X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;ds=sidebyside;f=test%2Fjalview%2Futil%2FMappingUtilsTest.java;h=204d80369931663706ff676f5b6fde94195b8fe1;hb=8bcec0698d13dede379ac8079d544d2da50e106c;hp=d4df8c70ed72cf14c370fbc904ada7e23220a355;hpb=44e76456cdfd0e0ba3dc3c958f0dd061b45fdd72;p=jalview.git diff --git a/test/jalview/util/MappingUtilsTest.java b/test/jalview/util/MappingUtilsTest.java index d4df8c7..204d803 100644 --- a/test/jalview/util/MappingUtilsTest.java +++ b/test/jalview/util/MappingUtilsTest.java @@ -22,9 +22,11 @@ package jalview.util; import static org.testng.AssertJUnit.assertEquals; import static org.testng.AssertJUnit.assertFalse; +import static org.testng.AssertJUnit.assertNull; import static org.testng.AssertJUnit.assertSame; import static org.testng.AssertJUnit.assertTrue; import static org.testng.AssertJUnit.fail; +import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals; import java.awt.Color; import java.io.IOException; @@ -37,6 +39,7 @@ import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; import jalview.api.AlignViewportI; +import jalview.bin.Cache; import jalview.commands.EditCommand; import jalview.commands.EditCommand.Action; import jalview.commands.EditCommand.Edit; @@ -59,6 +62,11 @@ import jalview.io.FormatAdapter; public class MappingUtilsTest { + @BeforeClass(alwaysRun = true) + public void setUp() + { + Cache.initLogger(); + } @BeforeClass(alwaysRun = true) public void setUpJvOptionPane() @@ -232,8 +240,8 @@ public class MappingUtilsTest .asList(new AlignedCodonFrame[] { acf }); - AlignViewportI dnaView = new AlignViewport(cdna); - AlignViewportI proteinView = new AlignViewport(protein); + AlignViewportI theDnaView = new AlignViewport(cdna); + AlignViewportI theProteinView = new AlignViewport(protein); protein.setCodonFrames(acfList); /* @@ -251,7 +259,7 @@ public class MappingUtilsTest * Verify the mapped sequence group in dna */ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, - proteinView, dnaView); + theProteinView, theDnaView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); @@ -269,7 +277,8 @@ public class MappingUtilsTest sg.addSequence(cdna.getSequenceAt(0), false); sg.setStartRes(0); sg.setEndRes(2); - mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); + mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, + theProteinView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); @@ -523,8 +532,8 @@ public class MappingUtilsTest .asList(new AlignedCodonFrame[] { acf }); - AlignViewportI dnaView = new AlignViewport(cdna); - AlignViewportI proteinView = new AlignViewport(protein); + AlignViewportI theDnaView = new AlignViewport(cdna); + AlignViewportI theProteinView = new AlignViewport(protein); protein.setCodonFrames(acfList); /* @@ -544,7 +553,7 @@ public class MappingUtilsTest * Verify the mapped sequence group in dna */ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, - proteinView, dnaView); + theProteinView, theDnaView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); @@ -565,7 +574,8 @@ public class MappingUtilsTest // select columns 2 and 3 in DNA which span protein columns 0 and 1 sg.setStartRes(2); sg.setEndRes(3); - mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); + mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, + theProteinView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); @@ -590,11 +600,11 @@ public class MappingUtilsTest * viewport). */ AlignmentI cdna = loadAlignment( - ">Seq1\nA-CG-GC--AT-CA\n>Seq2\n-TG-AC-AG-T-AT\n>Seq3\n-T--ACG-TAAT-G\n", + ">Cds11\nA-CG-GC--AT-CA\n>Cds2\n-TG-AC-AG-T-AT\n>Cds3\n-T--ACG-TAAT-G\n", FileFormat.Fasta); cdna.setDataset(null); AlignmentI protein = loadAlignment( - ">Seq1\n-KA-S\n>Seq2\n--L-QY\n>Seq3\nQ-V-M\n", + ">Pep1\n-KA-S\n>Pep2\n--L-QY\n>Pep3\nQ-V-M\n", FileFormat.Fasta); protein.setDataset(null); AlignedCodonFrame acf = new AlignedCodonFrame(); @@ -608,15 +618,14 @@ public class MappingUtilsTest .asList(new AlignedCodonFrame[] { acf }); - AlignViewportI