X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;ds=sidebyside;f=test%2Fjalview%2Fio%2Fvcf%2FVCFLoaderTest.java;h=7e3c0b453727b6f73aa3d78f493442498f1dc6ac;hb=37651a9d177de05ff938276071c16ba95ac44c73;hp=13c6f95d54a8a66305154fa13dde746995ab89f3;hpb=43bee46f18100411bfa20508f7740e60dd525f4a;p=jalview.git diff --git a/test/jalview/io/vcf/VCFLoaderTest.java b/test/jalview/io/vcf/VCFLoaderTest.java index 13c6f95..7e3c0b4 100644 --- a/test/jalview/io/vcf/VCFLoaderTest.java +++ b/test/jalview/io/vcf/VCFLoaderTest.java @@ -1,8 +1,8 @@ package jalview.io.vcf; import static org.testng.Assert.assertEquals; -import static org.testng.Assert.assertTrue; +import jalview.bin.Cache; import jalview.datamodel.AlignmentI; import jalview.datamodel.DBRefEntry; import jalview.datamodel.Mapping; @@ -21,7 +21,9 @@ import java.io.File; import java.io.IOException; import java.io.PrintWriter; import java.util.List; +import java.util.Map; +import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; public class VCFLoaderTest @@ -55,7 +57,7 @@ public class VCFLoaderTest private static final String[] VCF = { "##fileformat=VCFv4.2", "##INFO=", - "##reference=GRCh38", + "##reference=Homo_sapiens/GRCh38", "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO", // A/T,C variants in position 2 of gene sequence (precedes transcript) // should create 2 variant features with respective scores @@ -64,15 +66,27 @@ public class VCFLoaderTest // insertion G/GA is transferred to nucleotide but not to peptide "17\t45051613\t.\tG\tGA,C\t1666.64\tRF\tAC=15;AF=3.0e-03,2.0e-03" }; + @BeforeClass + public void setUp() + { + /* + * configure to capture all available VCF and VEP (CSQ) fields + */ + Cache.loadProperties("test/jalview/io/testProps.jvprops"); + Cache.setProperty("VCF_FIELDS", ".*"); + Cache.setProperty("VEP_FIELDS", ".*"); + Cache.initLogger(); + } + @Test(groups = "Functional") public void testDoLoad() throws IOException { AlignmentI al = buildAlignment(); - VCFLoader loader = new VCFLoader(al); File f = makeVcf(); + VCFLoader loader = new VCFLoader(f.getPath()); - loader.doLoad(f.getPath(), null); + loader.doLoad(al.getSequencesArray(), null); /* * verify variant feature(s) added to gene @@ -156,7 +170,7 @@ public class VCFLoaderTest assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 1); assertEquals(sf.getEnd(), 1); - assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); + assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT); assertEquals(sf.getDescription(), "p.Ser1Thr"); } @@ -191,7 +205,8 @@ public class VCFLoaderTest SequenceI gene1 = alignment.findName("gene1"); int[] to = new int[] { 45051610, 45051634 }; int[] from = new int[] { gene1.getStart(), gene1.getEnd() }; - gene1.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1)); + gene1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to, + 1, 1)); /* * map 'transcript1' to chromosome via 'gene1' @@ -201,7 +216,8 @@ public class VCFLoaderTest to = new int[] { 45051612, 45051619, 45051624, 45051633 }; SequenceI transcript1 = alignment.findName("transcript1"); from = new int[] { transcript1.getStart(), transcript1.getEnd() }; - transcript1.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, + transcript1.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList( + from, to, 1, 1)); /* @@ -210,7 +226,8 @@ public class VCFLoaderTest SequenceI gene2 = alignment.findName("gene2"); to = new int[] { 45051634, 45051610 }; from = new int[] { gene2.getStart(), gene2.getEnd() }; - gene2.