X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=help%2Fhtml%2Fmenus%2Falwcalculate.html;h=c7a1c87c9c005b8a5c8b5f14265ac4f8be54d305;hb=1a04478ca5d5fa6bae27f8e7220df5b57fe1c698;hp=34e8d758a08db746e546a56c595bb498135edeab;hpb=caa95ef9ea2580b9f7331d48fab0c2ad26babae6;p=jalview.git
diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html
index 34e8d75..c7a1c87 100755
--- a/help/html/menus/alwcalculate.html
+++ b/help/html/menus/alwcalculate.html
@@ -53,37 +53,19 @@
window.
-
Calculate Tree
Functions
- for calculating trees on the alignment or the currently selected
- region. See calculating
- trees.
-
-
- - Neighbour Joining Using PAM250
-
- - Neighbour Joining Using Sequence
- Feature Similarity
- - Neighbour Joining Using Blosum62
-
- - Neighbour Joining Using % Identity
- - Average Distance Using PAM250
-
- - Average Distance Using Sequence
- Feature Similarity
- - Average Distance Using Blosum62
- - Average Distance Using % Identity
-
+ Calculate Tree or PCA ...
Opens the
+ calculations dialog for
+ for calculating trees or
+ principle component analysis
+ plots on the alignment or the currently selected
+ region.
+
+
Pairwise Alignments
Applies
Smith and Waterman algorithm to selected sequences. See pairwise alignments.
+ href="../calculations/pairwise.html">pairwise
+ alignments.
- Principal Component Analysis
Shows
- a spatial clustering of the sequences based on similarity scores
- calculated over the alignment.. See Principal Component Analysis.
-
Extract Scores ... (optional)
This
option is only visible if Jalview detects one or more
white-space separated values in the description line of the
@@ -91,27 +73,28 @@
parsed into sequence associated annotation which can then be
used to sort the alignment via the Sort by→Score menu.
- Translate as cDNA (not applet)
- This option is visible for nucleotide alignments. Selecting
- this option shows the DNA's calculated protein product in a new
- split frame window.
- Note that the translation is not frame- or intron-aware; it
- simply translates all codons in each sequence, using the
- standard genetic code
- (any incomplete final codon is discarded). You can perform this
- action on the whole alignment, or selected rows, columns, or
- regions.
+ Translate as cDNA (not applet)
This
+ option is visible for nucleotide alignments. Selecting this
+ option shows the DNA's calculated protein product in a new split frame window. Note
+ that the translation is not frame- or intron-aware; it simply
+ translates all codons in each sequence, using the standard genetic code (any incomplete
+ final codon is discarded). You can perform this action on the
+ whole alignment, or selected rows, columns, or regions.
Reverse, Reverse Complement (not applet)
- These options are visible for nucleotide alignments. Selecting them adds the reverse (or reverse complement)
- of the sequences (or selected region) as new sequences in the alignment. To try this out, add this sequence and
- perform 'Reverse Complement' followed by 'Translate as cDNA':
-
- Seq GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
- TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG
+ These options are visible for nucleotide alignments.
+ Selecting them adds the reverse (or reverse complement) of the
+ sequences (or selected region) as new sequences in the
+ alignment. To try this out, add this sequence and perform
+ 'Reverse Complement' followed by 'Translate as cDNA':
+ Seq
+ GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
+ TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG
Get Cross-References (not applet)
- This option is visible where sequences have
+ This option is visible where sequences have
cross-references to other standard databases; for example, an
EMBL entry may have cross-references to one or more UNIPROT
entries. Select the database to view all cross-referenced