X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;ds=sidebyside;f=test%2Fjalview%2Fdatamodel%2FSequenceTest.java;h=c0cb09cce15f397c7136a19d665502b4796e8042;hb=f8b17a9e7363b8a9e7cd12d61bc6d611c7c97d7d;hp=0d4003741b9c56b4b6755550bddbaee26de76831;hpb=46b2bc114452c0e30463214b3e82eb0a5c98d23f;p=jalview.git diff --git a/test/jalview/datamodel/SequenceTest.java b/test/jalview/datamodel/SequenceTest.java index 0d40037..c0cb09c 100644 --- a/test/jalview/datamodel/SequenceTest.java +++ b/test/jalview/datamodel/SequenceTest.java @@ -23,22 +23,42 @@ package jalview.datamodel; import static org.testng.AssertJUnit.assertEquals; import static org.testng.AssertJUnit.assertFalse; import static org.testng.AssertJUnit.assertNotNull; +import static org.testng.AssertJUnit.assertNotSame; import static org.testng.AssertJUnit.assertNull; import static org.testng.AssertJUnit.assertSame; import static org.testng.AssertJUnit.assertTrue; +import jalview.commands.EditCommand; +import jalview.commands.EditCommand.Action; import jalview.datamodel.PDBEntry.Type; +import jalview.gui.JvOptionPane; +import jalview.util.MapList; +import java.io.File; +import java.util.ArrayList; import java.util.Arrays; +import java.util.BitSet; import java.util.List; import java.util.Vector; +import junit.extensions.PA; + +import org.testng.Assert; +import org.testng.annotations.BeforeClass; import org.testng.annotations.BeforeMethod; import org.testng.annotations.Test; public class SequenceTest { - SequenceI seq; + + @BeforeClass(alwaysRun = true) + public void setUpJvOptionPane() + { + JvOptionPane.setInteractiveMode(false); + JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION); + } + + Sequence seq; @BeforeMethod(alwaysRun = true) public void setUp() @@ -59,6 +79,33 @@ public class SequenceTest assertEquals("Gap interval 1 end wrong", 4, gapInt.get(0)[1]); assertEquals("Gap interval 2 start wrong", 6, gapInt.get(1)[0]); assertEquals("Gap interval 2 end wrong", 8, gapInt.get(1)[1]); + + BitSet gapfield = aseq.getInsertionsAsBits(); + BitSet expectedgaps = new BitSet(); + expectedgaps.set(2, 5); + expectedgaps.set(6, 9); + + assertEquals(6, expectedgaps.cardinality()); + + assertEquals("getInsertionsAsBits didn't mark expected number of gaps", + 6, gapfield.cardinality()); + + assertEquals("getInsertionsAsBits not correct.", expectedgaps, gapfield); + } + + @Test(groups = ("Functional")) + public void testIsProtein() + { + // test Protein + assertTrue(new Sequence("prot", "ASDFASDFASDF").isProtein()); + // test DNA + assertFalse(new Sequence("prot", "ACGTACGTACGT").isProtein()); + // test RNA + SequenceI sq = new Sequence("prot", "ACGUACGUACGU"); + assertFalse(sq.isProtein()); + // change sequence, should trigger an update of cached result + sq.setSequence("ASDFASDFADSF"); + assertTrue(sq.isProtein()); } @Test(groups = { "Functional" }) @@ -82,8 +129,7 @@ public class SequenceTest { AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1", 1f); - AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2", - 1f); + addAnnotation("label2", "desc2", "calcId2", 1f); AlignmentAnnotation ann3 = addAnnotation("label1", "desc3", "calcId3", 1f); AlignmentAnnotation[] anns = seq.getAnnotation("label1"); @@ -105,16 +151,15 @@ public class SequenceTest @Test(groups = { "Functional" }) public void testGetAlignmentAnnotations_forCalcIdAndLabel() { - AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1", - 1f); + addAnnotation("label1", "desc1", "calcId1", 1f); AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2", 1f); - AlignmentAnnotation ann3 = addAnnotation("label2", "desc3", "calcId3", - 1f); + addAnnotation("label2", "desc3", "calcId3", 1f); AlignmentAnnotation ann4 = addAnnotation("label2", "desc3", "calcId2", 1f); - AlignmentAnnotation ann5 = addAnnotation("label5", "desc3", null, 1f); - AlignmentAnnotation ann6 = addAnnotation(null, "desc3", "calcId3", 1f); + addAnnotation("label5", "desc3", null, 1f); + addAnnotation(null, "desc3", "calcId3", 1f); + List anns = seq.getAlignmentAnnotations("calcId2", "label2"); assertEquals(2, anns.size()); @@ -185,82 +230,353 @@ public class SequenceTest @Test(groups = { "Functional" }) public void testFindIndex() { + /* + * call sequenceChanged() after each test to invalidate any cursor, + * forcing the 1-arg findIndex to be executed + */ SequenceI sq = new Sequence("test", "ABCDEF"); assertEquals(0, sq.findIndex(0)); + sq.sequenceChanged(); assertEquals(1, sq.findIndex(1)); + sq.sequenceChanged(); assertEquals(5, sq.findIndex(5)); + sq.sequenceChanged(); assertEquals(6, sq.findIndex(6)); + sq.sequenceChanged(); assertEquals(6, sq.findIndex(9)); - sq = new Sequence("test", "-A--B-C-D-E-F--"); - assertEquals(2, sq.findIndex(1)); - assertEquals(5, sq.findIndex(2)); - assertEquals(7, sq.findIndex(3)); + sq = new Sequence("test/8-13", "-A--B-C-D-E-F--"); + assertEquals(2, sq.findIndex(8)); + sq.sequenceChanged(); + assertEquals(5, sq.findIndex(9)); + sq.sequenceChanged(); + assertEquals(7, sq.findIndex(10)); // before start returns 0 + sq.sequenceChanged(); assertEquals(0, sq.findIndex(0)); + sq.sequenceChanged(); assertEquals(0, sq.findIndex(-1)); // beyond end returns last residue column + sq.sequenceChanged(); assertEquals(13, sq.findIndex(99)); - } /** - * Tests for the method that returns a dataset sequence position (base 1) for + * Tests for the method that returns a dataset sequence position (start..) for * an aligned column position (base 0). */ @Test(groups = { "Functional" }) public void testFindPosition() { - SequenceI sq = new Sequence("test", "ABCDEF"); - assertEquals(1, sq.findPosition(0)); - assertEquals(6, sq.findPosition(5)); + /* + * call sequenceChanged() after each test to invalidate any cursor, + * forcing the 1-arg findPosition to be executed + */ + SequenceI sq = new Sequence("test/8-13", "ABCDEF"); + assertEquals(8, sq.findPosition(0)); + // Sequence should now hold a cursor at [8, 0] + assertEquals("test:Pos8:Col1:startCol1:endCol0:tok0", + PA.getValue(sq, "cursor").toString()); + SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + int token = (int) PA.getValue(sq, "changeCount"); + assertEquals(new SequenceCursor(sq, 8, 1, token), cursor); + + sq.sequenceChanged(); + + /* + * find F13 at column offset 5, cursor should update to [13, 6] + * endColumn is found and saved in cursor + */ + assertEquals(13, sq.findPosition(5)); + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals(++token, (int) PA.getValue(sq, "changeCount")); + assertEquals(new SequenceCursor(sq, 13, 6, token), cursor); + assertEquals("test:Pos13:Col6:startCol1:endCol6:tok1", + PA.getValue(sq, "cursor").toString()); + // assertEquals(-1, seq.findPosition(6)); // fails - sq = new Sequence("test", "AB-C-D--"); - assertEquals(1, sq.findPosition(0)); - assertEquals(2, sq.findPosition(1)); + sq = new Sequence("test/8-11", "AB-C-D--"); + token = (int) PA.getValue(sq, "changeCount"); // 0 + assertEquals(8, sq.findPosition(0)); + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals(new SequenceCursor(sq, 8, 1, token), cursor); + assertEquals("test:Pos8:Col1:startCol1:endCol0:tok0", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); + assertEquals(9, sq.findPosition(1)); + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals(new SequenceCursor(sq, 9, 2, ++token), cursor); + assertEquals("test:Pos9:Col2:startCol1:endCol0:tok1", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); // gap position 'finds' residue to the right (not the left as per javadoc) - assertEquals(3, sq.findPosition(2)); - assertEquals(3, sq.findPosition(3)); - assertEquals(4, sq.findPosition(4)); - assertEquals(4, sq.findPosition(5)); + // cursor is set to the last residue position found [B 2] + assertEquals(10, sq.findPosition(2)); + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals(new SequenceCursor(sq, 9, 2, ++token), cursor); + assertEquals("test:Pos9:Col2:startCol1:endCol0:tok2", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); + assertEquals(10, sq.findPosition(3)); + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals(new SequenceCursor(sq, 10, 4, ++token), cursor); + assertEquals("test:Pos10:Col4:startCol1:endCol0:tok3", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); + // column[4] is the gap after C - returns D11 + // cursor is set to [C 4] + assertEquals(11, sq.findPosition(4)); + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals(new SequenceCursor(sq, 10, 4, ++token), cursor); + assertEquals("test:Pos10:Col4:startCol1:endCol0:tok4", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); + assertEquals(11, sq.findPosition(5)); // D + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals(new SequenceCursor(sq, 11, 6, ++token), cursor); + // lastCol has been found and saved in the cursor + assertEquals("test:Pos11:Col6:startCol1:endCol6:tok5", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); // returns 1 more than sequence length if off the end ?!? - assertEquals(5, sq.findPosition(6)); - assertEquals(5, sq.findPosition(7)); + assertEquals(12, sq.findPosition(6)); - sq = new Sequence("test", "--AB-C-DEF--"); - assertEquals(1, sq.findPosition(0)); - assertEquals(1, sq.findPosition(1)); - assertEquals(1, sq.findPosition(2)); - assertEquals(2, sq.findPosition(3)); - assertEquals(3, sq.findPosition(4)); - assertEquals(3, sq.findPosition(5)); - assertEquals(4, sq.findPosition(6)); - assertEquals(4, sq.findPosition(7)); - assertEquals(5, sq.findPosition(8)); - assertEquals(6, sq.findPosition(9)); - assertEquals(7, sq.findPosition(10)); - assertEquals(7, sq.findPosition(11)); + sq.sequenceChanged(); + assertEquals(12, sq.findPosition(7)); + + /* + * first findPosition should also set firstResCol in cursor + */ + sq = new Sequence("test/8-13", "--AB-C-DEF--"); + assertEquals(8, sq.findPosition(0)); + assertNull(PA.getValue(sq, "cursor")); + + sq.sequenceChanged(); + assertEquals(8, sq.findPosition(1)); + assertNull(PA.getValue(sq, "cursor")); + + sq.sequenceChanged(); + assertEquals(8, sq.findPosition(2)); + assertEquals("test:Pos8:Col3:startCol3:endCol0:tok2", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); + assertEquals(9, sq.findPosition(3)); + assertEquals("test:Pos9:Col4:startCol3:endCol0:tok3", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); + // column[4] is a gap, returns next residue pos (C10) + // cursor is set to last residue found [B] + assertEquals(10, sq.findPosition(4)); + assertEquals("test:Pos9:Col4:startCol3:endCol0:tok4", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); + assertEquals(10, sq.findPosition(5)); + assertEquals("test:Pos10:Col6:startCol3:endCol0:tok5", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); + // column[6] is a gap, returns next residue pos (D11) + // cursor is set to last residue found [C] + assertEquals(11, sq.findPosition(6)); + assertEquals("test:Pos10:Col6:startCol3:endCol0:tok6", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); + assertEquals(11, sq.findPosition(7)); + assertEquals("test:Pos11:Col8:startCol3:endCol0:tok7", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); + assertEquals(12, sq.findPosition(8)); + assertEquals("test:Pos12:Col9:startCol3:endCol0:tok8", + PA.getValue(sq, "cursor").toString()); + + /* + * when the last residue column is found, it is set in the cursor + */ + sq.sequenceChanged(); + assertEquals(13, sq.findPosition(9)); + assertEquals("test:Pos13:Col10:startCol3:endCol10:tok9", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); + assertEquals(14, sq.findPosition(10)); + assertEquals("test:Pos13:Col10:startCol3:endCol10:tok10", + PA.getValue(sq, "cursor").toString()); + + /* + * findPosition for column beyond sequence length + * returns 1 more than last residue position + */ + sq.sequenceChanged(); + assertEquals(14, sq.findPosition(11)); + assertEquals("test:Pos13:Col10:startCol3:endCol10:tok11", + PA.getValue(sq, "cursor").toString()); + + sq.sequenceChanged(); + assertEquals(14, sq.findPosition(99)); + assertEquals("test:Pos13:Col10:startCol3:endCol10:tok12", + PA.getValue(sq, "cursor").toString()); + + /* + * gapped sequence ending in non-gap + */ + sq = new Sequence("test/8-13", "--AB-C-DEF"); + assertEquals(13, sq.findPosition(9)); + assertEquals("test:Pos13:Col10:startCol3:endCol10:tok0", + PA.getValue(sq, "cursor").toString()); + sq.sequenceChanged(); + assertEquals(12, sq.findPosition(8)); + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + // sequenceChanged() invalidates cursor.lastResidueColumn + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals("test:Pos12:Col9:startCol3:endCol0:tok1", + cursor.toString()); + // findPosition with cursor accepts base 1 column values + assertEquals(13, ((Sequence) sq).findPosition(10, cursor)); + assertEquals(13, sq.findPosition(9)); // F13 + // lastResidueColumn has now been found and saved in cursor + assertEquals("test:Pos13:Col10:startCol3:endCol10:tok1", + PA.getValue(sq, "cursor").toString()); } @Test(groups = { "Functional" }) public void testDeleteChars() { + /* + * internal delete + */ SequenceI sq = new Sequence("test", "ABCDEF"); + assertNull(PA.getValue(sq, "datasetSequence")); assertEquals(1, sq.getStart()); assertEquals(6, sq.getEnd()); sq.deleteChars(2, 3); assertEquals("ABDEF", sq.getSequenceAsString()); assertEquals(1, sq.getStart()); assertEquals(5, sq.getEnd()); + assertNull(PA.getValue(sq, "datasetSequence")); + /* + * delete at start + */ sq = new Sequence("test", "ABCDEF"); sq.deleteChars(0, 2); assertEquals("CDEF", sq.getSequenceAsString()); assertEquals(3, sq.getStart()); assertEquals(6, sq.getEnd()); + assertNull(PA.getValue(sq, "datasetSequence")); + + /* + * delete