X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=help%2Fhtml%2Fmenus%2Falwcalculate.html;h=80323487a675e09f4129dc01495e27b24ff97c01;hb=bf3206cc56a3bff812f96967a81cc9cff54a57b1;hp=28ff3d6d393475a230b4bcf6c3922d446cc9964e;hpb=797df64fa2a0a30773d0f48f5494d4155e5a8be3;p=jalview.git
diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html
index 28ff3d6..8032348 100755
--- a/help/html/menus/alwcalculate.html
+++ b/help/html/menus/alwcalculate.html
@@ -1,93 +1,138 @@
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview. If not, see .
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ -->
Alignment Window Menus
-
- Alignment Window Calculate Menu
-
-
- - Sort
-
- - by ID
This will sort the
- sequences according to sequence name. If the sort is repeated, the
- order of the sorted sequences will be inverted.
-
- - by Length
This will sort
- the sequences according to their length (excluding gap
- characters). If the sort is repeated, the order of the sorted
- sequences will be inverted.
-
- - by Group
This
- will sort the sequences according to sequence name. If the sort is
- repeated, the order of the sorted sequences will be inverted.
-
- - by Pairwise Identity
This
- will sort the selected sequences by their percentage identity to
- the consensus sequence. The most similar sequence is put at the
- top.
-
- - The Sort
- menu will have some additional options if the alignment has any
- associated score annotation, or you have just done a multiple
- alignment calculation or opened a tree viewer window.
-
- - Calculate Tree
Functions
- for calculating trees on the alignment or the currently selected
- region. See calculating
- trees.
-
- - Average Distance Using % Identity
-
- - Neighbour Joining Using % Identity
-
- - Average Distance Using Blosum62
-
- - Neighbour Joining Using Blosum62
-
-
-
- - Pairwise Alignments
Applies
- Smith and Waterman algorithm to selected sequences. See pairwise alignments.
-
- - Principal Component Analysis
Shows
- a spatial clustering of the sequences based on the BLOSUM62 scores
- in the alignment. See Principal
- Component Analysis.
- - Extract Scores ... (optional)
This
- option is only visible if Jalview detects one or more white-space
- separated values in the description line of the alignment sequences.
- When selected, these numbers are parsed into sequence associated
- annotation which can then be used to sort the alignment via the Sort
- by→Score menu.
-
- - Autocalculate Consensus
For
- large alignments it can be useful to deselect "Autocalculate
- Consensus" when editing. This prevents the sometimes lengthy
- calculations performed after each sequence edit.
- - Sort Alignment With New Tree
If
- this option is selected, the alignment will be automatically sorted
- whenever a new tree is calculated or loaded.
-
-
+
+ Alignment Window Calculate Menu
+
+
+ - Sort
+
+ - By ID
This will sort
+ the sequences according to sequence name. If the sort is
+ repeated, the order of the sorted sequences will be
+ inverted.
+ - By Length
This will
+ sort the sequences according to their length (excluding gap
+ characters). If the sort is repeated, the order of the
+ sorted sequences will be inverted.
+ - By Group
This
+ will sort the sequences according to sequence name. If the
+ sort is repeated, the order of the sorted sequences will be
+ inverted.
+ - By Pairwise Identity
+ This will sort the selected sequences by their
+ percentage identity to the consensus sequence. The most
+ similar sequence is put at the top.
+ - The Sort
+ menu will have some additional options if the alignment
+ has any associated score annotation, or you have just done a
+ multiple alignment calculation or opened a tree viewer
+ window.
+
+
+ - Calculate Tree
Functions
+ for calculating trees on the alignment or the currently selected
+ region. See calculating
+ trees.
+
+
+ - Neighbour Joining Using PAM250
+
+ - Neighbour Joining Using Sequence
+ Feature Similarity
+ - Neighbour Joining Using Blosum62
+
+ - Neighbour Joining Using % Identity
+ - Average Distance Using PAM250
+
+ - Average Distance Using Sequence
+ Feature Similarity
+ - Average Distance Using Blosum62
+ - Average Distance Using % Identity
+
+ - Pairwise Alignments
Applies
+ Smith and Waterman algorithm to selected sequences. See pairwise
+ alignments.
+
+ - Principal Component Analysis
Shows
+ a spatial clustering of the sequences based on similarity scores
+ calculated over the alignment.. See Principal Component
+ Analysis.
+
+ - Extract Scores ... (optional)
This
+ option is only visible if Jalview detects one or more
+ white-space separated values in the description line of the
+ alignment sequences.
When selected, these numbers are
+ parsed into sequence associated annotation which can then be
+ used to sort the alignment via the Sort by→Score menu.
+
+ - Translate as cDNA (not applet)
This
+ option is visible for nucleotide alignments. Selecting this
+ option shows the DNA's calculated protein product in a new split frame window. Note
+ that the translation is not frame- or intron-aware; it simply
+ translates all codons in each sequence, using the standard genetic code (any incomplete
+ final codon is discarded). You can perform this action on the
+ whole alignment, or selected rows, columns, or regions.
+
+ - Reverse, Reverse Complement (not applet)
+ These options are visible for nucleotide alignments.
+ Selecting them adds the reverse (or reverse complement) of the
+ sequences (or selected region) as new sequences in the
+ alignment. To try this out, add this sequence and perform
+ 'Reverse Complement' followed by 'Translate as cDNA':
+ Seq
+ GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
+ TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG
+
+ - Get Cross-References (not applet)
+ This option is visible where sequences have
+ cross-references to other standard databases; for example, an
+ EMBL entry may have cross-references to one or more UNIPROT
+ entries. Select the database to view all cross-referenced
+ sequences in a new split
+ frame window.
+
+ - Autocalculate Consensus
For
+ large alignments it can be useful to deselect
+ "Autocalculate Consensus" when editing. This prevents
+ the sometimes lengthy calculations performed after each sequence
+ edit.
+ - Sort Alignment With New Tree
If
+ this option is selected, the alignment will be automatically
+ sorted whenever a new tree is calculated or loaded.
+ - Show Flanking Regions
Opens
+ a new alignment window showing any additional sequence data
+ either side of the current alignment. Useful in conjunction with
+ 'Fetch Database References' when the 'Trim Retrieved Sequences'
+ option is disabled to retrieve full length sequences for a set
+ of aligned peptides.
+