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, 1, 1)); + gene2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList(from, to, + 1, 1)); /* * map 'transcript2' to chromosome via 'gene2' @@ -220,7 +237,8 @@ public class VCFLoaderTest to = new int[] { 45051633, 45051624, 45051619, 45051612 }; SequenceI transcript2 = alignment.findName("transcript2"); from = new int[] { transcript2.getStart(), transcript2.getEnd() }; - transcript2.setGeneLoci("human", "GRCh38", "17", new MapList(from, to, + transcript2.setGeneLoci("homo_sapiens", "GRCh38", "17", new MapList( + from, to, 1, 1)); /* @@ -248,7 +266,8 @@ public class VCFLoaderTest SequenceI gene3 = alignment.findName("gene3"); to = new int[] { 45051610, 45051634 }; from = new int[] { gene3.getStart(), gene3.getEnd() }; - gene3.setGeneLoci("human", "GRCh38", "5", new MapList(from, to, 1, 1)); + gene3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList(from, to, + 1, 1)); /* * map 'transcript3' to chromosome @@ -256,7 +275,8 @@ public class VCFLoaderTest SequenceI transcript3 = alignment.findName("transcript3"); to = new int[] { 45051612, 45051619, 45051624, 45051633 }; from = new int[] { transcript3.getStart(), transcript3.getEnd() }; - transcript3.setGeneLoci("human", "GRCh38", "5", new MapList(from, to, + transcript3.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList( + from, to, 1, 1)); /* @@ -266,7 +286,8 @@ public class VCFLoaderTest to = new int[] { 45051615, 45051617, 45051619, 45051632, 45051634, 45051634 }; from = new int[] { transcript4.getStart(), transcript4.getEnd() }; - transcript4.setGeneLoci("human", "GRCh38", "5", new MapList(from, to, + transcript4.setGeneLoci("homo_sapiens", "GRCh38", "5", new MapList( + from, to, 1, 1)); /* @@ -293,77 +314,97 @@ public class VCFLoaderTest { AlignmentI al = buildAlignment(); - VCFLoader loader = new VCFLoader(al); - File f = makeVcf(); - loader.doLoad(f.getPath(), null); + VCFLoader loader = new VCFLoader(f.getPath()); + + loader.doLoad(al.getSequencesArray(), null); /* * verify variant feature(s) added to gene2 - * gene/1-25 maps to chromosome 45051634- reverse strand - * variants A/T, A/C at 45051611 and G/GA,G/C at 45051613 map to - * T/A, T/G and C/TC,C/G at gene positions 24 and 22 respectively + * gene2/1-25 maps to chromosome 45051634- reverse strand */ List geneFeatures = al.getSequenceAt(2) .getSequenceFeatures(); SequenceFeatures.sortFeatures(geneFeatures, true); assertEquals(geneFeatures.size(), 4); - SequenceFeature sf = geneFeatures.get(0); - assertEquals(sf.getFeatureGroup(), "VCF"); - assertEquals(sf.getBegin(), 22); - assertEquals(sf.getEnd(), 22); - assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); - assertEquals(sf.getScore(), 2.0e-03, DELTA); - assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES)); - sf = geneFeatures.get(1); + /* + * variant A/T at 45051611 maps to T/A at gene position 24 + */ + SequenceFeature sf = geneFeatures.get(3); assertEquals(sf.getFeatureGroup(), "VCF"); - assertEquals(sf.getBegin(), 22); - assertEquals(sf.getEnd(), 22); + assertEquals(sf.getBegin(), 24); + assertEquals(sf.getEnd(), 24); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); - assertEquals(sf.getScore(), 3.0e-03, DELTA); - assertEquals("C,TC", sf.getValue(Gff3Helper.ALLELES)); + assertEquals(sf.getScore(), 5.0e-03, DELTA); + assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,A"); + /* + * variant A/C at 45051611 maps to T/G at gene position 24 + */ sf = geneFeatures.get(2); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 24); assertEquals(sf.getEnd(), 24); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); assertEquals(sf.getScore(), 4.0e-03, DELTA); - assertEquals("T,G", sf.getValue(Gff3Helper.ALLELES)); + assertEquals(sf.getValue(Gff3Helper.ALLELES), "T,G"); - sf = geneFeatures.get(3); + /* + * variant