X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=help%2Fhtml%2Fmenus%2Falwcalculate.html;h=34e8d758a08db746e546a56c595bb498135edeab;hb=f9e3f75dec30e85fa177f0a5f952616fc677a1fc;hp=2e9ea0c4a4a5e93fff2104105bd8c7ee0909bd8e;hpb=c17661b22323a66090ea91e04751aa17461b17c5;p=jalview.git

diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html
index 2e9ea0c..34e8d75 100755
--- a/help/html/menus/alwcalculate.html
+++ b/help/html/menus/alwcalculate.html
@@ -102,6 +102,14 @@
         action on the whole alignment, or selected rows, columns, or
         regions.
     </em> <br></li>
+    <li><strong>Reverse, Reverse Complement</strong> (not applet)<br>
+    <em>These options are visible for nucleotide alignments. Selecting them adds the reverse (or reverse complement)
+    of the sequences (or selected region) as new sequences in the alignment. To try this out, add this sequence and
+    perform 'Reverse Complement' followed by 'Translate as cDNA':
+    <br><small>
+    Seq GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
+    TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG</small>
+    </em> <br></li>
     <li><strong>Get Cross-References</strong> (not applet)<br>
     <em>This option is visible where sequences have
         cross-references to other standard databases; for example, an