X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=src%2Fjalview%2Fgui%2FAppVarnaBinding.java;h=e5196cc9a8759f55e83d8b1562a59e6f2a7c8f1e;hb=d335e9093099a7ffa812b61e734ddd88769ea9dd;hp=fc1f4467311ac3c766655f09386e4fc5d39b7b6e;hpb=7e8c302ce5d0b9de38cdc8d127fb192f851108c3;p=jalview.git diff --git a/src/jalview/gui/AppVarnaBinding.java b/src/jalview/gui/AppVarnaBinding.java index fc1f446..e5196cc 100644 --- a/src/jalview/gui/AppVarnaBinding.java +++ b/src/jalview/gui/AppVarnaBinding.java @@ -1,123 +1,73 @@ /* - * Jalview - A Sequence Alignment Editor and Viewer (Version 2.7) - * Copyright (C) 2011 J Procter, AM Waterhouse, J Engelhardt, LM Lui, G Barton, M Clamp, S Searle + * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$) + * Copyright (C) $$Year-Rel$$ The Jalview Authors * * This file is part of Jalview. * * Jalview is free software: you can redistribute it and/or * modify it under the terms of the GNU General Public License - * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. - * + * as published by the Free Software Foundation, either version 3 + * of the License, or (at your option) any later version. + * * Jalview is distributed in the hope that it will be useful, but * WITHOUT ANY WARRANTY; without even the implied warranty * of MERCHANTABILITY or FITNESS FOR A PARTICULAR * PURPOSE. See the GNU General Public License for more details. * - * You should have received a copy of the GNU General Public License along with Jalview. If not, see . + * You should have received a copy of the GNU General Public License + * along with Jalview. If not, see . + * The Jalview Authors are detailed in the 'AUTHORS' file. */ package jalview.gui; +import jalview.datamodel.SequenceI; +import jalview.ext.varna.JalviewVarnaBinding; +import jalview.structure.AtomSpec; +import jalview.util.MessageManager; + import java.awt.BorderLayout; import java.awt.Color; import java.awt.Component; import java.awt.Dimension; -import java.awt.Font; -import java.awt.GridLayout; import java.awt.datatransfer.DataFlavor; import java.awt.datatransfer.Transferable; import java.awt.dnd.DnDConstants; import java.awt.dnd.DropTarget; -import java.awt.dnd.DropTargetDragEvent; +import java.awt.dnd.DropTargetAdapter; import java.awt.dnd.DropTargetDropEvent; -import java.awt.dnd.DropTargetEvent; -import java.awt.dnd.DropTargetListener; -import java.awt.event.ActionEvent; -import java.awt.event.ActionListener; import java.awt.event.ComponentEvent; +import java.awt.event.MouseAdapter; import java.awt.event.MouseEvent; -import java.awt.event.MouseListener; import java.io.File; -import java.text.DateFormat; +import java.io.IOException; import java.util.ArrayList; import java.util.Collection; -import java.util.Date; import java.util.List; import javax.swing.DefaultListModel; import javax.swing.DefaultListSelectionModel; -import javax.swing.Icon; -import javax.swing.JButton; -import javax.swing.JFrame; import javax.swing.JLabel; import javax.swing.JList; -import javax.swing.JOptionPane; import javax.swing.JPanel; import javax.swing.JScrollPane; -import javax.swing.JSplitPane; -import javax.swing.JTextField; import javax.swing.ListModel; import javax.swing.ListSelectionModel; -import javax.swing.UIManager; -import javax.swing.UnsupportedLookAndFeelException; import javax.swing.event.ListSelectionEvent; import javax.swing.event.ListSelectionListener; import fr.orsay.lri.varna.VARNAPanel; import fr.orsay.lri.varna.components.ReorderableJList; -import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax; import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed; +import