G/C at 45051613 maps to C/G at gene position 22 + */ + sf = geneFeatures.get(1); assertEquals(sf.getFeatureGroup(), "VCF"); - assertEquals(sf.getBegin(), 24); - assertEquals(sf.getEnd(), 24); + assertEquals(sf.getBegin(), 22); + assertEquals(sf.getEnd(), 22); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); - assertEquals(sf.getScore(), 5.0e-03, DELTA); - assertEquals("T,A", sf.getValue(Gff3Helper.ALLELES)); + assertEquals(sf.getScore(), 2.0e-03, DELTA); + assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G"); /* - * verify variant feature(s) added to transcript2 - * variants G/GA,G/C at position 22 of gene overlap and map to - * C/TC,C/G at position 17 of transcript + * insertion G/GA at 45051613 maps to an insertion at + * the preceding position (21) on reverse strand gene + * reference: CAAGC -> GCTTG/21-25 + * genomic variant: CAAGAC (G/GA) + * gene variant: GTCTTG (G/GT at 21) + */ + sf = geneFeatures.get(0); + assertEquals(sf.getFeatureGroup(), "VCF"); + assertEquals(sf.getBegin(), 21); + assertEquals(sf.getEnd(), 21); + assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); + assertEquals(sf.getScore(), 3.0e-03, DELTA); + assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT"); + + /* + * verify 2 variant features added to transcript2 */ List transcriptFeatures = al.getSequenceAt(3) .getSequenceFeatures(); assertEquals(transcriptFeatures.size(), 2); + + /* + * insertion G/GT at position 21 of gene maps to position 16 of transcript + */ sf = transcriptFeatures.get(0); assertEquals(sf.getFeatureGroup(), "VCF"); - assertEquals(sf.getBegin(), 17); - assertEquals(sf.getEnd(), 17); + assertEquals(sf.getBegin(), 16); + assertEquals(sf.getEnd(), 16); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); - assertEquals(sf.getScore(), 2.0e-03, DELTA); - assertEquals("C,G", sf.getValue(Gff3Helper.ALLELES)); + assertEquals(sf.getScore(), 3.0e-03, DELTA); + assertEquals(sf.getValue(Gff3Helper.ALLELES), "G,GT"); + /* + * SNP C/G at position 22 of gene maps to position 17 of transcript + */ sf = transcriptFeatures.get(1); assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 17); assertEquals(sf.getEnd(), 17); assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); - assertEquals(sf.getScore(), 3.0e-03, DELTA); - assertEquals("C,TC", sf.getValue(Gff3Helper.ALLELES)); + assertEquals(sf.getScore(), 2.0e-03, DELTA); + assertEquals(sf.getValue(Gff3Helper.ALLELES), "C,G"); /* * verify variant feature(s) computed and added to protein @@ -384,7 +425,7 @@ public class VCFLoaderTest assertEquals(sf.getFeatureGroup(), "VCF"); assertEquals(sf.getBegin(), 6); assertEquals(sf.getEnd(), 6); - assertEquals(sf.getType(), SequenceOntologyI.SEQUENCE_VARIANT); + assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT); assertEquals(sf.getDescription(), "p.Ala6Gly"); } @@ -400,7 +441,7 @@ public class VCFLoaderTest { AlignmentI al = buildAlignment(); - VCFLoader loader = new VCFLoader(al); + VCFLoader loader = new VCFLoader("test/jalview/io/vcf/testVcf.vcf"); /* * VCF data file with variants at gene3 positions @@ -410,7 +451,7 @@ public class VCFLoaderTest * 13 C/G, C/T * 17 A/AC (insertion), A/G */ - loader.doLoad("test/jalview/io/vcf/testVcf.dat", null); + loader.doLoad(al.getSequencesArray(), null); /* * verify variant feature(s) added to gene3 @@ -425,49 +466,56 @@ public class VCFLoaderTest assertEquals(sf.getScore(), 0.1f, DELTA); assertEquals(sf.getValue("alleles"), "C,A"); // gene features include Consequence for all transcripts - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2); + Map map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); sf = geneFeatures.get(1); assertEquals(sf.getBegin(), 5); assertEquals(sf.getEnd(), 5); assertEquals(sf.getScore(), 0.2f, DELTA); assertEquals(sf.getValue("alleles"), "C,T"); - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); sf = geneFeatures.get(2); assertEquals(sf.getBegin(), 9); assertEquals(sf.getEnd(), 11); // deletion over 3 positions assertEquals(sf.getScore(), 0.3f, DELTA); assertEquals(sf.getValue("alleles"), "CGG,C"); - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); sf = geneFeatures.get(3); assertEquals(sf.getBegin(), 13); assertEquals(sf.getEnd(), 13); assertEquals(sf.getScore(), 0.5f, DELTA); assertEquals(sf.getValue("alleles"), "C,T"); - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); sf = geneFeatures.get(4); assertEquals(sf.getBegin(), 13); assertEquals(sf.getEnd(), 13); assertEquals(sf.getScore(), 0.4f, DELTA); assertEquals(sf.getValue("alleles"), "C,G"); - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); sf = geneFeatures.get(5); assertEquals(sf.getBegin(), 17); assertEquals(sf.getEnd(), 17); assertEquals(sf.getScore(), 0.7f, DELTA); assertEquals(sf.getValue("alleles"), "A,G"); - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); sf = geneFeatures.get(6); assertEquals(sf.getBegin(), 17); assertEquals(sf.getEnd(), 17); // insertion assertEquals(sf.getScore(), 0.6f, DELTA); assertEquals(sf.getValue("alleles"), "A,AC"); - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 2); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); /* * verify variant feature(s) added to transcript3 @@ -485,24 +533,57 @@ public class VCFLoaderTest assertEquals(sf.getScore(), 0.2f, DELTA); assertEquals(sf.getValue("alleles"), "C,T"); // transcript features only have Consequence for that transcripts - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1); - assertTrue(sf.getValue("CSQ").toString().contains("transcript3")); + map = (Map) sf.getValue("CSQ"); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3"); sf = transcriptFeatures.get(1); assertEquals(sf.getBegin(), 11); assertEquals(sf.getEnd(), 11); assertEquals(sf.getScore(), 0.7f, DELTA); assertEquals(sf.getValue("alleles"), "A,G"); - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1); - assertTrue(sf.getValue("CSQ").toString().contains("transcript3")); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3"); sf = transcriptFeatures.get(2); assertEquals(sf.getBegin(), 11); assertEquals(sf.getEnd(), 11); assertEquals(sf.getScore(), 0.6f, DELTA); assertEquals(sf.getValue("alleles"), "A,AC"); - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1); - assertTrue(sf.getValue("CSQ").toString().contains("transcript3")); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript3"); + + /* + * verify variants computed on protein product for transcript3 + * peptide is SWRECD + * codon variants are AGC/AGT position 1 which is synonymous + * and GAG/GGG which is E/G in position 4 + * the insertion variant is not transferred to the peptide + */ + DBRefEntry[] dbRefs = al.findName("transcript3").getDBRefs(); + SequenceI peptide = null; + for (DBRefEntry dbref : dbRefs) + { + if (dbref.getMap().getMap().getFromRatio() == 3) + { + peptide = dbref.getMap().getTo(); + } + } + List proteinFeatures = peptide.getSequenceFeatures(); + SequenceFeatures.sortFeatures(proteinFeatures, true); + assertEquals(proteinFeatures.size(), 2); + sf = proteinFeatures.get(0); + assertEquals(sf.getFeatureGroup(), "VCF"); + assertEquals(sf.getBegin(), 1); + assertEquals(sf.getEnd(), 1); + assertEquals(sf.getType(), SequenceOntologyI.SYNONYMOUS_VARIANT); + assertEquals(sf.getDescription(), "agC/agT"); + sf = proteinFeatures.get(1); + assertEquals(sf.getFeatureGroup(), "VCF"); + assertEquals(sf.getBegin(), 