at end + */ + sq = new Sequence("test", "ABCDEF"); + sq.deleteChars(4, 6); + assertEquals("ABCD", sq.getSequenceAsString()); + assertEquals(1, sq.getStart()); + assertEquals(4, sq.getEnd()); + assertNull(PA.getValue(sq, "datasetSequence")); + } + + @Test(groups = { "Functional" }) + public void testDeleteChars_withDbRefsAndFeatures() + { + /* + * internal delete - new dataset sequence created + * gets a copy of any dbrefs + */ + SequenceI sq = new Sequence("test", "ABCDEF"); + sq.createDatasetSequence(); + DBRefEntry dbr1 = new DBRefEntry("Uniprot", "0", "a123"); + sq.addDBRef(dbr1); + Object ds = PA.getValue(sq, "datasetSequence"); + assertNotNull(ds); + assertEquals(1, sq.getStart()); + assertEquals(6, sq.getEnd()); + sq.deleteChars(2, 3); + assertEquals("ABDEF", sq.getSequenceAsString()); + assertEquals(1, sq.getStart()); + assertEquals(5, sq.getEnd()); + Object newDs = PA.getValue(sq, "datasetSequence"); + assertNotNull(newDs); + assertNotSame(ds, newDs); + assertNotNull(sq.getDBRefs()); + assertEquals(1, sq.getDBRefs().length); + assertNotSame(dbr1, sq.getDBRefs()[0]); + assertEquals(dbr1, sq.getDBRefs()[0]); + + /* + * internal delete with sequence features + * (failure case for JAL-2541) + */ + sq = new Sequence("test", "ABCDEF"); + sq.createDatasetSequence(); + SequenceFeature sf1 = new SequenceFeature("Cath", "desc", 2, 4, 2f, + "CathGroup"); + sq.addSequenceFeature(sf1); + ds = PA.getValue(sq, "datasetSequence"); + assertNotNull(ds); + assertEquals(1, sq.getStart()); + assertEquals(6, sq.getEnd()); + sq.deleteChars(2, 4); + assertEquals("ABEF", sq.getSequenceAsString()); + assertEquals(1, sq.getStart()); + assertEquals(4, sq.getEnd()); + newDs = PA.getValue(sq, "datasetSequence"); + assertNotNull(newDs); + assertNotSame(ds, newDs); + List sfs = sq.getSequenceFeatures(); + assertEquals(1, sfs.size()); + assertNotSame(sf1, sfs.get(0)); + assertEquals(sf1, sfs.get(0)); + + /* + * delete at start - no new dataset sequence created + * any sequence features remain as before + */ + sq = new Sequence("test", "ABCDEF"); + sq.createDatasetSequence(); + ds = PA.getValue(sq, "datasetSequence"); + sf1 = new SequenceFeature("Cath", "desc", 2, 4, 2f, "CathGroup"); + sq.addSequenceFeature(sf1); + sq.deleteChars(0, 2); + assertEquals("CDEF", sq.getSequenceAsString()); + assertEquals(3, sq.getStart()); + assertEquals(6, sq.getEnd()); + assertSame(ds, PA.getValue(sq, "datasetSequence")); + sfs = sq.getSequenceFeatures(); + assertNotNull(sfs); + assertEquals(1, sfs.size()); + assertSame(sf1, sfs.get(0)); + + /* + * delete at end - no new dataset sequence created + * any dbrefs remain as before + */ + sq = new Sequence("test", "ABCDEF"); + sq.createDatasetSequence(); + ds = PA.getValue(sq, "datasetSequence"); + dbr1 = new DBRefEntry("Uniprot", "0", "a123"); + sq.addDBRef(dbr1); + sq.deleteChars(4, 6); + assertEquals("ABCD", sq.getSequenceAsString()); + assertEquals(1, sq.getStart()); + assertEquals(4, sq.getEnd()); + assertSame(ds, PA.getValue(sq, "datasetSequence")); + assertNotNull(sq.getDBRefs()); + assertEquals(1, sq.getDBRefs().length); + assertSame(dbr1, sq.getDBRefs()[0]); } @Test(groups = { "Functional" }) @@ -298,42 +614,58 @@ public class SequenceTest SequenceI sq = new Sequence("test", "GATCAT"); sq.createDatasetSequence(); - assertNull(sq.getSequenceFeatures()); + assertTrue(sq.getSequenceFeatures().isEmpty()); /* * SequenceFeature on sequence */ - SequenceFeature sf = new SequenceFeature(); + SequenceFeature sf = new SequenceFeature("Cath", "desc", 2, 4, 2f, null); sq.addSequenceFeature(sf); - SequenceFeature[] sfs = sq.getSequenceFeatures(); - assertEquals(1, sfs.length); - assertSame(sf, sfs[0]); + List sfs = sq.getSequenceFeatures(); + assertEquals(1, sfs.size()); + assertSame(sf, sfs.get(0)); /* * SequenceFeature on sequence and dataset sequence; returns that on * sequence + * + * Note JAL-2046: spurious: we have no use case for this at the moment. + * This test also buggy - as sf2.equals(sf), no new feature is added */ - SequenceFeature sf2 = new SequenceFeature(); + SequenceFeature sf2 = new SequenceFeature("Cath", "desc", 2, 4, 2f, + null); sq.getDatasetSequence().addSequenceFeature(sf2); sfs = sq.getSequenceFeatures(); - assertEquals(1, sfs.length); - assertSame(sf, sfs[0]); + assertEquals(1, sfs.size()); + assertSame(sf, sfs.get(0)); /* * SequenceFeature on dataset sequence only + * Note JAL-2046: spurious: we have no use case for setting a non-dataset sequence's feature array to null at the moment. */ sq.setSequenceFeatures(null); - sfs = sq.getSequenceFeatures(); - assertEquals(1, sfs.length); - assertSame(sf2, sfs[0]); + assertTrue(sq.getDatasetSequence().getSequenceFeatures().isEmpty()); /* * Corrupt case - no SequenceFeature, dataset's dataset is the original * sequence. Test shows no infinite loop results. */ sq.getDatasetSequence().setSequenceFeatures(null); - sq.getDatasetSequence().setDatasetSequence(sq); // loop! - assertNull(sq.getSequenceFeatures()); + /** + * is there a usecase for this ? setDatasetSequence should throw an error if + * this actually occurs. + */ + try + { + sq.getDatasetSequence().setDatasetSequence(sq); // loop! + Assert.fail("Expected Error to be raised when calling setDatasetSequence with self reference"); + } catch (IllegalArgumentException e) + { + // TODO Jalview error/exception class for raising implementation errors + assertTrue(e.getMessage().toLowerCase() + .contains("implementation error")); + } + assertTrue(sq.getSequenceFeatures().isEmpty()); } /** @@ -377,25 +709,149 @@ public class SequenceTest } /** + * test createDatasetSequence behaves to doc + */ + @Test(groups = { "Functional" }) + public void testCreateDatasetSequence() + { + SequenceI sq = new Sequence("my", "ASDASD"); + sq.addSequenceFeature(new SequenceFeature("type", "desc", 1, 10, 1f, + "group")); + sq.addDBRef(new DBRefEntry("source", "version", "accession")); + assertNull(sq.getDatasetSequence()); + assertNotNull(PA.getValue(sq, "sequenceFeatureStore")); + assertNotNull(PA.getValue(sq, "dbrefs")); + + SequenceI rds = sq.createDatasetSequence(); + assertNotNull(rds); + assertNull(rds.getDatasetSequence()); + assertSame(sq.getDatasetSequence(), rds); + + // sequence features and dbrefs transferred to dataset sequence + assertNull(PA.getValue(sq, "sequenceFeatureStore")); + assertNull(PA.getValue(sq, "dbrefs")); + assertNotNull(PA.getValue(rds, "sequenceFeatureStore")); + assertNotNull(PA.getValue(rds, "dbrefs")); + } + + /** * Test for deriveSequence applied to a sequence with a dataset */ @Test(groups = { "Functional" }) public void testDeriveSequence_existingDataset() { - SequenceI sq = new Sequence("Seq1", "CD"); + Sequence sq = new Sequence("Seq1", "CD"); sq.setDatasetSequence(new