Alignment Window Menus

X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=help%2Fhtml%2Fmenus%2Falwcalculate.html;h=34e8d758a08db746e546a56c595bb498135edeab;hb=f9e3f75dec30e85fa177f0a5f952616fc677a1fc;hp=85ec95cbc8b00921afed1c49f827939a4fd08a32;hpb=0696cffbccbb537be78d9fc2410589adbcd7be35;p=jalview.git diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html index 85ec95c..34e8d75 100755 --- a/help/html/menus/alwcalculate.html +++ b/help/html/menus/alwcalculate.html @@ -1,81 +1,137 @@ -Alignment Window Menus + * You should have received a copy of the GNU General Public License + * along with Jalview. If not, see . + * The Jalview Authors are detailed in the 'AUTHORS' file. + --> + +Alignment Window Menus + -

Alignment Window Calculate Menu

Sort -
- by ID
  - This will sort the sequences according to sequence name. If the sort is - repeated, the order of the sorted sequences will be inverted.
- by Length
  - This will sort the sequences according to their length (excluding gap characters). If the sort is - repeated, the order of the sorted sequences will be inverted.
- by Group
  - This will sort the sequences according to sequence name. - If the sort is repeated, the order of the sorted sequences will be inverted. -
- by Pairwise Identity
  - This will sort the selected sequences by their percentage - identity to the consensus sequence. The most similar sequence is put at - the top.
- The Sort menu will have - some additional options if the alignment has any associated - score annotation, or you have just done a multiple alignment calculation - or opened a tree viewer window.
  -
-
Calculate Tree
- Functions for calculating trees on the alignment or the currently selected - region. See calculating trees. -
- Average Distance Using % Identity
- Neighbour Joining Using % Identity
- Average Distance Using Blosum62
- Neighbour Joining Using Blosum62
  +
  + Alignment Window Calculate Menu +
  +
  +
  Sort +
  +
  By ID
  This will sort + the sequences according to sequence name. If the sort is + repeated, the order of the sorted sequences will be + inverted.
  +
  By Length
  This will + sort the sequences according to their length (excluding gap + characters). If the sort is repeated, the order of the + sorted sequences will be inverted.
  +
  By Group
  This + will sort the sequences according to sequence name. If the + sort is repeated, the order of the sorted sequences will be + inverted.
  +
  By Pairwise Identity
  + This will sort the selected sequences by their + percentage identity to the consensus sequence. The most + similar sequence is put at the top.
  +
  The Sort + menu will have some additional options if the alignment + has any associated score annotation, or you have just done a + multiple alignment calculation or opened a tree viewer + window. +
  +
  +
  Calculate Tree
  Functions + for calculating trees on the alignment or the currently selected + region. See calculating + trees. + +
  +
  Neighbour Joining Using PAM250
  +
  +
  Neighbour Joining Using Sequence + Feature Similarity
  +
  Neighbour Joining Using Blosum62
  +
  +
  Neighbour Joining Using % Identity
  +
  Average Distance Using PAM250
  
  -
  -
  -
  Pairwise Alignments
  - Applies Smith and Waterman algorithm to selected sequences. See pairwise - alignments.
  -
  -
  Principal Component Analysis
  - Shows a spatial clustering of the sequences based on the BLOSUM62 scores - in the alignment. See Principal Component - Analysis.
  -
  -
  Extract Scores ... (optional)
  - This option is only visible if Jalview detects one or more white-space separated values in the description line of the alignment sequences.
  - When selected, these numbers are parsed into sequence associated annotation which can - then be used to sort the alignment via the Sort by→Score menu.
  -
  - -
  Autocalculate Consensus
  - For large alignments it can be useful to deselect "Autocalculate - Consensus" when editing. This prevents the sometimes lengthy calculations - performed after each sequence edit.
  -
  -
  - +
- Average Distance Using Sequence + Feature Similarity

+
Pairwise Alignments
Applies + Smith and Waterman algorithm to selected sequences. See pairwise alignments. +
+
Principal Component Analysis
Shows + a spatial clustering of the sequences based on similarity scores + calculated over the alignment.. See Principal Component Analysis. +
+
Extract Scores ... (optional)
This + option is only visible if Jalview detects one or more + white-space separated values in the description line of the + alignment sequences.
When selected, these numbers are + parsed into sequence associated annotation which can then be + used to sort the alignment via the Sort by→Score menu. +
+
Translate as cDNA (not applet)
+ This option is visible for nucleotide alignments. Selecting + this option shows the DNA's calculated protein product in a new + split frame window. + Note that the translation is not frame- or intron-aware; it + simply translates all codons in each sequence, using the + standard genetic code + (any incomplete final codon is discarded). You can perform this + action on the whole alignment, or selected rows, columns, or + regions. +
+
Reverse, Reverse Complement (not applet)
+ These options are visible for nucleotide alignments. Selecting them adds the reverse (or reverse complement) + of the sequences (or selected region) as new sequences in the alignment. To try this out, add this sequence and + perform 'Reverse Complement' followed by 'Translate as cDNA': +
+ Seq GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC + TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG +
+
Get Cross-References (not applet)
+ This option is visible where sequences have + cross-references to other standard databases; for example, an + EMBL entry may have cross-references to one or more UNIPROT + entries. Select the database to view all cross-referenced + sequences in a new split + frame window. +
+
Autocalculate Consensus
For + large alignments it can be useful to deselect + "Autocalculate Consensus" when editing. This prevents + the sometimes lengthy calculations performed after each sequence + edit.
+
Sort Alignment With New Tree
If + this option is selected, the alignment will be automatically + sorted whenever a new tree is calculated or loaded.
+
Show Flanking Regions
Opens + a new alignment window showing any additional sequence data + either side of the current alignment. Useful in conjunction with + 'Fetch Database References' when the 'Trim Retrieved Sequences' + option is disabled to retrieve full length sequences for a set + of aligned peptides.
+