4); + assertEquals(sf.getEnd(), 4); + assertEquals(sf.getType(), SequenceOntologyI.NONSYNONYMOUS_VARIANT); + assertEquals(sf.getDescription(), "p.Glu4Gly"); /* * verify variant feature(s) added to transcript4 @@ -516,31 +597,85 @@ public class VCFLoaderTest assertEquals(sf.getEnd(), 7); assertEquals(sf.getScore(), 0.5f, DELTA); assertEquals(sf.getValue("alleles"), "C,T"); - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1); - assertTrue(sf.getValue("CSQ").toString().contains("transcript4")); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4"); sf = transcriptFeatures.get(1); assertEquals(sf.getBegin(), 7); assertEquals(sf.getEnd(), 7); assertEquals(sf.getScore(), 0.4f, DELTA); assertEquals(sf.getValue("alleles"), "C,G"); - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1); - assertTrue(sf.getValue("CSQ").toString().contains("transcript4")); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4"); sf = transcriptFeatures.get(2); assertEquals(sf.getBegin(), 11); assertEquals(sf.getEnd(), 11); assertEquals(sf.getScore(), 0.7f, DELTA); assertEquals(sf.getValue("alleles"), "A,G"); - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1); - assertTrue(sf.getValue("CSQ").toString().contains("transcript4")); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4"); sf = transcriptFeatures.get(3); assertEquals(sf.getBegin(), 11); assertEquals(sf.getEnd(), 11); assertEquals(sf.getScore(), 0.6f, DELTA); assertEquals(sf.getValue("alleles"), "A,AC"); - assertEquals(((String) sf.getValue("CSQ")).split(",").length, 1); - assertTrue(sf.getValue("CSQ").toString().contains("transcript4")); + assertEquals(map.size(), 9); + assertEquals(sf.getValueAsString("CSQ", "Feature"), "transcript4"); + } + + /** + * A test that demonstrates loading a contig sequence from an indexed sequence + * database which is the reference for a VCF file + * + * @throws IOException + */ + @Test(groups = "Functional") + public void testLoadVCFContig() throws IOException + { + VCFLoader loader = new VCFLoader( + "test/jalview/io/vcf/testVcf2.vcf"); + + SequenceI seq = loader.loadVCFContig("contig123"); + assertEquals(seq.getLength(), 15); + assertEquals(seq.getSequenceAsString(), "AAAAACCCCCGGGGG"); + List features = seq.getSequenceFeatures(); + SequenceFeatures.sortFeatures(features, true); + assertEquals(features.size(), 2); + SequenceFeature sf = features.get(0); + assertEquals(sf.getBegin(), 8); + assertEquals(sf.getEnd(), 8); + assertEquals(sf.getDescription(), "C,A"); + sf = features.get(1); + assertEquals(sf.getBegin(), 12); + assertEquals(sf.getEnd(), 12); + assertEquals(sf.getDescription(), "G,T"); + + seq = loader.loadVCFContig("contig789"); + assertEquals(seq.getLength(), 25); + assertEquals(seq.getSequenceAsString(), "GGGGGTTTTTAAAAACCCCCGGGGG"); + features = seq.getSequenceFeatures(); + SequenceFeatures.sortFeatures(features, true); + assertEquals(features.size(), 2); + sf = features.get(0); + assertEquals(sf.getBegin(), 2); + assertEquals(sf.getEnd(), 2); + assertEquals(sf.getDescription(), "G,T"); + sf = features.get(1); + assertEquals(sf.getBegin(), 21); + assertEquals(sf.getEnd(), 21); + assertEquals(sf.getDescription(), "G,A"); + + seq = loader.loadVCFContig("contig456"); + assertEquals(seq.getLength(), 20); + assertEquals(seq.getSequenceAsString(), "CCCCCGGGGGTTTTTAAAAA"); + features = seq.getSequenceFeatures(); + SequenceFeatures.sortFeatures(features, true); + assertEquals(features.size(), 1); + sf = features.get(0); + assertEquals(sf.getBegin(), 15); + assertEquals(sf.getEnd(), 15); + assertEquals(sf.getDescription(), "T,C"); } -} +} \ No newline at end of file