Sequence("Seq1", "ABCDEF")); sq.getDatasetSequence().addSequenceFeature( new SequenceFeature("", "", 1, 2, 0f, null)); sq.setStart(3); sq.setEnd(4); - SequenceI derived = sq.deriveSequence(); + + sq.setDescription("Test sequence description.."); + sq.setVamsasId("TestVamsasId"); + sq.addDBRef(new DBRefEntry("PDB", "version0", "1TST")); + + sq.addDBRef(new DBRefEntry("PDB", "version1", "1PDB")); + sq.addDBRef(new DBRefEntry("PDB", "version2", "2PDB")); + sq.addDBRef(new DBRefEntry("PDB", "version3", "3PDB")); + sq.addDBRef(new DBRefEntry("PDB", "version4", "4PDB")); + + sq.addPDBId(new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1")); + sq.addPDBId(new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1")); + sq.addPDBId(new PDBEntry("2PDB", "A", Type.MMCIF, "filePath/test2")); + sq.addPDBId(new PDBEntry("2PDB", "B", Type.MMCIF, "filePath/test2")); + + // these are the same as ones already added + DBRefEntry pdb1pdb = new DBRefEntry("PDB", "version1", "1PDB"); + DBRefEntry pdb2pdb = new DBRefEntry("PDB", "version2", "2PDB"); + + List primRefs = Arrays.asList(new DBRefEntry[] { pdb1pdb, + pdb2pdb }); + + sq.getDatasetSequence().addDBRef(pdb1pdb); // should do nothing + sq.getDatasetSequence().addDBRef(pdb2pdb); // should do nothing + sq.getDatasetSequence().addDBRef( + new DBRefEntry("PDB", "version3", "3PDB")); // should do nothing + sq.getDatasetSequence().addDBRef( + new DBRefEntry("PDB", "version4", "4PDB")); // should do nothing + + PDBEntry pdbe1a = new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1"); + PDBEntry pdbe1b = new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1"); + PDBEntry pdbe2a = new PDBEntry("2PDB", "A", Type.MMCIF, + "filePath/test2"); + PDBEntry pdbe2b = new PDBEntry("2PDB", "B", Type.MMCIF, + "filePath/test2"); + sq.getDatasetSequence().addPDBId(pdbe1a); + sq.getDatasetSequence().addPDBId(pdbe1b); + sq.getDatasetSequence().addPDBId(pdbe2a); + sq.getDatasetSequence().addPDBId(pdbe2b); + + /* + * test we added pdb entries to the dataset sequence + */ + Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries(), Arrays + .asList(new PDBEntry[] { pdbe1a, pdbe1b, pdbe2a, pdbe2b }), + "PDB Entries were not found on dataset sequence."); + + /* + * we should recover a pdb entry that is on the dataset sequence via PDBEntry + */ + Assert.assertEquals(pdbe1a, + sq.getDatasetSequence().getPDBEntry("1PDB"), + "PDB Entry '1PDB' not found on dataset sequence via getPDBEntry."); + ArrayList annotsList = new ArrayList(); + System.out.println(">>>>>> " + sq.getSequenceAsString().length()); + annotsList.add(new Annotation("A", "A", 'X', 0.1f)); + annotsList.add(new Annotation("A", "A", 'X', 0.1f)); + Annotation[] annots = annotsList.toArray(new Annotation[0]); + sq.addAlignmentAnnotation(new AlignmentAnnotation("Test annot", + "Test annot description", annots)); + sq.getDatasetSequence().addAlignmentAnnotation( + new AlignmentAnnotation("Test annot", "Test annot description", + annots)); + Assert.assertEquals(sq.getDescription(), "Test sequence description.."); + Assert.assertEquals(sq.getDBRefs().length, 5); // DBRefs are on dataset + // sequence + Assert.assertEquals(sq.getAllPDBEntries().size(), 4); + Assert.assertNotNull(sq.getAnnotation()); + Assert.assertEquals(sq.getAnnotation()[0].annotations.length, 2); + Assert.assertEquals(sq.getDatasetSequence().getDBRefs().length, 5); // same + // as + // sq.getDBRefs() + Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries().size(), + 4); + Assert.assertNotNull(sq.getDatasetSequence().getAnnotation()); + + Sequence derived = (Sequence) sq.deriveSequence(); + + Assert.assertEquals(derived.getDescription(), + "Test sequence description.."); + Assert.assertEquals(derived.getDBRefs().length, 5); // come from dataset + Assert.assertEquals(derived.getAllPDBEntries().size(), 4); + Assert.assertNotNull(derived.getAnnotation()); + Assert.assertEquals(derived.getAnnotation()[0].annotations.length, 2); + Assert.assertEquals(derived.getDatasetSequence().getDBRefs().length, 5); + Assert.assertEquals(derived.getDatasetSequence().getAllPDBEntries() + .size(), 4); + Assert.assertNotNull(derived.getDatasetSequence().getAnnotation()); + assertEquals("CD", derived.getSequenceAsString()); assertSame(sq.getDatasetSequence(), derived.getDatasetSequence()); - assertNull(((Sequence) seq).sequenceFeatures); - assertNull(((Sequence) derived).sequenceFeatures); - assertNotNull(seq.getSequenceFeatures()); - assertSame(seq.getSequenceFeatures(), derived.getSequenceFeatures()); + // derived sequence should access dataset sequence features + assertNotNull(sq.getSequenceFeatures()); + assertEquals(sq.getSequenceFeatures(), derived.getSequenceFeatures()); + + /* + * verify we have primary db refs *just* for PDB IDs with associated + * PDBEntry objects + */ + + assertEquals(primRefs, sq.getPrimaryDBRefs()); + assertEquals(primRefs, sq.getDatasetSequence().getPrimaryDBRefs()); + + assertEquals(sq.getPrimaryDBRefs(), derived.getPrimaryDBRefs()); + } /** @@ -440,7 +896,7 @@ public class SequenceTest 12.4f, "group")); seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File")); seq1.addDBRef(new DBRefEntry("EMBL", "1.2", "AZ12345")); - + SequenceI copy = new Sequence(seq1); assertNull(copy.getDatasetSequence()); @@ -467,6 +923,8 @@ public class SequenceTest seq1.setDescription("description"); seq1.addAlignmentAnnotation(new AlignmentAnnotation("label", "desc", 1.3d)); + // JAL-2046 - what is the contract for using a derived sequence's + // addSequenceFeature ? seq1.addSequenceFeature(new SequenceFeature("type", "desc", 22, 33, 12.4f, "group")); seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File")); @@ -512,10 +970,18 @@ public class SequenceTest assertEquals(anns[0].score, seq1.getAnnotation()[0].score); // copy has a copy of the sequence feature: - SequenceFeature[] sfs = copy.getSequenceFeatures(); - assertEquals(1, sfs.length); - assertFalse(sfs[0] == seq1.getSequenceFeatures()[0]); - assertTrue(sfs[0].equals(seq1.getSequenceFeatures()[0])); + List sfs = copy.getSequenceFeatures(); + assertEquals(1, sfs.size()); + if (seq1.getDatasetSequence() != null + && copy.getDatasetSequence() == seq1.getDatasetSequence()) + { + assertSame(sfs.get(0), seq1.getSequenceFeatures().get(0)); + } + else + { + assertNotSame(sfs.get(0), seq1.getSequenceFeatures().get(0)); + } + assertEquals(sfs.get(0), seq1.getSequenceFeatures().get(0)); // copy has a copy of the PDB entry Vector pdbs = copy.getAllPDBEntries(); @@ -523,4 +989,818 @@ public class SequenceTest assertFalse(pdbs.get(0) == seq1.getAllPDBEntries().get(0)); assertTrue(pdbs.get(0).equals(seq1.getAllPDBEntries().get(0))); } + + @Test(groups = "Functional") + public void testGetCharAt() + { + SequenceI sq = new