligned' - should fail, since now not + * all unaligned sequences share a dataset with aligned sequences */ - codonVariants = new String[][] { { "C" }, { "T" }, - { "A", "C", "G", "T" } }; - // CTA CTC CTG CTT all code for L - variants = AlignmentUtils.computePeptideVariants(codonVariants, "S"); - assertEquals("[L]", variants.toString()); - + SequenceI dna6 = new Sequence("dna6", "CCCgggtttAAA"); + dna6.createDatasetSequence(); + al1.addSequence(dna6); + // JAL-2110 JBP Comment: what's the use case for this behaviour ? + assertFalse(AlignmentUtils.alignAsSameSequences(al1, al2)); + } + + @Test(groups = "Functional") + public void testAlignAsSameSequencesMultipleSubSeq() + { + SequenceI dna1 = new Sequence("dna1", "cccGGGTTTaaa"); + SequenceI dna2 = new Sequence("dna2", "CCCgggtttAAA"); + SequenceI as1 = dna1.deriveSequence(); // cccGGGTTTaaa/1-12 + SequenceI as2 = dna1.deriveSequence().getSubSequence(3, 7); // GGGT/4-7 + SequenceI as3 = dna2.deriveSequence(); // CCCgggtttAAA/1-12 + as1.insertCharAt(6, 5, '-'); + assertEquals("cccGGG-----TTTaaa", as1.getSequenceAsString()); + as2.insertCharAt(6, 5, '-'); + assertEquals("GGGT-----", as2.getSequenceAsString()); + as3.insertCharAt(3, 5, '-'); + assertEquals("CCC-----gggtttAAA", as3.getSequenceAsString()); + AlignmentI aligned = new Alignment(new SequenceI[] { as1, as2, as3 }); + + // why do we need to cast this still ? + ((Alignment) aligned).createDatasetAlignment(); + SequenceI uas1 = dna1.deriveSequence(); + SequenceI uas2 = dna1.deriveSequence().getSubSequence(3, 7); + SequenceI uas3 = dna2.deriveSequence(); + AlignmentI tobealigned = new Alignment(new SequenceI[] { uas1, uas2, + uas3 }); + ((Alignment) tobealigned).createDatasetAlignment(); + + /* + * alignAs lines up dataset sequences and removes empty columns (two) + */ + assertTrue(AlignmentUtils.alignAsSameSequences(tobealigned, aligned)); + assertEquals("cccGGG---TTTaaa", uas1.getSequenceAsString()); + assertEquals("GGGT", uas2.getSequenceAsString()); + assertEquals("CCC---gggtttAAA", uas3.getSequenceAsString()); + } + + @Test(groups = { "Functional" }) + public void testTransferGeneLoci() + { + SequenceI from = new Sequence("transcript", + "aaacccgggTTTAAACCCGGGtttaaacccgggttt"); + SequenceI to = new Sequence("CDS", "TTTAAACCCGGG"); + MapList map = new MapList(new int[] { 1, 12 }, new int[] { 10, 21 }, 1, + 1); + + /* + * first with nothing to transfer + */ + AlignmentUtils.transferGeneLoci(from, map, to); + assertNull(to.getGeneLoci()); + /* - * vary codons 1 and 2; variant products are sorted and non-redundant + * next with gene loci set on 'from' sequence */ - codonVariants = new String[][] { { "a", "C" }, { "g", "T" }, { "A" } }; - // aga ata cga cta code for R, I, R, L - variants = AlignmentUtils.computePeptideVariants(codonVariants, "S"); - assertEquals("[I, L, R]", variants.toString()); + int[] exons = new int[] { 100, 105, 155, 164, 210, 229 }; + MapList geneMap = new MapList(new int[] { 1, 36 }, exons, 1, 1); + from.setGeneLoci("human", "GRCh38", "7", geneMap); + AlignmentUtils.transferGeneLoci(from, map, to); + + GeneLociI toLoci = to.getGeneLoci(); + assertNotNull(toLoci); + // DBRefEntry constructor upper-cases 'source' + assertEquals("HUMAN", toLoci.getSpeciesId()); + assertEquals("GRCh38", toLoci.getAssemblyId()); + assertEquals("7", toLoci.getChromosomeId()); + + /* + * transcript 'exons' are 1-6, 7-16, 17-36 + * CDS 1:12 is transcript 10-21 + * transcript 'CDS' is 10-16, 17-21 + * which is 'gene' 158-164, 210-214 + */ + MapList toMap = toLoci.getMapping(); + assertEquals(1, toMap.getFromRanges().size()); + assertEquals(2, toMap.getFromRanges().get(0).length); + assertEquals(1, toMap.getFromRanges().get(0)[0]); + assertEquals(12, toMap.getFromRanges().get(0)[1]); + assertEquals(2, toMap.getToRanges().size()); + assertEquals(2, toMap.getToRanges().get(0).length); + assertEquals(158, toMap.getToRanges().get(0)[0]); + assertEquals(164, toMap.getToRanges().get(0)[1]); + assertEquals(210, toMap.getToRanges().get(1)[0]); + assertEquals(214, toMap.getToRanges().get(1)[1]); + // or summarised as (but toString might change in future): + assertEquals("[ [1, 12] ] 1:1 to [ [158, 164] [210, 214] ]", + toMap.toString()); + + /* + * an existing value is not overridden + */ + geneMap = new MapList(new int[] { 1, 36 }, new int[] { 36, 1 }, 1, 1); + from.setGeneLoci("inhuman", "GRCh37", "6", geneMap); + AlignmentUtils.transferGeneLoci(from, map, to); + assertEquals("GRCh38", toLoci.getAssemblyId()); + assertEquals("7", toLoci.getChromosomeId()); + toMap = toLoci.getMapping(); + assertEquals("[ [1, 12] ] 1:1 to [ [158, 164] [210, 214] ]", + toMap.toString()); + } + + /** + * Tests for the method that maps nucleotide to protein based on CDS features + */ + @Test(groups = "Functional") + public void testMapCdsToProtein() + { + SequenceI peptide = new Sequence("pep", "KLQ"); + + /* + * Case 1: CDS 3 times length of peptide + * NB method only checks lengths match, not translation + */ + SequenceI dna = new Sequence("dna", "AACGacgtCTCCT"); + dna.createDatasetSequence(); + dna.addSequenceFeature(new SequenceFeature("CDS", "", 1, 4, null)); + dna.addSequenceFeature(new SequenceFeature("CDS", "", 9, 13, null)); + MapList ml = AlignmentUtils.mapCdsToProtein(dna, peptide); + assertEquals(3, ml.getFromRatio()); + assertEquals(1, ml.getToRatio()); + assertEquals("[[1, 3]]", + Arrays.deepToString(ml.getToRanges().toArray())); + assertEquals("[[1, 4], [9, 13]]", + Arrays.deepToString(ml.getFromRanges().toArray())); + + /* + * Case 2: CDS 3 times length of peptide + stop codon + * (note code does not currently check trailing codon is a stop codon) + */ + dna = new Sequence("dna", "AACGacgtCTCCTCCC"); + dna.createDatasetSequence(); + dna.addSequenceFeature(new SequenceFeature("CDS", "", 1, 4, null)); + dna.addSequenceFeature(new SequenceFeature("CDS", "", 9, 16, null)); + ml = AlignmentUtils.mapCdsToProtein(dna, peptide); + assertEquals(3, ml.getFromRatio()); + assertEquals(1, ml.getToRatio()); + assertEquals("[[1, 3]]", + Arrays.deepToString(ml.getToRanges().toArray())); + assertEquals("[[1, 4], [9, 13]]", + Arrays.deepToString(ml.getFromRanges().toArray())); + + /* + * Case 3: CDS longer than 3 * peptide + stop codon - no mapping is made + */ + dna = new Sequence("dna", "AACGacgtCTCCTTGATCA"); + dna.createDatasetSequence(); + dna.addSequenceFeature(new SequenceFeature("CDS", "", 1, 4, null)); + dna.addSequenceFeature(new SequenceFeature("CDS", "", 9, 19, null)); + ml = AlignmentUtils.mapCdsToProtein(dna, peptide); + assertNull(ml); + + /* + * Case 4: CDS shorter than 3 * peptide - no mapping is made + */ + dna = new Sequence("dna", "AACGacgtCTCC"); + dna.createDatasetSequence(); + dna.addSequenceFeature(new SequenceFeature("CDS", "", 1, 4, null)); + dna.addSequenceFeature(new SequenceFeature("CDS", "", 9, 12, null)); + ml = AlignmentUtils.mapCdsToProtein(dna, peptide); + assertNull(ml); + + /* + * Case 5: CDS 3 times length of peptide + part codon - mapping is truncated + */ + dna = new