X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;ds=sidebyside;f=test%2Fjalview%2Fio%2Fgff%2FGff3HelperTest.java;h=4355e40ec67af11eeac5073e70a455b723feffc6;hb=604cbee405a837565ba1a74aa9bddd62aed685ab;hp=420b0320128800f1b72ee5676c0e069a75c028b7;hpb=8f920d337154e092f5f9056ffde3cdf2735eca43;p=jalview.git

diff --git a/test/jalview/io/gff/Gff3HelperTest.java b/test/jalview/io/gff/Gff3HelperTest.java
index 420b032..4355e40 100644
--- a/test/jalview/io/gff/Gff3HelperTest.java
+++ b/test/jalview/io/gff/Gff3HelperTest.java
@@ -1,3 +1,23 @@
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ * 
+ * This file is part of Jalview.
+ * 
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License 
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *  
+ * Jalview is distributed in the hope that it will be useful, but 
+ * WITHOUT ANY WARRANTY; without even the implied warranty 
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
+ * PURPOSE.  See the GNU General Public License for more details.
+ * 
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview.  If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
 package jalview.io.gff;
 
 import static org.testng.AssertJUnit.assertEquals;
@@ -161,7 +181,7 @@ public class Gff3HelperTest
             "GAATTCGTTCATGTAGGTTGATTTTTATT");
     seq.createDatasetSequence();
     AlignmentI align = new Alignment(new SequenceI[] {});
-  
+
     // mapping from gi|68711 12923-13060 to gi|N37351 1-138
     String[] gff = "gi|68711\tblat-pasa\tcDNA_match\t12923\t13060\t98.55\t+\t.\tID=align_68;Target=gi|N37351 1 138 +"
             .split("\\t");
@@ -179,7 +199,7 @@ public class Gff3HelperTest
     // (this is important for 'align cdna to genome' to work correctly)
     assertEquals(1, align.getCodonFrames().size());
     AlignedCodonFrame mapping = align.getCodonFrames().get(0);
-  
+
     /*
      * 'dnaseqs' (map from) is here [gi|68711]
      * 'aaseqs' (map to) is here [gi|N37351]
@@ -192,8 +212,7 @@ public class Gff3HelperTest
     assertEquals(1, mapping.getdnaToProt().length);
     assertEquals(2, mapping.getdnaToProt()[0].getFromRanges().size());
     // the two spliced dna ranges are combined in one MapList
-    assertArrayEquals(new int[] { 12923, 13060 },
-            mapping.getdnaToProt()[0]
+    assertArrayEquals(new int[] { 12923, 13060 }, mapping.getdnaToProt()[0]
             .getFromRanges().get(0));
     assertArrayEquals(new int[] { 13411, 13550 }, mapping.getdnaToProt()[0]
             .getFromRanges().get(1));