Sequence("", "abcde"); + assertEquals('a', sq.getCharAt(0)); + assertEquals('e', sq.getCharAt(4)); + assertEquals(' ', sq.getCharAt(5)); + assertEquals(' ', sq.getCharAt(-1)); + } + + @Test(groups = { "Functional" }) + public void testAddSequenceFeatures() + { + SequenceI sq = new Sequence("", "abcde"); + // type may not be null + assertFalse(sq.addSequenceFeature(new SequenceFeature(null, "desc", 4, + 8, 0f, null))); + assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4, + 8, 0f, null))); + // can't add a duplicate feature + assertFalse(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", + 4, 8, 0f, null))); + // can add a different feature + assertTrue(sq.addSequenceFeature(new SequenceFeature("Scop", "desc", 4, + 8, 0f, null))); // different type + assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", + "description", 4, 8, 0f, null)));// different description + assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 3, + 8, 0f, null))); // different start position + assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4, + 9, 0f, null))); // different end position + assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4, + 8, 1f, null))); // different score + assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4, + 8, Float.NaN, null))); // score NaN + assertTrue(sq.addSequenceFeature(new SequenceFeature("Cath", "desc", 4, + 8, 0f, "Metal"))); // different group + assertEquals(8, sq.getFeatures().getAllFeatures().size()); + } + + /** + * Tests for adding (or updating) dbrefs + * + * @see DBRefEntry#updateFrom(DBRefEntry) + */ + @Test(groups = { "Functional" }) + public void testAddDBRef() + { + SequenceI sq = new Sequence("", "abcde"); + assertNull(sq.getDBRefs()); + DBRefEntry dbref = new DBRefEntry("Uniprot", "1", "P00340"); + sq.addDBRef(dbref); + assertEquals(1, sq.getDBRefs().length); + assertSame(dbref, sq.getDBRefs()[0]); + + /* + * change of version - new entry + */ + DBRefEntry dbref2 = new DBRefEntry("Uniprot", "2", "P00340"); + sq.addDBRef(dbref2); + assertEquals(2, sq.getDBRefs().length); + assertSame(dbref, sq.getDBRefs()[0]); + assertSame(dbref2, sq.getDBRefs()[1]); + + /* + * matches existing entry - not added + */ + sq.addDBRef(new DBRefEntry("UNIPROT", "1", "p00340")); + assertEquals(2, sq.getDBRefs().length); + + /* + * different source = new entry + */ + DBRefEntry dbref3 = new DBRefEntry("UniRef", "1", "p00340"); + sq.addDBRef(dbref3); + assertEquals(3, sq.getDBRefs().length); + assertSame(dbref3, sq.getDBRefs()[2]); + + /* + * different ref = new entry + */ + DBRefEntry dbref4 = new DBRefEntry("UniRef", "1", "p00341"); + sq.addDBRef(dbref4); + assertEquals(4, sq.getDBRefs().length); + assertSame(dbref4, sq.getDBRefs()[3]); + + /* + * matching ref with a mapping - map updated + */ + DBRefEntry dbref5 = new DBRefEntry("UniRef", "1", "p00341"); + Mapping map = new Mapping(new MapList(new int[] { 1, 3 }, new int[] { + 1, 1 }, 3, 1)); + dbref5.setMap(map); + sq.addDBRef(dbref5); + assertEquals(4, sq.getDBRefs().length); + assertSame(dbref4, sq.getDBRefs()[3]); + assertSame(map, dbref4.getMap()); + + /* + * 'real' version replaces "0" version + */ + dbref2.setVersion("0"); + DBRefEntry dbref6 = new DBRefEntry(dbref2.getSource(), "3", + dbref2.getAccessionId()); + sq.addDBRef(dbref6); + assertEquals(4, sq.getDBRefs().length); + assertSame(dbref2, sq.getDBRefs()[1]); + assertEquals("3", dbref2.getVersion()); + + /* + * 'real' version replaces "source:0" version + */ + dbref3.setVersion("Uniprot:0"); + DBRefEntry dbref7 = new DBRefEntry(dbref3.getSource(), "3", + dbref3.getAccessionId()); + sq.addDBRef(dbref7); + assertEquals(4, sq.getDBRefs().length); + assertSame(dbref3, sq.getDBRefs()[2]); + assertEquals("3", dbref2.getVersion()); + } + + @Test(groups = { "Functional" }) + public void testGetPrimaryDBRefs_peptide() + { + SequenceI sq = new Sequence("aseq", "ASDFKYLMQPRST", 10, 22); + + // no dbrefs + List primaryDBRefs = sq.getPrimaryDBRefs(); + assertTrue(primaryDBRefs.isEmpty()); + + // empty dbrefs + sq.setDBRefs(new DBRefEntry[] {}); + primaryDBRefs = sq.getPrimaryDBRefs(); + assertTrue(primaryDBRefs.isEmpty()); + + // primary - uniprot + DBRefEntry upentry1 = new DBRefEntry("UNIPROT", "0", "Q04760"); + sq.addDBRef(upentry1); + + // primary - uniprot with congruent map + DBRefEntry upentry2 = new DBRefEntry("UNIPROT", "0", "Q04762"); + upentry2.setMap(new Mapping(null, new MapList(new int[] { 10, 22 }, + new int[] { 10, 22 }, 1, 1))); + sq.addDBRef(upentry2); + + // primary - uniprot with map of enclosing sequence + DBRefEntry upentry3 = new DBRefEntry("UNIPROT", "0", "Q04763"); + upentry3.setMap(new Mapping(null, new MapList(new int[] { 8, 24 }, + new int[] { 8, 24 }, 1, 1))); + sq.addDBRef(upentry3); + + // not primary - uniprot with map of sub-sequence (5') + DBRefEntry upentry4 = new DBRefEntry("UNIPROT", "0", "Q04764"); + upentry4.setMap(new Mapping(null, new MapList(new int[] { 10, 18 }, + new int[] { 10, 18 }, 1, 1))); + sq.addDBRef(upentry4); + + // not primary - uniprot with map that overlaps 3' + DBRefEntry upentry5 = new DBRefEntry("UNIPROT", "0", "Q04765"); + upentry5.setMap(new Mapping(null, new MapList(new int[] { 12, 22 }, + new int[] { 12, 22 }, 1, 1))); + sq.addDBRef(upentry5); + + // not primary - uniprot with map to different coordinates frame + DBRefEntry upentry6 = new DBRefEntry("UNIPROT", "0", "Q04766"); + upentry6.setMap(new Mapping(null, new MapList(new int[] { 12, 18 }, + new int[] { 112, 118 }, 1, 1))); + sq.addDBRef(upentry6); + + // not primary - dbref to 'non-core' database + DBRefEntry upentry7 = new DBRefEntry("Pfam", "0", "PF00903"); + sq.addDBRef(upentry7); + + // primary - type is PDB + DBRefEntry pdbentry = new DBRefEntry("PDB", "0", "1qip"); + sq.addDBRef(pdbentry); + + // not primary - PDBEntry has no file + sq.addDBRef(new DBRefEntry("PDB", "0", "1AAA")); + + // not primary - no PDBEntry + sq.addDBRef(new DBRefEntry("PDB", "0", "1DDD")); + + // add corroborating PDB entry for primary DBref - + // needs to have a file as well as matching ID + // note PDB ID is not treated as case sensitive + sq.addPDBId(new PDBEntry("1QIP", null, Type.PDB, new File("/blah") + .toString())); + + // not valid DBRef - no file.. + sq.addPDBId(new PDBEntry("1AAA", null, null, null)); + + primaryDBRefs = sq.getPrimaryDBRefs(); + assertEquals(4, primaryDBRefs.size()); + assertTrue("Couldn't find simple primary reference (UNIPROT)", + primaryDBRefs.contains(upentry1)); + assertTrue("Couldn't find mapped primary reference (UNIPROT)", + primaryDBRefs.contains(upentry2)); + assertTrue("Couldn't find mapped context reference (UNIPROT)", + primaryDBRefs.contains(upentry3)); + assertTrue("Couldn't find expected PDB primary reference", + primaryDBRefs.contains(pdbentry)); + } + + @Test(groups = { "Functional" }) + public void