Sequence("dna", "AACGacgtCTCCTTG"); + dna.createDatasetSequence(); + dna.addSequenceFeature(new SequenceFeature("CDS", "", 1, 4, null)); + dna.addSequenceFeature(new SequenceFeature("CDS", "", 9, 15, null)); + ml = AlignmentUtils.mapCdsToProtein(dna, peptide); + assertEquals(3, ml.getFromRatio()); + assertEquals(1, ml.getToRatio()); + assertEquals("[[1, 3]]", + Arrays.deepToString(ml.getToRanges().toArray())); + assertEquals("[[1, 4], [9, 13]]", + Arrays.deepToString(ml.getFromRanges().toArray())); + + /* + * Case 6: incomplete start codon corresponding to X in peptide + */ + dna = new Sequence("dna", "ACGacgtCTCCTTGG"); + dna.createDatasetSequence(); + SequenceFeature sf = new SequenceFeature("CDS", "", 1, 3, null); + sf.setPhase("2"); // skip 2 positions (AC) to start of next codon (GCT) + dna.addSequenceFeature(sf); + dna.addSequenceFeature(new SequenceFeature("CDS", "", 8, 15, null)); + peptide = new Sequence("pep", "XLQ"); + ml = AlignmentUtils.mapCdsToProtein(dna, peptide); + assertEquals("[[2, 3]]", + Arrays.deepToString(ml.getToRanges().toArray())); + assertEquals("[[3, 3], [8, 12]]", + Arrays.deepToString(ml.getFromRanges().toArray())); + } + + /** + * Tests for the method that locates the CDS sequence that has a mapping to + * the given protein. That is, given a transcript-to-peptide mapping, find the + * cds-to-peptide mapping that relates to both, and return the CDS sequence. + */ + @Test + public void testFindCdsForProtein() + { + List mappings = new ArrayList<>(); + AlignedCodonFrame acf1 = new AlignedCodonFrame(); + mappings.add(acf1); + + SequenceI dna1 = new Sequence("dna1", "cgatATcgGCTATCTATGacg"); + dna1.createDatasetSequence(); + + // NB we currently exclude STOP codon from CDS sequences + // the test would need to change if this changes in future + SequenceI cds1 = new Sequence("cds1", "ATGCTATCT"); + cds1.createDatasetSequence(); + + SequenceI pep1 = new Sequence("pep1", "MLS"); + pep1.createDatasetSequence(); + List seqMappings = new ArrayList<>(); + MapList mapList = new MapList( + new int[] + { 5, 6, 9, 15 }, new int[] { 1, 3 }, 3, 1); + Mapping dnaToPeptide = new Mapping(pep1.getDatasetSequence(), mapList); + + // add dna to peptide mapping + seqMappings.add(acf1); + acf1.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), + mapList); + + /* + * first case - no dna-to-CDS mapping exists - search fails + */ + SequenceI seq = AlignmentUtils.findCdsForProtein(mappings, dna1, + seqMappings, dnaToPeptide); + assertNull(seq); + + /* + * second case - CDS-to-peptide mapping exists but no dna-to-CDS + * - search fails + */ + // todo this test fails if the mapping is added to acf1, not acf2 + // need to tidy up use of lists of mappings in AlignedCodonFrame + AlignedCodonFrame acf2 = new AlignedCodonFrame(); + mappings.add(acf2); + MapList cdsToPeptideMapping = new MapList(new int[] + { 1, 9 }, new int[] { 1, 3 }, 3, 1); + acf2.addMap(cds1.getDatasetSequence(), pep1.getDatasetSequence(), + cdsToPeptideMapping); + assertNull(AlignmentUtils.findCdsForProtein(mappings, dna1, seqMappings, + dnaToPeptide)); + + /* + * third case - add dna-to-CDS mapping - CDS is now found! + */ + MapList dnaToCdsMapping = new MapList(new int[] { 5, 6, 9, 15 }, + new int[] + { 1, 9 }, 1, 1); + acf1.addMap(dna1.getDatasetSequence(), cds1.getDatasetSequence(), + dnaToCdsMapping); + seq = AlignmentUtils.findCdsForProtein(mappings, dna1, seqMappings, + dnaToPeptide); + assertSame(seq, cds1.getDatasetSequence()); + } + + /** + * Tests for the method that locates the CDS sequence that has a mapping to + * the given