fr.orsay.lri.varna.exceptions.ExceptionNAViewAlgorithm; import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength; -import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses; -import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener; import fr.orsay.lri.varna.models.FullBackup; import fr.orsay.lri.varna.models.VARNAConfig; -import fr.orsay.lri.varna.models.rna.Mapping; import fr.orsay.lri.varna.models.rna.RNA; -public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding - implements DropTargetListener, InterfaceVARNAListener, - MouseListener +public class AppVarnaBinding extends JalviewVarnaBinding { - - /** - * - */ - // private static final long serialVersionUID = -790155708306987257L; - - private String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA"; - - private String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...))))).."; - - private String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...))))).."; - public VARNAPanel vp; - protected JPanel _tools = new JPanel(); - - private JPanel _input = new JPanel(); - - private JPanel _seqPanel = new JPanel(); - - private JPanel _strPanel = new JPanel(); - - private JLabel _info = new JLabel(); - - private JTextField _str = new JTextField(); - - private JTextField _seq = new JTextField(); - - private JLabel _strLabel = new JLabel(" Str:"); - - private JLabel _seqLabel = new JLabel(" Seq:"); - - private JButton _createButton = new JButton("Create"); - - private JButton _updateButton = new JButton("Update"); - - private JButton _deleteButton = new JButton("Delete"); - - private JButton _duplicateButton = new JButton("Snapshot"); - protected JPanel _listPanel = new JPanel(); private ReorderableJList _sideList = null; @@ -136,29 +86,23 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding private BackupHolder _rnaList; - /* - * public AppVarnaBinding() { //super("VARNA in Jalview"); - * //this.set_seq("ATGC"); //this.set_str(".()."); //RNAPanelDemoInit(); - * - * //initVarna("ATGCATGATATATATATAT","....((((...))))...."); - * initVarna(this.DEFAULT_SEQUENCE,this.DEFAULT_STRUCTURE1); } + /** + * Constructor */ - - public AppVarnaBinding(String seq, String struc) + public AppVarnaBinding() { - // super("VARNA in Jalview"); - initVarna(seq, struc); + init(); } - public AppVarnaBinding(ArrayList rnaList) + /** + * Constructs the VARNAPanel and an (empty) selection list of structures to + * show in it + */ + private void init() { - // super("VARNA in Jalview"); - initVarnaEdit(rnaList); - } + DefaultListModel dlm = new DefaultListModel(); - private void initVarna(String seq, String str) - { - DefaultListModel dlm = new DefaultListModel(); + int marginTools = 40; DefaultListSelectionModel m = new DefaultListSelectionModel(); m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); @@ -166,85 +110,21 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding _sideList = new ReorderableJList(); _sideList.setModel(dlm); - _sideList.addMouseListener(this); - _sideList.setSelectionModel(m); - _sideList.setPreferredSize(new Dimension(100, 0)); - _sideList.addListSelectionListener(new ListSelectionListener() + _sideList.addMouseListener(new MouseAdapter() { - public void valueChanged(ListSelectionEvent arg0) + @Override + public void mouseClicked(MouseEvent e) { - if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting()) - { - FullBackup sel = (FullBackup) _sideList.getSelectedValue(); - Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA() - .getSize(), sel.rna.getSize()); - vp.showRNAInterpolated(sel.rna, sel.config, map); - _seq.setText(sel.rna.getSeq()); - _str.setText(sel.rna.getStructDBN()); - } + AppVarnaBinding.this.mouseClicked(e); } }); - - _rnaList = new BackupHolder(dlm, _sideList); - RNA _RNA1 = new RNA("User defined 1"); - - try - { - vp = new VARNAPanel("0", "."); - _RNA1.setRNA(seq, str); - _RNA1.drawRNARadiate(vp.getConfig()); - } catch (ExceptionNonEqualLength e) - { - vp.errorDialog(e); - } catch (ExceptionUnmatchedClosingParentheses e2) - { - e2.printStackTrace(); - } catch (ExceptionFileFormatOrSyntax e3) - { - e3.printStackTrace(); - } - vp.setPreferredSize(new Dimension(400, 400)); - _rnaList.add(vp.getConfig().clone(), _RNA1, generateDefaultName(), true); - - // TODO setBackground(_backgroundColor); - vp.setBackground(_backgroundColor); - - // TODO getContentPane().setLayout(new BorderLayout()); - // TODO getContentPane().add(vp, BorderLayout.CENTER); - - // setVisible(true); - vp.addVARNAListener(this); - } - - private void initVarnaEdit(ArrayList rnaInList) - { - DefaultListModel dlm = new DefaultListModel(); - - int marginTools = 40; - - DefaultListSelectionModel m = new DefaultListSelectionModel(); - m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); - m.setLeadAnchorNotificationEnabled(false); - - _sideList = new ReorderableJList(); - _sideList.setModel(dlm); - _sideList.addMouseListener(this); _sideList.setSelectionModel(m); _sideList.setPreferredSize(new Dimension(100, 0)); _sideList.addListSelectionListener(new ListSelectionListener() { - public void valueChanged(ListSelectionEvent arg0) + public void valueChanged(ListSelectionEvent evt) { - // System.out.println(arg0); - if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting()) - { - FullBackup sel = (FullBackup) _sideList.getSelectedValue(); - Mapping map = Mapping.DefaultOutermostMapping(vp.getRNA() - .getSize(), sel.rna.getSize()); - vp.showRNAInterpolated(sel.rna, sel.config, map); - // _seq.setText(sel.rna.getSeq()); - _str.setText(sel.rna.getStructDBN()); - } + changeSelectedStructure_actionPerformed(evt); } }); _rnaList = new BackupHolder(dlm, _sideList); @@ -252,119 +132,33 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding try { vp = new VARNAPanel("0", "."); - for (int i = 0; i < rnaInList.size(); i++) - { - rnaInList.get(i).drawRNARadiate(vp.getConfig()); - } } catch (ExceptionNonEqualLength e) { vp.errorDialog(e); } vp.setPreferredSize(new Dimension(400, 400)); - for (int i = 0; i < rnaInList.size(); i++) - { - if (i < rnaInList.size() - 1) - { - _rnaList.add(vp.getConfig().clone(), rnaInList.get(i), rnaInList - .get(i).getName()); - } - else - { - _rnaList.add(vp.getConfig().clone(), rnaInList.get(i), rnaInList - .get(i).getName(), true); - } - } - - /* - * _rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName()); - * _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true); - */ JScrollPane listScroller = new JScrollPane(_sideList); listScroller.setPreferredSize(new Dimension(150, 0)); vp.setBackground(_backgroundColor); - Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12"); + JLabel j = new JLabel( + MessageManager.getString("label.structures_manager"), + JLabel.CENTER); + _listPanel.setLayout(new BorderLayout()); - // _seqLabel.setHorizontalTextPosition(JLabel.LEFT); - // _seqLabel.setPreferredSize(new Dimension(marginTools, 15)); - _seq.setFont(textFieldsFont); - _seq.setText(rnaInList.get(0).getSeq()); + _listPanel.add(j, BorderLayout.NORTH); + _listPanel.add(listScroller, BorderLayout.CENTER); - _updateButton.addActionListener(new ActionListener() + new DropTarget(vp, new DropTargetAdapter() { - public void actionPerformed(ActionEvent e) + @Override + public void drop(DropTargetDropEvent