dnaView = new AlignViewport(cdna); - AlignViewportI proteinView = new AlignViewport(protein); + AlignViewportI theDnaView = new AlignViewport(cdna); + AlignViewportI theProteinView = new AlignViewport(protein); protein.setCodonFrames(acfList); /* - * Select Seq1 and Seq2 in the protein, column 1 (K/-). Expect mapped - * sequence group to cover Seq1, columns 0-3 (ACG). Because the selection - * only includes a gap in Seq2 there is no mappable selection region in the - * corresponding DNA. + * Select Pep1 and Pep2 in the protein, column 1 (K/-). Expect mapped + * sequence group to cover Cds1, columns 0-3 (ACG). Although the selection + * only includes a gap in Cds2, mapped Cds2 is included with 'no columns' */ SequenceGroup sg = new SequenceGroup(); sg.setColourText(true); @@ -631,14 +640,15 @@ public class MappingUtilsTest * Verify the mapped sequence group in dna */ SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, - proteinView, dnaView); + theProteinView, theDnaView); assertTrue(mappedGroup.getColourText()); assertSame(sg.getIdColour(), mappedGroup.getIdColour()); assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); - assertEquals(1, mappedGroup.getSequences().size()); + assertEquals(2, mappedGroup.getSequences().size()); assertSame(cdna.getSequenceAt(0), mappedGroup.getSequences().get(0)); - // Seq2 in protein has a gap in column 1 - ignored - // Seq1 has K which should map to columns 0-3 in Seq1 + assertSame(cdna.getSequenceAt(1), mappedGroup.getSequences().get(1)); + // Pep2 in protein has a gap in column 1 - doesn't map to any column + // Pep1 has K which should map to columns 0-3 in Cds1 assertEquals(0, mappedGroup.getStartRes()); assertEquals(3, mappedGroup.getEndRes()); @@ -648,7 +658,8 @@ public class MappingUtilsTest */ sg.setStartRes(2); sg.setEndRes(4); - mappedGroup = MappingUtils.mapSequenceGroup(sg, proteinView, dnaView); + mappedGroup = MappingUtils.mapSequenceGroup(sg, theProteinView, + theDnaView); assertEquals(1, mappedGroup.getStartRes()); assertEquals(13, mappedGroup.getEndRes()); @@ -661,19 +672,22 @@ public class MappingUtilsTest // select columns 4,5 - includes Seq1:codon2 (A) only sg.setStartRes(4); sg.setEndRes(5); - mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); + mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, + theProteinView); assertEquals(2, mappedGroup.getStartRes()); assertEquals(2, mappedGroup.getEndRes()); // add Seq2 to dna selection cols 4-5 include codons 1 and 2 (LQ) sg.addSequence(cdna.getSequenceAt(1), false); - mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); + mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, + theProteinView); assertEquals(2, mappedGroup.getStartRes()); assertEquals(4, mappedGroup.getEndRes()); // add Seq3 to dna selection cols 4-5 include codon 1 (Q) sg.addSequence(cdna.getSequenceAt(2), false); - mappedGroup = MappingUtils.mapSequenceGroup(sg, dnaView, proteinView); + mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, + theProteinView); assertEquals(0, mappedGroup.getStartRes()); assertEquals(4, mappedGroup.getEndRes()); } @@ -1322,20 +1336,20 @@ public class MappingUtilsTest assertEquals(1, ranges.size()); assertEquals(9, ranges.get(0)[1]); } - + @Test(groups = "Functional") public void testListToArray() { List ranges = new ArrayList<>(); - + int[] result = MappingUtils.listToArray(ranges); assertEquals(result.length, 0); - ranges.add(new int[] {24, 12}); + ranges.add(new int[] { 24, 12 }); result = MappingUtils.listToArray(ranges); assertEquals(result.length, 2); assertEquals(result[0], 24); assertEquals(result[1], 12); - ranges.add(new int[] {-7, 30}); + ranges.add(new int[] { -7, 30 }); result = MappingUtils.listToArray(ranges); assertEquals(result.length, 4); assertEquals(result[0], 24); @@ -1356,7 +1370,9 @@ public class MappingUtilsTest * Test mapping a sequence group where sequences in and outside the group * share a dataset sequence (e.g. alternative CDS for the same gene) *