protein. That is, given a transcript-to-peptide mapping, find the + * cds-to-peptide mapping that relates to both, and return the CDS sequence. + * This test is for the case where transcript and CDS are the same length. + */ + @Test + public void testFindCdsForProtein_noUTR() + { + List mappings = new ArrayList<>(); + AlignedCodonFrame acf1 = new AlignedCodonFrame(); + mappings.add(acf1); + + SequenceI dna1 = new Sequence("dna1", "ATGCTATCTTAA"); + dna1.createDatasetSequence(); + + // NB we currently exclude STOP codon from CDS sequences + // the test would need to change if this changes in future + SequenceI cds1 = new Sequence("cds1", "ATGCTATCT"); + cds1.createDatasetSequence(); + + SequenceI pep1 = new Sequence("pep1", "MLS"); + pep1.createDatasetSequence(); + List seqMappings = new ArrayList<>(); + MapList mapList = new MapList( + new int[] + { 1, 9 }, new int[] { 1, 3 }, 3, 1); + Mapping dnaToPeptide = new Mapping(pep1.getDatasetSequence(), mapList); + + // add dna to peptide mapping + seqMappings.add(acf1); + acf1.addMap(dna1.getDatasetSequence(), pep1.getDatasetSequence(), + mapList); /* - * vary codons 2 and 3 + * first case - transcript lacks CDS features - it appears to be + * the CDS sequence and is returned */ - codonVariants = new String[][] { { "a" }, { "g", "T" }, { "A", "c" } }; - // aga agc ata atc code for R, S, I, I - variants = AlignmentUtils.computePeptideVariants(codonVariants, "S"); - assertEquals("[I, R]", variants.toString()); + SequenceI seq = AlignmentUtils.findCdsForProtein(mappings, dna1, + seqMappings, dnaToPeptide); + assertSame(seq, dna1.getDatasetSequence()); /* - * vary codons 1 and 3 + * second case - transcript has CDS feature - this means it is + * not returned as a match for CDS (CDS sequences don't have CDS features) + */ + dna1.addSequenceFeature( + new SequenceFeature(SequenceOntologyI.CDS, "cds", 1, 12, null)); + seq = AlignmentUtils.findCdsForProtein(mappings, dna1, seqMappings, + dnaToPeptide); + assertNull(seq); + + /* + * third case - CDS-to-peptide mapping exists but no dna-to-CDS + * - search fails */ - codonVariants = new String[][] { { "a", "t" }, { "a" }, { "t", "g" } }; - // aat aag tat tag code for N, K, Y, STOP - STOP sorted to end - variants = AlignmentUtils.computePeptideVariants(codonVariants, "S"); - assertEquals("[K, N, Y, STOP]", variants.toString()); + // todo this test fails if the mapping is added to acf1, not acf2 + // need to tidy up use of lists of mappings in AlignedCodonFrame + AlignedCodonFrame acf2 = new AlignedCodonFrame(); + mappings.add(acf2); + MapList cdsToPeptideMapping = new MapList(new int[] + { 1, 9 }, new int[] { 1, 3 }, 3, 1); + acf2.addMap(cds1.getDatasetSequence(), pep1.getDatasetSequence(), + cdsToPeptideMapping); + assertNull(AlignmentUtils.findCdsForProtein(mappings, dna1, seqMappings, + dnaToPeptide)); /* - * vary codons 1, 2 and 3 + * fourth case - add dna-to-CDS mapping - CDS is now found! */ - codonVariants = new String[][] { { "a", "t" }, { "G", "C" }, - { "t", "g" } }; - // agt agg act acg tgt tgg tct tcg code for S, R, T, T, C, W, S, S - variants = AlignmentUtils.computePeptideVariants(codonVariants, "S"); - assertEquals("[C, R, T, W]", variants.toString()); + MapList dnaToCdsMapping = new MapList(new int[] { 1, 9 }, + new int[] + { 1, 9 }, 1, 1); + acf1.addMap(dna1.getDatasetSequence(), cds1.getDatasetSequence(), + dnaToCdsMapping); + seq = AlignmentUtils.findCdsForProtein(mappings, dna1, seqMappings, + dnaToPeptide); + assertSame(seq, cds1.getDatasetSequence()); } }