X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=help%2Fhtml%2Fmenus%2Falwcalculate.html;h=34e8d758a08db746e546a56c595bb498135edeab;hb=f9e3f75dec30e85fa177f0a5f952616fc677a1fc;hp=e18e273bc6e63d17a8266460e4a4915b193850f3;hpb=6ab4ef1cc71ff9d28a21a139db69e4a8351a3fb5;p=jalview.git
diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html
index e18e273..34e8d75 100755
--- a/help/html/menus/alwcalculate.html
+++ b/help/html/menus/alwcalculate.html
@@ -1,18 +1,137 @@
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see .
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ -->
+
+Alignment Window Menus
+
+
+
+
+ Alignment Window Calculate Menu
+
+
+ - Sort
+
+ - By ID
This will sort
+ the sequences according to sequence name. If the sort is
+ repeated, the order of the sorted sequences will be
+ inverted.
+ - By Length
This will
+ sort the sequences according to their length (excluding gap
+ characters). If the sort is repeated, the order of the
+ sorted sequences will be inverted.
+ - By Group
This
+ will sort the sequences according to sequence name. If the
+ sort is repeated, the order of the sorted sequences will be
+ inverted.
+ - By Pairwise Identity
+ This will sort the selected sequences by their
+ percentage identity to the consensus sequence. The most
+ similar sequence is put at the top.
+ - The Sort
+ menu will have some additional options if the alignment
+ has any associated score annotation, or you have just done a
+ multiple alignment calculation or opened a tree viewer
+ window.
+
+
+ - Calculate Tree
Functions
+ for calculating trees on the alignment or the currently selected
+ region. See calculating
+ trees.
+
+
+ - Neighbour Joining Using PAM250
+
+ - Neighbour Joining Using Sequence
+ Feature Similarity
+ - Neighbour Joining Using Blosum62
+
+ - Neighbour Joining Using % Identity
+ - Average Distance Using PAM250
+
+ - Average Distance Using Sequence
+ Feature Similarity
+ - Average Distance Using Blosum62
+ - Average Distance Using % Identity
+
+ - Pairwise Alignments
Applies
+ Smith and Waterman algorithm to selected sequences. See pairwise alignments.
+
+ - Principal Component Analysis
Shows
+ a spatial clustering of the sequences based on similarity scores
+ calculated over the alignment.. See Principal Component Analysis.
+
+ - Extract Scores ... (optional)
This
+ option is only visible if Jalview detects one or more
+ white-space separated values in the description line of the
+ alignment sequences.
When selected, these numbers are
+ parsed into sequence associated annotation which can then be
+ used to sort the alignment via the Sort by→Score menu.
+
+ - Translate as cDNA (not applet)
+ This option is visible for nucleotide alignments. Selecting
+ this option shows the DNA's calculated protein product in a new
+ split frame window.
+ Note that the translation is not frame- or intron-aware; it
+ simply translates all codons in each sequence, using the
+ standard genetic code
+ (any incomplete final codon is discarded). You can perform this
+ action on the whole alignment, or selected rows, columns, or
+ regions.
+
+ - Reverse, Reverse Complement (not applet)
+ These options are visible for nucleotide alignments. Selecting them adds the reverse (or reverse complement)
+ of the sequences (or selected region) as new sequences in the alignment. To try this out, add this sequence and
+ perform 'Reverse Complement' followed by 'Translate as cDNA':
+
+ Seq GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
+ TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG
+
+ - Get Cross-References (not applet)
+ This option is visible where sequences have
+ cross-references to other standard databases; for example, an
+ EMBL entry may have cross-references to one or more UNIPROT
+ entries. Select the database to view all cross-referenced
+ sequences in a new split
+ frame window.
+
+ - Autocalculate Consensus
For
+ large alignments it can be useful to deselect
+ "Autocalculate Consensus" when editing. This prevents
+ the sometimes lengthy calculations performed after each sequence
+ edit.
+ - Sort Alignment With New Tree
If
+ this option is selected, the alignment will be automatically
+ sorted whenever a new tree is calculated or loaded.
+ - Show Flanking Regions
Opens
+ a new alignment window showing any additional sequence data
+ either side of the current alignment. Useful in conjunction with
+ 'Fetch Database References' when the 'Trim Retrieved Sequences'
+ option is disabled to retrieve full length sequences for a set
+ of aligned peptides.
+
+
+