- * This scenario doesn't arise after JAL-3763 changes, but test left as still valid + * This scenario doesn't arise after JAL-3763 changes, but test left as still + * valid + * * @throws IOException */ @Test(groups = { "Functional" }) @@ -1452,4 +1468,105 @@ public class MappingUtilsTest assertEquals(0, mappedGroup.getStartRes()); assertEquals(1, mappedGroup.getEndRes()); // two columns } + + @Test(groups = "Functional") + public void testFindOverlap() + { + List ranges = new ArrayList<>(); + ranges.add(new int[] { 4, 8 }); + ranges.add(new int[] { 10, 12 }); + ranges.add(new int[] { 16, 19 }); + + int[] overlap = MappingUtils.findOverlap(ranges, 5, 13); + assertArrayEquals(overlap, new int[] { 5, 12 }); + overlap = MappingUtils.findOverlap(ranges, -100, 100); + assertArrayEquals(overlap, new int[] { 4, 19 }); + overlap = MappingUtils.findOverlap(ranges, 7, 17); + assertArrayEquals(overlap, new int[] { 7, 17 }); + overlap = MappingUtils.findOverlap(ranges, 13, 15); + assertNull(overlap); + } + + /** + * Test mapping a sequence group including a sequence which maps to more than + * one other sequence + * + * @throws IOException + */ + @Test(groups = { "Functional" }) + public void testMapSequenceGroup_oneToMany() throws IOException + { + /* + * Uniprot:FER2_ARATH has cross-refs to 10 EMBLCDS sequences; + * we'll just mimic 3 of them here (abbreviated) + * From EMBLCDS|BAE98526 [ [1, 444] ] 3:1 to [ [1, 148] ] FER2_ARATH + * From EMBLCDS|AAM91336 same + * From EMBLCDS|AAM13033 same + */ + String coding = "atggcttccactgctctctca"; + AlignmentI cds = loadAlignment(">BAE98526\n" + coding + "\n>AAM91336\n" + + coding + "\n>AAM13033\n" + coding + "\n", + FileFormat.Fasta); + cds.setDataset(null); + AlignmentI protein = loadAlignment(">FER2_ARATH\nMASTALS\n", + FileFormat.Fasta); + protein.setDataset(null); + AlignedCodonFrame acf = new AlignedCodonFrame(); + MapList map = new MapList(new int[] { 1, 21 }, new int[] { 1, 7 }, 3, 1); + for (int seq = 0; seq < 3; seq++) + { + acf.addMap(cds.getSequenceAt(seq).getDatasetSequence(), + protein.getSequenceAt(0).getDatasetSequence(), map); + } + List acfList = Arrays + .asList(new AlignedCodonFrame[] + { acf }); + + AlignViewportI theDnaView = new AlignViewport(cds); + AlignViewportI theProteinView = new AlignViewport(protein); + protein.setCodonFrames(acfList); + + /* + * Select FER2_ARATH in the protein + */ + SequenceGroup sg = new SequenceGroup(); + sg.setColourText(true); + sg.setIdColour(Color.GREEN); + sg.setOutlineColour(Color.LIGHT_GRAY); + sg.addSequence(protein.getSequenceAt(0), false); + sg.setEndRes(protein.getWidth() - 1); + + /* + * Verify the mapped sequence group in dna + */ + SequenceGroup mappedGroup = MappingUtils.mapSequenceGroup(sg, + theProteinView, theDnaView); + assertTrue(mappedGroup.getColourText()); + assertSame(sg.getIdColour(), mappedGroup.getIdColour()); + assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); + assertEquals(3, mappedGroup.getSequences().size()); + assertSame(cds.getSequenceAt(0), mappedGroup.getSequences().get(0)); + assertSame(cds.getSequenceAt(1), mappedGroup.getSequences().get(1)); + assertSame(cds.getSequenceAt(2), mappedGroup.getSequences().get(2)); + assertEquals(0, mappedGroup.getStartRes()); + assertEquals(20, mappedGroup.getEndRes()); // 21 columns (7 codons) + + /* + * Select 2 CDS, verify peptide is mapped + */ + sg.clear(); + sg.addSequence(cds.getSequenceAt(1), false); + sg.addSequence(cds.getSequenceAt(0), false); + sg.setStartRes(0); + sg.setEndRes(20); + mappedGroup = MappingUtils.mapSequenceGroup(sg, theDnaView, + theProteinView); + assertTrue(mappedGroup.getColourText()); + assertSame(sg.getIdColour(), mappedGroup.getIdColour()); + assertSame(sg.getOutlineColour(), mappedGroup.getOutlineColour()); + assertEquals(1, mappedGroup.getSequences().size()); + assertSame(protein.getSequenceAt(0), mappedGroup.getSequences().get(0)); + assertEquals(0, mappedGroup.getStartRes()); + assertEquals(6, mappedGroup.getEndRes()); + } }