X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=help%2Fhtml%2Fmenus%2Falwcalculate.html;h=80323487a675e09f4129dc01495e27b24ff97c01;hb=c2e5d3d1ebe3b283bdde15637c590721cd6c5637;hp=2e9ea0c4a4a5e93fff2104105bd8c7ee0909bd8e;hpb=c17661b22323a66090ea91e04751aa17461b17c5;p=jalview.git diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html index 2e9ea0c..8032348 100755 --- a/help/html/menus/alwcalculate.html +++ b/help/html/menus/alwcalculate.html @@ -75,14 +75,14 @@
  • Pairwise Alignments
    Applies Smith and Waterman algorithm to selected sequences. See pairwise alignments. + href="../calculations/pairwise.html">pairwise + alignments.
  • Principal Component Analysis
    Shows a spatial clustering of the sequences based on similarity scores calculated over the alignment.. See Principal Component Analysis. + href="../calculations/pca.html">Principal Component + Analysis.
  • Extract Scores ... (optional)
    This option is only visible if Jalview detects one or more @@ -91,19 +91,28 @@ parsed into sequence associated annotation which can then be used to sort the alignment via the Sort by→Score menu.
  • -
  • Translate as cDNA (not applet)
    - This option is visible for nucleotide alignments. Selecting - this option shows the DNA's calculated protein product in a new - split frame window. - Note that the translation is not frame- or intron-aware; it - simply translates all codons in each sequence, using the - standard genetic code - (any incomplete final codon is discarded). You can perform this - action on the whole alignment, or selected rows, columns, or - regions. +
  • Translate as cDNA (not applet)
    This + option is visible for nucleotide alignments. Selecting this + option shows the DNA's calculated protein product in a new split frame window. Note + that the translation is not frame- or intron-aware; it simply + translates all codons in each sequence, using the standard genetic code (any incomplete + final codon is discarded). You can perform this action on the + whole alignment, or selected rows, columns, or regions. +
  • +
  • Reverse, Reverse Complement (not applet)
    + These options are visible for nucleotide alignments. + Selecting them adds the reverse (or reverse complement) of the + sequences (or selected region) as new sequences in the + alignment. To try this out, add this sequence and perform + 'Reverse Complement' followed by 'Translate as cDNA':
    + Seq + GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC + TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG

  • Get Cross-References (not applet)
    - This option is visible where sequences have + This option is visible where sequences have cross-references to other standard databases; for example, an EMBL entry may have cross-references to one or more UNIPROT entries. Select the database to view all cross-referenced