X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=help%2Fhtml%2Fmenus%2Falwcalculate.html;h=c7a1c87c9c005b8a5c8b5f14265ac4f8be54d305;hb=e502a7571bf01a0354ce8205948dd7a3cda1603b;hp=a1c630e5e12d837794cf4e316076e31d1798e2c1;hpb=de255c8c87707a2cd2a2a15f5ad04ed10fe5846d;p=jalview.git diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html index a1c630e..c7a1c87 100755 --- a/help/html/menus/alwcalculate.html +++ b/help/html/menus/alwcalculate.html @@ -24,85 +24,91 @@ -

- Alignment Window Calculate Menu -

Sort -
- By ID
  This will sort the - sequences according to sequence name. If the sort is repeated, the - order of the sorted sequences will be inverted. -
- By Length
  This will sort - the sequences according to their length (excluding gap - characters). If the sort is repeated, the order of the sorted - sequences will be inverted. -
- By Group
  This - will sort the sequences according to sequence name. If the sort is - repeated, the order of the sorted sequences will be inverted. -
- By Pairwise Identity
  This - will sort the selected sequences by their percentage identity to - the consensus sequence. The most similar sequence is put at the - top. -
- The Sort - menu will have some additional options if the alignment has any - associated score annotation, or you have just done a multiple - alignment calculation or opened a tree viewer window.
Calculate Tree
Functions - for calculating trees on the alignment or the currently selected - region. See calculating - trees. - +
+ Alignment Window Calculate Menu +
+
- Sort
  - Neighbour Joining Using PAM250
    -
  - Neighbour Joining Using Sequence - Feature Similarity
  - Neighbour Joining Using Blosum62
    -
  - Neighbour Joining Using % Identity
  - Average Distance Using PAM250
    -
  - Average Distance Using Sequence - Feature Similarity
  - Average Distance Using Blosum62
  - Average Distance Using % Identity
  - By ID
    This will sort + the sequences according to sequence name. If the sort is + repeated, the order of the sorted sequences will be + inverted.
  - By Length
    This will + sort the sequences according to their length (excluding gap + characters). If the sort is repeated, the order of the + sorted sequences will be inverted.
  - By Group
    This + will sort the sequences according to sequence name. If the + sort is repeated, the order of the sorted sequences will be + inverted.
  - By Pairwise Identity
    + This will sort the selected sequences by their + percentage identity to the consensus sequence. The most + similar sequence is put at the top.
  - The Sort + menu will have some additional options if the alignment + has any associated score annotation, or you have just done a + multiple alignment calculation or opened a tree viewer + window. +
- Calculate Tree or PCA ...
  Opens the + calculations dialog for + for calculating trees or + principle component analysis + plots on the alignment or the currently selected + region. +
  +
- Pairwise Alignments
  Applies - Smith and Waterman algorithm to selected sequences. See pairwise alignments.
  -
- Principal Component Analysis
  Shows - a spatial clustering of the sequences based on similarity scores calculated over the alignment.. See Principal - Component Analysis.
- Extract Scores ... (optional)
  This - option is only visible if Jalview detects one or more white-space - separated values in the description line of the alignment sequences.
  - When selected, these numbers are parsed into sequence associated - annotation which can then be used to sort the alignment via the Sort - by→Score menu.
- Translate as cDNA (not applet)
  This option is visible for nucleotide alignments. - Selecting this option shows the DNA's calculated protein product in a new split frame window. Note that the - translation is not frame- or intron-aware; it simply translates all codons in each sequence, using the - standard genetic code (any incomplete final codon is discarded). - You can perform this action on the whole alignment, - or selected rows, columns, or regions.
- Get Cross-References (not applet)
  This option is visible where sequences have cross-references to - other standard databases; for example, an EMBL entry may have cross-references to one or more UNIPROT entries. - Select the database to view all cross-referenced sequences in a new split frame window.
- Autocalculate Consensus
  For - large alignments it can be useful to deselect "Autocalculate - Consensus" when editing. This prevents the sometimes lengthy - calculations performed after each sequence edit.
- Sort Alignment With New Tree
  If - this option is selected, the alignment will be automatically sorted - whenever a new tree is calculated or loaded.
  -
- Extract Scores ... (optional)
  This + option is only visible if Jalview detects one or more + white-space separated values in the description line of the + alignment sequences.
  When selected, these numbers are + parsed into sequence associated annotation which can then be + used to sort the alignment via the Sort by→Score menu. +
- Translate as cDNA (not applet)
  This + option is visible for nucleotide alignments. Selecting this + option shows the DNA's calculated protein product in a new split frame window. Note + that the translation is not frame- or intron-aware; it simply + translates all codons in each sequence, using the standard genetic code (any incomplete + final codon is discarded). You can perform this action on the + whole alignment, or selected rows, columns, or regions. +
- Reverse, Reverse Complement (not applet)
  + These options are visible for nucleotide alignments. + Selecting them adds the reverse (or reverse complement) of the + sequences (or selected region) as new sequences in the + alignment. To try this out, add this sequence and perform + 'Reverse Complement' followed by 'Translate as cDNA':
  + Seq + GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC + TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG +
- Get Cross-References (not applet)
  + This option is visible where sequences have + cross-references to other standard databases; for example, an + EMBL entry may have cross-references to one or more UNIPROT + entries. Select the database to view all cross-referenced + sequences in a new split + frame window. +
- Autocalculate Consensus
  For + large alignments it can be useful to deselect + "Autocalculate Consensus" when editing. This prevents + the sometimes lengthy calculations performed after each sequence + edit.
- Sort Alignment With New Tree
  If + this option is selected, the alignment will be automatically + sorted whenever a new tree is calculated or loaded.
- Show Flanking Regions
  Opens a new alignment window showing any additional sequence data either side of the current alignment. Useful in conjunction with