Alignment Window Menus

X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=help%2Fhtml%2Fmenus%2Falwcalculate.html;h=c7a1c87c9c005b8a5c8b5f14265ac4f8be54d305;hb=ecdbc96815298ac853543640881ef8d2384b48a1;hp=93652aff2e1934d2434a804c12f261c662bb26b6;hpb=b2f9a8d7bce642ff4011bc6d49e02bb0569fbb11;p=jalview.git diff --git a/help/html/menus/alwcalculate.html b/help/html/menus/alwcalculate.html index 93652af..c7a1c87 100755 --- a/help/html/menus/alwcalculate.html +++ b/help/html/menus/alwcalculate.html @@ -1,94 +1,120 @@ + --> Alignment Window Menus -

- Alignment Window Calculate Menu -

Sort -
- by ID
  This will sort the - sequences according to sequence name. If the sort is repeated, the - order of the sorted sequences will be inverted. -
- by Length
  This will sort - the sequences according to their length (excluding gap - characters). If the sort is repeated, the order of the sorted - sequences will be inverted. -
- by Group
  This - will sort the sequences according to sequence name. If the sort is - repeated, the order of the sorted sequences will be inverted. -
- by Pairwise Identity
  This - will sort the selected sequences by their percentage identity to - the consensus sequence. The most similar sequence is put at the - top. -
- The Sort - menu will have some additional options if the alignment has any - associated score annotation, or you have just done a multiple - alignment calculation or opened a tree viewer window.
Calculate Tree
Functions - for calculating trees on the alignment or the currently selected - region. See calculating - trees. -
- Average Distance Using % Identity -
- Neighbour Joining Using % Identity -
- Average Distance Using Blosum62 -
- Neighbour Joining Using Blosum62
  - -
Pairwise Alignments
Applies - Smith and Waterman algorithm to selected sequences. See pairwise alignments.
-
Principal Component Analysis
Shows - a spatial clustering of the sequences based on the BLOSUM62 scores - in the alignment. See Principal - Component Analysis.
Extract Scores ... (optional)
This - option is only visible if Jalview detects one or more white-space - separated values in the description line of the alignment sequences.
- When selected, these numbers are parsed into sequence associated - annotation which can then be used to sort the alignment via the Sort - by→Score menu.
Autocalculate Consensus
For - large alignments it can be useful to deselect "Autocalculate - Consensus" when editing. This prevents the sometimes lengthy - calculations performed after each sequence edit.
Sort Alignment With New Tree
If - this option is selected, the alignment will be automatically sorted - whenever a new tree is calculated or loaded.
-

+ Alignment Window Calculate Menu +

Sort +
- By ID
  This will sort + the sequences according to sequence name. If the sort is + repeated, the order of the sorted sequences will be + inverted.
- By Length
  This will + sort the sequences according to their length (excluding gap + characters). If the sort is repeated, the order of the + sorted sequences will be inverted.
- By Group
  This + will sort the sequences according to sequence name. If the + sort is repeated, the order of the sorted sequences will be + inverted.
- By Pairwise Identity
  + This will sort the selected sequences by their + percentage identity to the consensus sequence. The most + similar sequence is put at the top.
- The Sort + menu will have some additional options if the alignment + has any associated score annotation, or you have just done a + multiple alignment calculation or opened a tree viewer + window. +
Calculate Tree or PCA ...
Opens the + calculations dialog for + for calculating trees or + principle component analysis + plots on the alignment or the currently selected + region. +
+
Pairwise Alignments
Applies + Smith and Waterman algorithm to selected sequences. See pairwise + alignments. +
Extract Scores ... (optional)
This + option is only visible if Jalview detects one or more + white-space separated values in the description line of the + alignment sequences.
When selected, these numbers are + parsed into sequence associated annotation which can then be + used to sort the alignment via the Sort by→Score menu. +
Translate as cDNA (not applet)
This + option is visible for nucleotide alignments. Selecting this + option shows the DNA's calculated protein product in a new split frame window. Note + that the translation is not frame- or intron-aware; it simply + translates all codons in each sequence, using the standard genetic code (any incomplete + final codon is discarded). You can perform this action on the + whole alignment, or selected rows, columns, or regions. +
Reverse, Reverse Complement (not applet)
+ These options are visible for nucleotide alignments. + Selecting them adds the reverse (or reverse complement) of the + sequences (or selected region) as new sequences in the + alignment. To try this out, add this sequence and perform + 'Reverse Complement' followed by 'Translate as cDNA':
+ Seq + GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC + TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG +
Get Cross-References (not applet)
+ This option is visible where sequences have + cross-references to other standard databases; for example, an + EMBL entry may have cross-references to one or more UNIPROT + entries. Select the database to view all cross-referenced + sequences in a new split + frame window. +
Autocalculate Consensus
For + large alignments it can be useful to deselect + "Autocalculate Consensus" when editing. This prevents + the sometimes lengthy calculations performed after each sequence + edit.
Sort Alignment With New Tree
If + this option is selected, the alignment will be automatically + sorted whenever a new tree is calculated or loaded.
Show Flanking Regions
Opens + a new alignment window showing any additional sequence data + either side of the current alignment. Useful in conjunction with + 'Fetch Database References' when the 'Trim Retrieved Sequences' + option is disabled to retrieve full length sequences for a set + of aligned peptides.