X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=help%2Fhtml%2Fmenus%2Falwcalculate.html;h=80323487a675e09f4129dc01495e27b24ff97c01;hb=c2e5d3d1ebe3b283bdde15637c590721cd6c5637;hp=2e9ea0c4a4a5e93fff2104105bd8c7ee0909bd8e;hpb=c17661b22323a66090ea91e04751aa17461b17c5;p=jalview.git
diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html
index 2e9ea0c..8032348 100755
--- a/help/html/menus/alwcalculate.html
+++ b/help/html/menus/alwcalculate.html
@@ -75,14 +75,14 @@
Pairwise Alignments
Applies
Smith and Waterman algorithm to selected sequences. See pairwise alignments.
+ href="../calculations/pairwise.html">pairwise
+ alignments.
Principal Component Analysis
Shows
a spatial clustering of the sequences based on similarity scores
calculated over the alignment.. See Principal Component Analysis.
+ href="../calculations/pca.html">Principal Component
+ Analysis.
Extract Scores ... (optional)
This
option is only visible if Jalview detects one or more
@@ -91,19 +91,28 @@
parsed into sequence associated annotation which can then be
used to sort the alignment via the Sort by→Score menu.
- Translate as cDNA (not applet)
- This option is visible for nucleotide alignments. Selecting
- this option shows the DNA's calculated protein product in a new
- split frame window.
- Note that the translation is not frame- or intron-aware; it
- simply translates all codons in each sequence, using the
- standard genetic code
- (any incomplete final codon is discarded). You can perform this
- action on the whole alignment, or selected rows, columns, or
- regions.
+ Translate as cDNA (not applet)
This
+ option is visible for nucleotide alignments. Selecting this
+ option shows the DNA's calculated protein product in a new split frame window. Note
+ that the translation is not frame- or intron-aware; it simply
+ translates all codons in each sequence, using the standard genetic code (any incomplete
+ final codon is discarded). You can perform this action on the
+ whole alignment, or selected rows, columns, or regions.
+
+ Reverse, Reverse Complement (not applet)
+ These options are visible for nucleotide alignments.
+ Selecting them adds the reverse (or reverse complement) of the
+ sequences (or selected region) as new sequences in the
+ alignment. To try this out, add this sequence and perform
+ 'Reverse Complement' followed by 'Translate as cDNA':
+ Seq
+ GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
+ TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG
Get Cross-References (not applet)
- This option is visible where sequences have
+ This option is visible where sequences have
cross-references to other standard databases; for example, an
EMBL entry may have cross-references to one or more UNIPROT
entries. Select the database to view all cross-referenced