dtde) { - FullBackup sel = (FullBackup) _sideList.getSelectedValue(); - sel.rna.setSequence("A"); + AppVarnaBinding.this.drop(dtde); } }); - - // _seqPanel.setLayout(new BorderLayout()); - // _seqPanel.add(_seqLabel, BorderLayout.WEST); - // _seqPanel.add(_seq, BorderLayout.CENTER); - - _strLabel.setPreferredSize(new Dimension(marginTools, 15)); - _strLabel.setHorizontalTextPosition(JLabel.LEFT); - _str.setFont(textFieldsFont); - _strPanel.setLayout(new BorderLayout()); - _strPanel.add(_strLabel, BorderLayout.WEST); - _strPanel.add(_str, BorderLayout.CENTER); - - _input.setLayout(new GridLayout(1, 0)); - // _input.add(_seqPanel); - _input.add(_strPanel); - - JPanel goPanel = new JPanel(); - goPanel.setLayout(new BorderLayout()); - - _tools.setLayout(new BorderLayout()); - _tools.add(_input, BorderLayout.CENTER); - // _tools.add(_info, BorderLayout.SOUTH); - _tools.add(goPanel, BorderLayout.EAST); - - /* - * _deleteButton.addActionListener(new ActionListener() { public void - * actionPerformed(ActionEvent e) { _rnaList.removeSelected(); } }); - * _duplicateButton.addActionListener(new ActionListener() { public void - * actionPerformed(ActionEvent e) { - * _rnaList.add((VARNAConfig)vp.getConfig(). - * clone(),vp.getRNA().clone(),vp.getRNA - * ().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new - * Date()),true); }}); - */ - goPanel.add(_updateButton, BorderLayout.CENTER); - - JPanel ops = new JPanel(); - ops.setLayout(new GridLayout(1, 2)); - ops.add(_deleteButton); - ops.add(_duplicateButton); - - JLabel j = new JLabel("Structures Manager", JLabel.CENTER); - _listPanel.setLayout(new BorderLayout()); - - //_listPanel.add(ops, BorderLayout.SOUTH); - _listPanel.add(j, BorderLayout.NORTH); - _listPanel.add(listScroller, BorderLayout.CENTER); - - // JSplitPane split = new - // JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp); - /** - * TODO getContentPane().setLayout(new BorderLayout()); - * getContentPane().add(split, BorderLayout.CENTER); - * getContentPane().add(_tools, BorderLayout.NORTH); - */ - - // TODO setVisible(true); - DropTarget dt = new DropTarget(vp, this); - - vp.addVARNAListener(this); - } - - public JPanel getTools() - { - return _tools; } public JPanel getListPanel() @@ -373,13 +167,19 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding } /** - * TODO: Is it effective to transfer the whole RNA? + * Returns the currently selected RNA, or null if none selected * - * @return Currently selected RNA + * @return */ public RNA getSelectedRNA() { - return _rnaList.getElementAt(_sideList.getSelectedIndex()).rna; + int selectedIndex = _sideList.getSelectedIndex(); + if (selectedIndex < 0) + { + return null; + } + FullBackup selected = _rnaList.getElementAt(selectedIndex); + return selected.rna; } /** @@ -393,127 +193,14 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding vp.showRNA(rnaEdit); } - /* - * private void RNAPanelDemoInit() { DefaultListModel dlm = new - * DefaultListModel(); - * - * - * int marginTools = 40; - * - * DefaultListSelectionModel m = new DefaultListSelectionModel(); - * m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); - * m.setLeadAnchorNotificationEnabled(false); - * - * - * _sideList = new ReorderableJList(); _sideList.setModel(dlm); - * _sideList.addMouseListener(this); _sideList.setSelectionModel(m); - * _sideList.setPreferredSize(new Dimension(100, 0)); - * _sideList.addListSelectionListener( new ListSelectionListener(){ public - * void valueChanged(ListSelectionEvent arg0) { //System.out.println(arg0); if - * (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting()) { FullBackup - * sel = (FullBackup) _sideList.getSelectedValue(); Mapping map = - * Mapping.DefaultOutermostMapping(vp.getRNA().getSize(), sel.rna.getSize()); - * vp.showRNAInterpolated(sel.rna,sel.config,map); - * _seq.setText(sel.rna.getSeq()); _str.setText(sel.rna.getStructDBN()); } } - * }); - * - * _rnaList = new BackupHolder(dlm,_sideList); RNA _RNA1 = new - * RNA("User defined 1"); RNA _RNA2 = new RNA("User defined 2"); try { vp = - * new VARNAPanel("0","."); _RNA1.setRNA(DEFAULT_SEQUENCE, - * DEFAULT_STRUCTURE1); _RNA1.drawRNARadiate(vp.getConfig()); - * _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2); - * _RNA2.drawRNARadiate(vp.getConfig()); } catch (ExceptionNonEqualLength e) { - * vp.errorDialog(e); } catch (ExceptionUnmatchedClosingParentheses e2) { - * e2.printStackTrace(); } catch (ExceptionFileFormatOrSyntax e3) { - * e3.printStackTrace(); } vp.setPreferredSize(new Dimension(400, 400)); - * _rnaList.add(vp.getConfig().clone(),_RNA2,generateDefaultName()); - * _rnaList.add(vp.getConfig().clone(),_RNA1,generateDefaultName(),true); - * - * JScrollPane listScroller = new JScrollPane(_sideList); - * listScroller.setPreferredSize(new Dimension(150, 0)); - * - * setBackground(_backgroundColor); vp.setBackground(_backgroundColor); - * - * - * Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12"); - * - * _seqLabel.setHorizontalTextPosition(JLabel.LEFT); - * _seqLabel.setPreferredSize(new Dimension(marginTools, 15)); - * _seq.setFont(textFieldsFont); _seq.setText(DEFAULT_SEQUENCE); - * - * _createButton.addActionListener(new ActionListener() { public void - * actionPerformed(ActionEvent e) { try { RNA nRNA = new - * RNA(generateDefaultName()); nRNA.setRNA(_seq.getText(), _str.getText()); - * nRNA.drawRNARadiate(vp.getConfig()); _rnaList.add(new - * VARNAConfig(),nRNA,true); } catch (ExceptionUnmatchedClosingParentheses e1) - * { JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error", - * JOptionPane.ERROR_MESSAGE); } catch (ExceptionFileFormatOrSyntax e1) { - * JOptionPane.showMessageDialog(vp, e1.getMessage(),"Error", - * JOptionPane.ERROR_MESSAGE); } } }); - * - * - * _seqPanel.setLayout(new BorderLayout()); _seqPanel.add(_seqLabel, - * BorderLayout.WEST); _seqPanel.add(_seq, BorderLayout.CENTER); - * - * _strLabel.setPreferredSize(new Dimension(marginTools, 15)); - * _strLabel.setHorizontalTextPosition(JLabel.LEFT); - * _str.setFont(textFieldsFont); _strPanel.setLayout(new BorderLayout()); - * _strPanel.add(_strLabel, BorderLayout.WEST); _strPanel.add(_str, - * BorderLayout.CENTER); - * - * _input.setLayout(new GridLayout(2, 0)); _input.add(_seqPanel); - * _input.add(_strPanel); - * - * JPanel goPanel = new JPanel(); goPanel.setLayout(new BorderLayout()); - * - * _tools.setLayout(new BorderLayout()); _tools.add(_input, - * BorderLayout.CENTER); _tools.add(_info, BorderLayout.SOUTH); - * _tools.add(goPanel, BorderLayout.EAST); - * - * _deleteButton.addActionListener(new ActionListener() { public void - * actionPerformed(ActionEvent e) { _rnaList.removeSelected(); } }); - * _duplicateButton.addActionListener(new ActionListener() { public void - * actionPerformed(ActionEvent e) { - * _rnaList.add((VARNAConfig)vp.getConfig().clone - * (),vp.getRNA().clone(),vp.getRNA - * ().