testGetPrimaryDBRefs_nucleotide() + { + SequenceI sq = new Sequence("aseq", "TGATCACTCGACTAGCATCAGCATA", 10, 34); + + // primary - Ensembl + DBRefEntry dbr1 = new DBRefEntry("ENSEMBL", "0", "ENSG1234"); + sq.addDBRef(dbr1); + + // not primary - Ensembl 'transcript' mapping of sub-sequence + DBRefEntry dbr2 = new DBRefEntry("ENSEMBL", "0", "ENST1234"); + dbr2.setMap(new Mapping(null, new MapList(new int[] { 15, 25 }, + new int[] { 1, 11 }, 1, 1))); + sq.addDBRef(dbr2); + + // primary - EMBL with congruent map + DBRefEntry dbr3 = new DBRefEntry("EMBL", "0", "J1234"); + dbr3.setMap(new Mapping(null, new MapList(new int[] { 10, 34 }, + new int[] { 10, 34 }, 1, 1))); + sq.addDBRef(dbr3); + + // not primary - to non-core database + DBRefEntry dbr4 = new DBRefEntry("CCDS", "0", "J1234"); + sq.addDBRef(dbr4); + + // not primary - to protein + DBRefEntry dbr5 = new DBRefEntry("UNIPROT", "0", "Q87654"); + sq.addDBRef(dbr5); + + List primaryDBRefs = sq.getPrimaryDBRefs(); + assertEquals(2, primaryDBRefs.size()); + assertTrue(primaryDBRefs.contains(dbr1)); + assertTrue(primaryDBRefs.contains(dbr3)); + } + + /** + * Test the method that updates the list of PDBEntry from any new DBRefEntry + * for PDB + */ + @Test(groups = { "Functional" }) + public void testUpdatePDBIds() + { + PDBEntry pdbe1 = new PDBEntry("3A6S", null, null, null); + seq.addPDBId(pdbe1); + seq.addDBRef(new DBRefEntry("Ensembl", "8", "ENST1234")); + seq.addDBRef(new DBRefEntry("PDB", "0", "1A70")); + seq.addDBRef(new DBRefEntry("PDB", "0", "4BQGa")); + seq.addDBRef(new DBRefEntry("PDB", "0", "3a6sB")); + // 7 is not a valid chain code: + seq.addDBRef(new DBRefEntry("PDB", "0", "2GIS7")); + + seq.updatePDBIds(); + List pdbIds = seq.getAllPDBEntries(); + assertEquals(4, pdbIds.size()); + assertSame(pdbe1, pdbIds.get(0)); + // chain code got added to 3A6S: + assertEquals("B", pdbe1.getChainCode()); + assertEquals("1A70", pdbIds.get(1).getId()); + // 4BQGA is parsed into id + chain + assertEquals("4BQG", pdbIds.get(2).getId()); + assertEquals("a", pdbIds.get(2).getChainCode()); + assertEquals("2GIS7", pdbIds.get(3).getId()); + assertNull(pdbIds.get(3).getChainCode()); + } + + /** + * Test the method that either adds a pdbid or updates an existing one + */ + @Test(groups = { "Functional" }) + public void testAddPDBId() + { + PDBEntry pdbe = new PDBEntry("3A6S", null, null, null); + seq.addPDBId(pdbe); + assertEquals(1, seq.getAllPDBEntries().size()); + assertSame(pdbe, seq.getPDBEntry("3A6S")); + assertSame(pdbe, seq.getPDBEntry("3a6s")); // case-insensitive + + // add the same entry + seq.addPDBId(pdbe); + assertEquals(1, seq.getAllPDBEntries().size()); + assertSame(pdbe, seq.getPDBEntry("3A6S")); + + // add an identical entry + seq.addPDBId(new PDBEntry("3A6S", null, null, null)); + assertEquals(1, seq.getAllPDBEntries().size()); + assertSame(pdbe, seq.getPDBEntry("3A6S")); + + // add a different entry + PDBEntry pdbe2 = new PDBEntry("1A70", null, null, null); + seq.addPDBId(pdbe2); + assertEquals(2, seq.getAllPDBEntries().size()); + assertSame(pdbe, seq.getAllPDBEntries().get(0)); + assertSame(pdbe2, seq.getAllPDBEntries().get(1)); + + // update pdbe with chain code, file, type + PDBEntry pdbe3 = new PDBEntry("3a6s", "A", Type.PDB, "filepath"); + seq.addPDBId(pdbe3); + assertEquals(2, seq.getAllPDBEntries().size()); + assertSame(pdbe, seq.getAllPDBEntries().get(0)); // updated in situ + assertEquals("3A6S", pdbe.getId()); // unchanged + assertEquals("A", pdbe.getChainCode()); // updated + assertEquals(Type.PDB.toString(), pdbe.getType()); // updated + assertEquals("filepath", pdbe.getFile()); // updated + assertSame(pdbe2, seq.getAllPDBEntries().get(1)); + + // add with a different file path + PDBEntry pdbe4 = new PDBEntry("3a6s", "A", Type.PDB, "filepath2"); + seq.addPDBId(pdbe4); + assertEquals(3, seq.getAllPDBEntries().size()); + assertSame(pdbe4, seq.getAllPDBEntries().get(2)); + + // add with a different chain code + PDBEntry pdbe5 = new PDBEntry("3a6s", "B", Type.PDB, "filepath"); + seq.addPDBId(pdbe5); + assertEquals(4, seq.getAllPDBEntries().size()); + assertSame(pdbe5, seq.getAllPDBEntries().get(3)); + } + + @Test( + groups = { "Functional" }, + expectedExceptions = { IllegalArgumentException.class }) + public void testSetDatasetSequence_toSelf() + { + seq.setDatasetSequence(seq); + } + + @Test( + groups = { "Functional" }, + expectedExceptions = { IllegalArgumentException.class }) + public void testSetDatasetSequence_cascading() + { + SequenceI seq2 = new Sequence("Seq2", "xyz"); + seq2.createDatasetSequence(); + seq.setDatasetSequence(seq2); + } + + @Test(groups = { "Functional" }) + public void testFindFeatures() + { + SequenceI sq = new Sequence("test/8-16", "-ABC--DEF--GHI--"); + sq.createDatasetSequence(); + + assertTrue(sq.findFeatures(1, 99).isEmpty()); + + // add non-positional feature + SequenceFeature sf0 = new SequenceFeature("Cath", "desc", 0, 0, 2f, + null); + sq.addSequenceFeature(sf0); + // add feature on BCD + SequenceFeature sfBCD = new SequenceFeature("Cath", "desc", 9, 11, 2f, + null); + sq.addSequenceFeature(sfBCD); + // add feature on DE + SequenceFeature sfDE = new SequenceFeature("Cath", "desc", 11, 12, 2f, + null); + sq.addSequenceFeature(sfDE); + // add contact feature at [B, H] + SequenceFeature sfContactBH = new SequenceFeature("Disulphide bond", + "desc", 9, 15, 2f, null); + sq.addSequenceFeature(sfContactBH); + // add contact feature at [F, G] + SequenceFeature sfContactFG = new SequenceFeature("Disulfide Bond", + "desc", 13, 14, 2f, null); + sq.addSequenceFeature(sfContactFG); + // add single position feature at [I] + SequenceFeature sfI = new SequenceFeature("Disulfide Bond", + "desc", 16, 16, null); + sq.addSequenceFeature(sfI); + + // no features in columns 1-2 (-A) + List found = sq.findFeatures(1, 2); + assertTrue(found.isEmpty()); + + // columns 1-6 (-ABC--) includes BCD and B/H feature but not DE + found = sq.findFeatures(1, 6); + assertEquals(2, found.size()); + assertTrue(found.contains(sfBCD)); + assertTrue(found.contains(sfContactBH)); + + // columns 5-6 (--) includes (enclosing) BCD but not (contact) B/H feature + found = sq.findFeatures(5, 6); + assertEquals(1, found.size()); + assertTrue(found.contains(sfBCD)); + + // columns 7-10 (DEF-) includes BCD, DE, F/G but not B/H feature + found = sq.findFeatures(7, 10); + assertEquals(3, found.size()); + assertTrue(found.contains(sfBCD)); + assertTrue(found.contains(sfDE)); + assertTrue(found.contains(sfContactFG)); + + // columns 10-11 (--) should find nothing + found = sq.findFeatures(10, 11); + assertEquals(0, found.size()); + + // columns 14-14 (I) should find variant feature + found = sq.findFeatures(14, 14); + assertEquals(1, found.size()); + assertTrue(found.contains(sfI)); + } + + @Test(groups = { "Functional" }) + public void testFindIndex_withCursor() + { + Sequence sq = new Sequence("test/8-13", "-A--BCD-EF--"); + + // find F given A + assertEquals(10, sq.findIndex(13, new SequenceCursor(sq, 8, 2, 0))); + + // find A given F + assertEquals(2, sq.findIndex(8, new SequenceCursor(sq, 13, 10, 0))); + + // find C given C + assertEquals(6, sq.findIndex(10, new SequenceCursor(sq, 10, 6, 0))); + } + + @Test(groups = { "Functional" }) + public void testFindPosition_withCursor() + { + Sequence sq = new Sequence("test/8-13", "-A--BCD-EF--"); + + // find F pos given A - lastCol gets set in cursor + assertEquals(13, sq.findPosition(10, new SequenceCursor(sq, 8, 2, 0))); + assertEquals("test:Pos13:Col10:startCol0:endCol10:tok0", + PA.getValue(sq, "cursor").toString()); + + // find A pos given F - first residue column is saved in cursor + assertEquals(8, sq.findPosition(2, new SequenceCursor(sq, 13, 10, 0))); + assertEquals("test:Pos8:Col2:startCol2:endCol10:tok0", + PA.getValue(sq, "cursor").toString()); + + // find C pos given C (neither startCol nor endCol is set) + assertEquals(10, sq.findPosition(6, new SequenceCursor(sq, 10, 6, 0))); + assertEquals("test:Pos10:Col6:startCol0:endCol0:tok0", + PA.getValue(sq, "cursor").toString()); + + // now the grey area - what residue position for a gapped column? JAL-2562 + + // find 'residue' for column 3 given cursor for D (so working left) + // returns B9; cursor is updated to [B 5] + assertEquals(9, sq.findPosition(3, new SequenceCursor(sq, 11, 7, 0))); + assertEquals("test:Pos9:Col5:startCol0:endCol0:tok0", + PA.getValue(sq, "cursor").toString()); + + // find 'residue' for column 8 given cursor for D (so working right) + // returns E12; cursor is updated to [D 7] + assertEquals(12, sq.findPosition(8, new SequenceCursor(sq, 11, 7, 0))); + assertEquals("test:Pos11:Col7:startCol0:endCol0:tok0", + PA.getValue(sq, "cursor").toString()); + + // find 'residue' for column 12 given cursor for B + // returns 1 more than last residue position; cursor is updated to [F 10] + // lastCol position is saved in cursor + assertEquals(14, sq.findPosition(12, new SequenceCursor(sq, 9, 5, 0))); + assertEquals("test:Pos13:Col10:startCol0:endCol10:tok0", + PA.getValue(sq, "cursor").toString()); + + /* + * findPosition for column beyond length of sequence + * returns 1 more than the last residue position + * cursor is set to last real residue position [F 10] + */ + assertEquals(14, sq.findPosition(99, new SequenceCursor(sq, 8, 2, 0))); + assertEquals("test:Pos13:Col10:startCol0:endCol10:tok0", + PA.getValue(sq, "cursor").toString()); + + /* + * and the case without a trailing gap + */ + sq = new Sequence("test/8-13", "-A--BCD-EF"); + // first find C from A + assertEquals(10, sq.findPosition(6, new SequenceCursor(sq, 8, 2, 0))); + SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals("test:Pos10:Col6:startCol0:endCol0:tok0", + cursor.toString()); + // now 'find' 99 from C + // cursor is set to [F 10] and saved lastCol + assertEquals(14, sq.findPosition(99, cursor)); + assertEquals("test:Pos13:Col10:startCol0:endCol10:tok0", + PA.getValue(sq, "cursor").toString()); + } + + @Test + public void testIsValidCursor() + { + Sequence sq = new Sequence("Seq", "ABC--DE-F", 8, 13); + assertFalse(sq.isValidCursor(null)); + + /* + * cursor is valid if it has valid sequence ref and changeCount token + * and positions within the range of the sequence + */ + int changeCount = (int) PA.getValue(sq, "changeCount"); + SequenceCursor cursor = new SequenceCursor(sq, 13, 1, changeCount); + assertTrue(sq.isValidCursor(cursor)); + + /* + * column position outside [0 - length] is rejected + */ + cursor = new SequenceCursor(sq, 13, -1, changeCount); + assertFalse(sq.isValidCursor(cursor)); + cursor = new SequenceCursor(sq, 13, 10, changeCount); + assertFalse(sq.isValidCursor(cursor)); + cursor = new SequenceCursor(sq, 7, 8, changeCount); + assertFalse(sq.isValidCursor(cursor)); + cursor = new SequenceCursor(sq, 14, 2, changeCount); + assertFalse(sq.isValidCursor(cursor)); + + /* + * wrong sequence is rejected + */ + cursor = new SequenceCursor(null, 13, 1, changeCount); + assertFalse(sq.isValidCursor(cursor)); + cursor = new SequenceCursor(new Sequence("Seq", "abc"), 13, 1, + changeCount); + assertFalse(sq.isValidCursor(cursor)); + + /* + * wrong token value is rejected + */ + cursor = new SequenceCursor(sq, 13, 1, changeCount + 1); + assertFalse(sq.isValidCursor(cursor)); + cursor = new SequenceCursor(sq, 13, 1, changeCount - 1); + assertFalse(sq.isValidCursor(cursor)); + } + + @Test(groups = { "Functional" }) + public void testFindPosition_withCursorAndEdits() + { + Sequence sq = new Sequence("test/8-13", "-A--BCD-EF--"); + + // find F pos given A + assertEquals(13, sq.findPosition(10, new SequenceCursor(sq, 8, 2, 0))); + int token = (int) PA.getValue(sq, "changeCount"); // 0 + SequenceCursor cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals(new SequenceCursor(sq, 13, 10, token), cursor); + + /* + * setSequence should invalidate the cursor cached by the sequence + */ + sq.setSequence("-A-BCD-EF---"); // one gap removed + assertEquals(8, sq.getStart()); // sanity check + assertEquals(11, sq.findPosition(5)); // D11 + // cursor should now be at [D 6] + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals(new SequenceCursor(sq, 11, 6, ++token), cursor); + + /* + * deleteChars should invalidate the cached cursor + */ + sq.deleteChars(2, 5); // delete -BC + assertEquals("-AD-EF---", sq.getSequenceAsString()); + assertEquals(8, sq.getStart()); // sanity check + assertEquals(10, sq.findPosition(4)); // E10 + // cursor should now be at [E 5] + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals(new SequenceCursor(sq, 10, 5, ++token), cursor); + + /* + * Edit to insert gaps should invalidate the cached cursor + * insert 2 gaps at column[3] to make -AD---EF--- + */ + SequenceI[] seqs = new SequenceI[] { sq }; + AlignmentI al = new Alignment(seqs); + new EditCommand().appendEdit(Action.INSERT_GAP, seqs, 3, 2, al, true); + assertEquals("-AD---EF---", sq.getSequenceAsString()); + assertEquals(10, sq.findPosition(4)); // E10 + // cursor should now be at [D 3] + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals(new SequenceCursor(sq, 9, 3, ++token), cursor); + + /* + * insertCharAt should invalidate the cached cursor + * insert CC at column[4] to make -AD-CC--EF--- + */ + sq.insertCharAt(4, 2, 'C'); + assertEquals("-AD-CC--EF---", sq.getSequenceAsString()); + assertEquals(13, sq.findPosition(9)); // F13 + // cursor should now be at [F 10] + cursor = (SequenceCursor) PA.getValue(sq, "cursor"); + assertEquals(new SequenceCursor(sq, 13, 10, ++token), cursor); + } + + @Test(groups = { "Functional" }) + public void testGetSequence() + { + String seqstring = "-A--BCD-EF--"; + Sequence sq = new Sequence("test/8-13", seqstring); + sq.createDatasetSequence(); + assertTrue(Arrays.equals(sq.getSequence(), seqstring.toCharArray())); + assertTrue(Arrays.equals(sq.getDatasetSequence().getSequence(), + "ABCDEF".toCharArray())); + + // verify a copy of the sequence array is returned + char[] theSeq = (char[]) PA.getValue(sq, "sequence"); + assertNotSame(theSeq, sq.getSequence()); + theSeq = (char[]) PA.getValue(sq.getDatasetSequence(), "sequence"); + assertNotSame(theSeq, sq.getDatasetSequence().getSequence()); + } + + @Test(groups = { "Functional" }) + public void testReplace() + { + String seqstring = "-A--BCD-EF--"; + SequenceI sq = new Sequence("test/8-13", seqstring); + assertEquals(0, PA.getValue(sq, "changeCount")); + + assertEquals(0, sq.replace('A', 'A')); // same char + assertEquals(seqstring, sq.getSequenceAsString()); + assertEquals(0, PA.getValue(sq, "changeCount")); + + assertEquals(0, sq.replace('X', 'Y')); // not there + assertEquals(seqstring, sq.getSequenceAsString()); + assertEquals(0, PA.getValue(sq, "changeCount")); + + assertEquals(1, sq.replace('A', 'K')); + assertEquals("-K--BCD-EF--", sq.getSequenceAsString()); + assertEquals(1, PA.getValue(sq, "changeCount")); + + assertEquals(6, sq.replace('-', '.')); + assertEquals(".K..BCD.EF..", sq.getSequenceAsString()); + assertEquals(2, PA.getValue(sq, "changeCount")); + } + + @Test(groups = { "Functional" }) + public void testFindPositions() + { + SequenceI sq = new Sequence("test/8-13", "-ABC---DE-F--"); + + /* + * invalid inputs + */ + assertNull(sq.findPositions(6, 5)); + assertNull(sq.findPositions(0, 5)); + assertNull(sq.findPositions(-1, 5)); + + /* + * all gapped ranges + */ + assertNull(sq.findPositions(1, 1)); // 1-based columns + assertNull(sq.findPositions(5, 5)); + assertNull(sq.findPositions(5, 6)); + assertNull(sq.findPositions(5, 7)); + + /* + * all ungapped ranges + */ + assertEquals(new Range(8, 8), sq.findPositions(2, 2)); // A + assertEquals(new Range(8, 9), sq.findPositions(2, 3)); // AB + assertEquals(new Range(8, 10), sq.findPositions(2, 4)); // ABC + assertEquals(new Range(9, 10), sq.findPositions(3, 4)); // BC + + /* + * gap to ungapped range + */ + assertEquals(new Range(8, 10), sq.findPositions(1, 4)); // ABC + assertEquals(new Range(11, 12), sq.findPositions(6, 9)); // DE + + /* + * ungapped to gapped range + */ + assertEquals(new Range(10, 10), sq.findPositions(4, 5)); // C + assertEquals(new Range(9, 13), sq.findPositions(3, 11)); // BCDEF + + /* + * ungapped to ungapped enclosing gaps + */ + assertEquals(new Range(10, 11), sq.findPositions(4, 8)); // CD + assertEquals(new Range(8, 13), sq.findPositions(2, 11)); // ABCDEF + + /* + * gapped to gapped enclosing ungapped + */ + assertEquals(new Range(8, 10), sq.findPositions(1, 5)); // ABC + assertEquals(new Range(11, 12), sq.findPositions(5, 10)); // DE + assertEquals(new Range(8, 13), sq.findPositions(1, 13)); // the lot + assertEquals(new Range(8, 13), sq.findPositions(1, 99)); + } + + @Test(groups = { "Functional" }) + public void testFindFeatures_largeEndPos() + { + /* + * imitate a PDB sequence where end is larger than end position + */ + SequenceI sq = new Sequence("test", "-ABC--DEF--", 1, 20); + sq.createDatasetSequence(); + + assertTrue(sq.findFeatures(1, 9).isEmpty()); + // should be no array bounds exception - JAL-2772 + assertTrue(sq.findFeatures(1, 15).isEmpty()); + + // add feature on BCD + SequenceFeature sfBCD = new SequenceFeature("Cath", "desc", 2, 4, 2f, + null); + sq.addSequenceFeature(sfBCD); + + // no features in columns 1-2 (-A) + List found = sq.findFeatures(1, 2); + assertTrue(found.isEmpty()); + + // columns 1-6 (-ABC--) includes BCD + found = sq.findFeatures(1, 6); + assertEquals(1, found.size()); + assertTrue(found.contains(sfBCD)); + + // columns 10-11 (--) should find nothing + found = sq.findFeatures(10, 11); + assertEquals(0, found.size()); + } + + @Test(groups = { "Functional" }) + public void testSetName() + { + SequenceI sq = new Sequence("test", "-ABC---DE-F--"); + assertEquals("test", sq.getName()); + assertEquals(1, sq.getStart()); + assertEquals(6, sq.getEnd()); + + sq.setName("testing"); + assertEquals("testing", sq.getName()); + + sq.setName("test/8-10"); + assertEquals("test", sq.getName()); + assertEquals(8, sq.getStart()); + assertEquals(13, sq.getEnd()); // note end is recomputed + + sq.setName("testing/7-99"); + assertEquals("testing", sq.getName()); + assertEquals(7, sq.getStart()); + assertEquals(99, sq.getEnd()); // end may be beyond physical end + + sq.setName("/2-3"); + assertEquals("", sq.getName()); + assertEquals(2, sq.getStart()); + assertEquals(7, sq.getEnd()); + + sq.setName("test/"); // invalid + assertEquals("test/", sq.getName()); + assertEquals(2, sq.getStart()); + assertEquals(7, sq.getEnd()); + + sq.setName("test/6-13/7-99"); + assertEquals("test/6-13", sq.getName()); + assertEquals(7, sq.getStart()); + assertEquals(99, sq.getEnd()); + + sq.setName("test/0-5"); // 0 is invalid - ignored + assertEquals("test/0-5", sq.getName()); + assertEquals(7, sq.getStart()); + assertEquals(99, sq.getEnd()); + + sq.setName("test/a-5"); // a is invalid - ignored + assertEquals("test/a-5", sq.getName()); + assertEquals(7, sq.getStart()); + assertEquals(99, sq.getEnd()); + + sq.setName("test/6-5"); // start > end is invalid - ignored + assertEquals("test/6-5", sq.getName()); + assertEquals(7, sq.getStart()); + assertEquals(99, sq.getEnd()); + + sq.setName("test/5"); // invalid - ignored + assertEquals("test/5", sq.getName()); + assertEquals(7, sq.getStart()); + assertEquals(99, sq.getEnd()); + + sq.setName("test/-5"); // invalid - ignored + assertEquals("test/-5", sq.getName()); + assertEquals(7, sq.getStart()); + assertEquals(99, sq.getEnd()); + + sq.setName("test/5-"); // invalid - ignored + assertEquals("test/5-", sq.getName()); + assertEquals(7, sq.getStart()); + assertEquals(99, sq.getEnd()); + + sq.setName("test/5-6-7"); // invalid - ignored + assertEquals("test/5-6-7", sq.getName()); + assertEquals(7, sq.getStart()); + assertEquals(99, sq.getEnd()); + + sq.setName(null); // invalid, gets converted to space + assertEquals("", sq.getName()); + assertEquals(7, sq.getStart()); + assertEquals(99, sq.getEnd()); + } + + @Test(groups = { "Functional" }) + public void testCheckValidRange() + { + Sequence sq = new Sequence("test/7-12", "-ABC---DE-F--"); + assertEquals(7, sq.getStart()); + assertEquals(12, sq.getEnd()); + + /* + * checkValidRange ensures end is at least the last residue position + */ + PA.setValue(sq, "end", 2); + sq.checkValidRange(); + assertEquals(12, sq.getEnd()); + + /* + * end may be beyond the last residue position + */ + PA.setValue(sq, "end", 22); + sq.checkValidRange(); + assertEquals(22, sq.getEnd()); + } }