X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;ds=sidebyside;f=test%2Fjalview%2Fio%2Fgff%2FGffTests.java;h=393f2ce31eb6c504e8c96000b10a6fc8b6072909;hb=27c2e79ddd7e9913b385325798f2ed8a8b084dca;hp=77da8fa5bef4712bd472fe4077a4c8dab29f9b81;hpb=8f920d337154e092f5f9056ffde3cdf2735eca43;p=jalview.git diff --git a/test/jalview/io/gff/GffTests.java b/test/jalview/io/gff/GffTests.java index 77da8fa..393f2ce 100644 --- a/test/jalview/io/gff/GffTests.java +++ b/test/jalview/io/gff/GffTests.java @@ -1,3 +1,23 @@ +/* + * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$) + * Copyright (C) $$Year-Rel$$ The Jalview Authors + * + * This file is part of Jalview. + * + * Jalview is free software: you can redistribute it and/or + * modify it under the terms of the GNU General Public License + * as published by the Free Software Foundation, either version 3 + * of the License, or (at your option) any later version. + * + * Jalview is distributed in the hope that it will be useful, but + * WITHOUT ANY WARRANTY; without even the implied warranty + * of MERCHANTABILITY or FITNESS FOR A PARTICULAR + * PURPOSE. See the GNU General Public License for more details. + * + * You should have received a copy of the GNU General Public License + * along with Jalview. If not, see . + * The Jalview Authors are detailed in the 'AUTHORS' file. + */ package jalview.io.gff; import static org.testng.AssertJUnit.assertEquals; @@ -13,11 +33,13 @@ import jalview.datamodel.Sequence; import jalview.datamodel.SequenceDummy; import jalview.datamodel.SequenceI; import jalview.gui.AlignFrame; +import jalview.gui.JvOptionPane; +import jalview.io.DataSourceType; import jalview.io.FileLoader; -import jalview.io.FormatAdapter; import java.util.List; +import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; /** @@ -27,6 +49,14 @@ import org.testng.annotations.Test; */ public class GffTests { + + @BeforeClass(alwaysRun = true) + public void setUpJvOptionPane() + { + JvOptionPane.setInteractiveMode(false); + JvOptionPane.setMockResponse(JvOptionPane.CANCEL_OPTION); + } + /** * Test the case where we load a protein ('query') sequence, then exonerateGff * describing its mapping to cDNA, and then a DNA sequence including the @@ -37,7 +67,7 @@ public class GffTests { String proteinSeq = ">prot1/10-16\nYCWRSGA"; AlignFrame af = new FileLoader(false).LoadFileWaitTillLoaded( - proteinSeq, FormatAdapter.PASTE); + proteinSeq, DataSourceType.PASTE); /* * exonerate GFF output mapping residues 11-15 (CWRSG) @@ -45,7 +75,7 @@ public class GffTests */ String exonerateGff = "##gff-version 2\n" + "prot1\tprotein2genome\tsimilarity\t11\t15\t99\t-\t.\talignment_id 0 ; Target dna1 ; Align 11 24 5"; - af.loadJalviewDataFile(exonerateGff, FormatAdapter.PASTE, null, null); + af.loadJalviewDataFile(exonerateGff, DataSourceType.PASTE, null, null); /* * check we have a mapping from prot1 to SequenceDummy 'dna1' @@ -69,8 +99,6 @@ public class GffTests mappedRegion = mapList[0].getMap().locateInFrom(15, 15); assertArrayEquals(new int[] { 12, 10 }, mappedRegion); - // so far so good; TODO: programmatically add mapped sequences - // and verify the mappings are 'realised' SequenceI dna1 = new Sequence("dna1", "AAACCCGGGTTTAAACCCGGGTTT"); AlignmentI al = new Alignment(new SequenceI[] { dna1 }); al.setDataset(null);