X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=help%2Fhtml%2Fmenus%2Falwcalculate.html;h=c7a1c87c9c005b8a5c8b5f14265ac4f8be54d305;hb=cd1dfe669b5d4d155cdb5f4a97554ae91ab10cf9;hp=e91aa662ab1cd3a883673cd38ab8d7cb0e9d13b5;hpb=c19d2a91ca05e052e3408bf5852d88eb5d0608f1;p=jalview.git

diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html
index e91aa66..c7a1c87 100755
--- a/help/html/menus/alwcalculate.html
+++ b/help/html/menus/alwcalculate.html
@@ -1,7 +1,7 @@
 <html>
 <!--
- * Jalview - A Sequence Alignment Editor and Viewer (Version 2.9.0b2)
- * Copyright (C) 2015 The Jalview Authors
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
  * 
  * This file is part of Jalview.
  * 
@@ -53,37 +53,19 @@
             window.
         </em><br></li>
       </ul></li>
-    <li><strong>Calculate Tree </strong> <br> <em>Functions
-        for calculating trees on the alignment or the currently selected
-        region. See <a href="../calculations/tree.html">calculating
-          trees</a>.
-    </em>
-      <ul>
-        <li><strong>Neighbour Joining Using PAM250<br>
-        </strong></li>
-        <li><strong>Neighbour Joining Using Sequence
-            Feature Similarity</strong></li>
-        <li><strong>Neighbour Joining Using Blosum62<br>
-        </strong></li>
-        <li><strong>Neighbour Joining Using % Identity</strong></li>
-        <li><strong>Average Distance Using PAM250<br>
-        </strong></li>
-        <li><strong>Average Distance Using Sequence
-            Feature Similarity</strong></li>
-        <li><strong>Average Distance Using Blosum62</strong></li>
-        <li><strong>Average Distance Using % Identity</strong></li>
-      </ul></li>
+    <li><strong>Calculate Tree or PCA ...</strong> <br> <em>Opens the 
+    <a href="../calculations/calculations.html">calculations dialog</a> for
+        for calculating <a href="../calculations/tree.html">trees</a> or
+         <a href="../calculations/pca.html">principle component analysis 
+         plots</a> on the alignment or the currently selected
+        region. 
+      </em><br>
+    </li>
     <li><strong>Pairwise Alignments</strong><br> <em>Applies
         Smith and Waterman algorithm to selected sequences. See <a
-        href="../calculations/pairwise.html"
-      >pairwise alignments</a>.
+        href="../calculations/pairwise.html">pairwise
+          alignments</a>.
     </em><br></li>
-    <li><strong>Principal Component Analysis</strong><br> <em>Shows
-        a spatial clustering of the sequences based on similarity scores
-        calculated over the alignment.. See <a
-        href="../calculations/pca.html"
-      >Principal Component Analysis</a>.
-    </em> <br></li>
     <li><strong>Extract Scores ... (optional)</strong><br> <em>This
         option is only visible if Jalview detects one or more
         white-space separated values in the description line of the
@@ -91,19 +73,28 @@
         parsed into sequence associated annotation which can then be
         used to sort the alignment via the Sort by&#8594;Score menu.
     </em> <br></li>
-    <li><strong>Translate as cDNA</strong> (not applet)<br>
-    <em>This option is visible for nucleotide alignments. Selecting
-        this option shows the DNA's calculated protein product in a new
-        <a href="../features/splitView.html">split frame</a> window.
-        Note that the translation is not frame- or intron-aware; it
-        simply translates all codons in each sequence, using the
-        standard <a href="../misc/geneticCode.html">genetic code</a>
-        (any incomplete final codon is discarded). You can perform this
-        action on the whole alignment, or selected rows, columns, or
-        regions.
+    <li><strong>Translate as cDNA</strong> (not applet)<br> <em>This
+        option is visible for nucleotide alignments. Selecting this
+        option shows the DNA's calculated protein product in a new <a
+        href="../features/splitView.html">split frame</a> window. Note
+        that the translation is not frame- or intron-aware; it simply
+        translates all codons in each sequence, using the standard <a
+        href="../misc/geneticCode.html">genetic code</a> (any incomplete
+        final codon is discarded). You can perform this action on the
+        whole alignment, or selected rows, columns, or regions.
+    </em> <br></li>
+    <li><strong>Reverse, Reverse Complement</strong> (not applet)<br>
+      <em>These options are visible for nucleotide alignments.
+        Selecting them adds the reverse (or reverse complement) of the
+        sequences (or selected region) as new sequences in the
+        alignment. To try this out, add this sequence and perform
+        'Reverse Complement' followed by 'Translate as cDNA': <br>
+      <small> Seq
+          GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC
+          TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG</small>
     </em> <br></li>
     <li><strong>Get Cross-References</strong> (not applet)<br>
-    <em>This option is visible where sequences have
+      <em>This option is visible where sequences have
         cross-references to other standard databases; for example, an
         EMBL entry may have cross-references to one or more UNIPROT
         entries. Select the database to view all cross-referenced