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new - * Date()),true); }}); - * - * JPanel ops = new JPanel(); ops.setLayout(new GridLayout(1,2)); - * ops.add(_deleteButton); ops.add(_duplicateButton); - * - * JLabel j = new JLabel("Structures Manager",JLabel.CENTER); - * _listPanel.setLayout(new BorderLayout()); - * - * _listPanel.add(ops,BorderLayout.SOUTH); - * _listPanel.add(j,BorderLayout.NORTH); - * _listPanel.add(listScroller,BorderLayout.CENTER); - * - * goPanel.add(_createButton, BorderLayout.CENTER); - * - * JSplitPane split = new - * JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,vp); - * getContentPane().setLayout(new BorderLayout()); getContentPane().add(split, - * BorderLayout.CENTER); getContentPane().add(_tools, BorderLayout.NORTH); - * - * setVisible(true); DropTarget dt = new DropTarget(vp, this); - * - * vp.addVARNAListener(this); } - */ public static String generateDefaultName() { return "User file #" + _nextID++; } - public RNA getRNA() - { - return (RNA) _sideList.getSelectedValue(); - } - public String[][] getParameterInfo() { - String[][] info = - { + String[][] info = { // Parameter Name Kind of Value Description, { "sequenceDBN", "String", "A raw RNA sequence" }, { "structureDBN", "String", @@ -522,12 +209,6 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding return info; } - public void init() - { - vp.setBackground(_backgroundColor); - _error = true; - } - @SuppressWarnings("unused") private Color getSafeColor(String col, Color def) { @@ -558,60 +239,6 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding vp = surface; } - public String get_seq() - { - return _seq.getText(); - } - - public void set_seq(String _seq) - { - this._seq.setText(_seq); - } - - public String get_str() - { - return _str.getText(); - } - - public void set_str(String _str) - { - this._str.setText(_str); - } - - public JLabel get_info() - { - return _info; - } - - public void set_info(JLabel _info) - { - this._info = _info; - } - - /* - * public static void main(String[] args) { AppVarnaBinding d = new - * AppVarnaBinding(); d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); - * d.pack(); d.setVisible(true); } - */ - - public void dragEnter(DropTargetDragEvent arg0) - { - // TODO Auto-generated method stub - - } - - public void dragExit(DropTargetEvent arg0) - { - // TODO Auto-generated method stub - - } - - public void dragOver(DropTargetDragEvent arg0) - { - // TODO Auto-generated method stub - - } - public void drop(DropTargetDropEvent dtde) { try @@ -638,29 +265,33 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding if (c instanceof VARNAPanel) { String path = o.toString(); - VARNAPanel vp = (VARNAPanel) c; + VARNAPanel varnaPanel = (VARNAPanel) c; try { FullBackup bck = VARNAPanel.importSession(path); _rnaList.add(bck.config, bck.rna, bck.name, true); } catch (ExceptionLoadingFailed e3) { - int mn=1; - Collection mdls=fr.orsay.lri.varna.factories.RNAFactory.loadSecStr(path); - for (RNA r:mdls) + int mn = 1; + Collection mdls = fr.orsay.lri.varna.factories.RNAFactory + .loadSecStr(path); + for (RNA r : mdls) { - r.drawRNA(vp.getConfig()); - String name = r.getName(); - if (name.equals("")) - { - name = path.substring(path - .lastIndexOf(File.separatorChar) + 1); - } - if (mdls.size()>1) - { - name += " (Model "+mn+++")"; - } - _rnaList.add(vp.getConfig().clone(), r, name, true); + r.drawRNA(varnaPanel.getConfig()); + String name = r.getName(); + if (name.equals("")) + { + name = path.substring( + path.lastIndexOf(File.separatorChar) + 1); + } + if (mdls.size() > 1) + { + name += " (Model " + mn++ + ")"; + } + _rnaList.add(varnaPanel.getConfig().clone(), r, name, + true); + // BH 2018 SwingJS clone of varnaPanel or its config will + // be the object itself, not a clone } } } @@ -682,263 +313,269 @@ public class AppVarnaBinding extends jalview.ext.varna.JalviewVarnaBinding } - public void dropActionChanged(DropTargetDragEvent arg0) - { - } - private class BackupHolder { - private DefaultListModel _rnaList; + private DefaultListModel _rnalist; - private ArrayList _rnas = new ArrayList(); + private List _rnas = new ArrayList(); JList _l; - public BackupHolder(DefaultListModel rnaList, JList l) + public BackupHolder(DefaultListModel rnaList, JList l) { - _rnaList = rnaList; + _rnalist = rnaList; _l = l; } - public void add(VARNAConfig c, RNA r) - { - add(c, r, r.getName(), false); - } - - public void add(VARNAConfig c, RNA r, boolean select) - { - add(c, r, r.getName(), select); - } - public void add(VARNAConfig c, RNA r, String name) { add(c, r, name, false); } + /** + * Adds an entry to the end of the selection list and (optionally) sets it + * as selected + * + * @param c + * @param r + * @param name + * @param select + */ public void add(VARNAConfig c, RNA r, String name, boolean select) { if (select) { - _l.removeSelectionInterval(0, _rnaList.size()); + _l.removeSelectionInterval(0, _rnalist.size()); } if (name.equals("")) { name = generateDefaultName(); } FullBackup bck = new FullBackup(c, r, name); - _rnas.add(0, r); - _rnaList.add(0, bck); + _rnas.add(r); + _rnalist.addElement(bck); if (select) { _l.setSelectedIndex(0); } } - public void remove(int i) - { - _rnas.remove(i); - _rnaList.remove(i); - - } - - public DefaultListModel getModel() - { - return _rnaList; - } - - public boolean contains(RNA r) - { - return _rnas.contains(r); - } - - /* - * public int getSize() { return _rnaList.getSize(); } - */ public FullBackup getElementAt(int i) { - return (FullBackup) _rnaList.getElementAt(i); - } - - public void removeSelected() - { - int i = _l.getSelectedIndex(); - if (i != -1) - { - if (_rnaList.getSize() == 1) - { - RNA r = new RNA(); - try - { - r.setRNA(" ", "."); - } catch (ExceptionUnmatchedClosingParentheses e1) - { - } catch (ExceptionFileFormatOrSyntax e1) - { - } - vp.showRNA(r); - vp.repaint(); - } - else - { - int newi = i + 1; - if (newi == _rnaList.getSize()) - { - newi = _rnaList.getSize() - 2; - } - FullBackup bck = (FullBackup) _rnaList.getElementAt(newi); - _l.setSelectedValue(bck, true); - } - _rnaList.remove(i); - } - + return _rnalist.getElementAt(i); } } - public void onLayoutChanged() - { - // TODO Auto-generated method stub - - } - - public void onUINewStructure(VARNAConfig v, RNA r) - { - _rnaList.add(v, r, "", true); - } - - public void onWarningEmitted(String s) - { - // TODO Auto-generated method stub - - } - public void mouseClicked(MouseEvent e) { if (e.getClickCount() == 2) { int index = _sideList.locationToIndex(e.getPoint()); - ListModel dlm = _sideList.getModel(); - FullBackup item = (FullBackup) dlm.getElementAt(index); - ; + ListModel dlm = _sideList.getModel(); + // FullBackup item = dlm.getElementAt(index); + _sideList.ensureIndexIsVisible(index); /* - * TODO Object newName = JOptionPane.showInputDialog( this, + * TODO Object newName = JvOptionPane.showInputDialog( this, * "Specify a new name for this RNA", "Rename RNA", - * JOptionPane.QUESTION_MESSAGE, (Icon)null, null, item.toString()); if + * JvOptionPane.QUESTION_MESSAGE, (Icon)null, null, item.toString()); if * (newName!=null) { item.name = newName.toString(); * this._sideList.repaint(); } */ } } - public void mouseEntered(MouseEvent arg0) + @Override + public String[] getStructureFiles() { - // TODO Auto-generated method stub - + return null; } - public void mouseExited(MouseEvent arg0) + @Override + public void releaseReferences(Object svl) { - // TODO Auto-generated method stub - } - public void mousePressed(MouseEvent arg0) + @Override + public void updateColours(Object source) { - // TODO Auto-generated method stub - } - public void mouseReleased(MouseEvent arg0) + @Override + public void componentHidden(ComponentEvent e) { - // TODO Auto-generated method stub - } @Override - public Color getColour(int atomIndex, int pdbResNum, String chain, - String pdbId) + public void componentMoved(ComponentEvent e) { - // TODO Auto-generated method stub - return null; } @Override - public String[] getPdbFile() + public void componentResized(ComponentEvent e) { - // TODO Auto-generated method stub - return null; } @Override - public void highlightAtom(int atomIndex, int pdbResNum, String chain, - String pdbId) + public void componentShown(ComponentEvent e) { - // TODO Auto-generated method stub - } @Override - public void mouseOverStructure(int atomIndex, String strInfo) + public void highlightAtoms(List atoms) { - // TODO Auto-generated method stub - } @Override - public void releaseReferences(Object svl) + public boolean isListeningFor(SequenceI seq) { - // TODO Auto-generated method stub - + return true; } - @Override - public void updateColours(Object source) + /** + * Returns the path to a temporary file containing a representation of the + * state of the Varna display, or null on any error + * + * @param rna + * @param jds + * + * @return + */ + public String getStateInfo(RNA rna) { - // TODO Auto-generated method stub + if (vp == null) + { + return null; + } - } + /* + * we have to show the RNA we want to save in the viewer; get the currently + * displayed model first so we can restore it + */ + FullBackup sel = (FullBackup) _sideList.getSelectedValue(); - @Override - public void componentHidden(ComponentEvent e) - { - // TODO Auto-generated method stub + FullBackup model = null; + ListModel models = _sideList.getModel(); + for (int i = 0; i < models.getSize(); i++) + { + model = (FullBackup) models.getElementAt(i); + if (model.rna == rna) + { + break; + } + } + if (model == null) + { + return null; + } + + /* + * switch display + */ + vp.showRNA(model.rna, model.config); + + try + { + File temp; + temp = File.createTempFile("varna", null); + temp.deleteOnExit(); + String filePath = temp.getAbsolutePath(); + vp.toXML(filePath); + + /* + * restore the previous display + */ + vp.showRNA(sel.rna, sel.config); + return filePath; + } catch (IOException e) + { + return null; + } } - @Override - public void componentMoved(ComponentEvent e) + public int getSelectedIndex() { - // TODO Auto-generated method stub - + return _sideList.getSelectedIndex(); } - @Override - public void componentResized(ComponentEvent e) + /** + * Switch the Varna display to the structure selected in the left hand panel + * + * @param evt + */ + protected void changeSelectedStructure_actionPerformed( + ListSelectionEvent evt) { - // TODO Auto-generated method stub + if (!evt.getValueIsAdjusting()) + { + showSelectedStructure(); + } + } + /** + * + */ + protected void showSelectedStructure() + { + FullBackup sel = (FullBackup) _sideList.getSelectedValue(); + if (sel != null) + { + vp.showRNA(sel.rna, sel.config); + } } - @Override - public void componentShown(ComponentEvent e) + /** + * Set and display the selected item in the list of structures + * + * @param selectedRna + */ + public void setSelectedIndex(final int selectedRna) { - // TODO Auto-generated method stub + /* + * note this does nothing if, say, selecting item 3 when only 1 has been + * added on load + */ + _sideList.setSelectedIndex(selectedRna); + // TODO ? need a worker thread to get this to happen properly + } + /** + * Add an RNA structure to the selection list + * + * @param rna + */ + public void addStructure(RNA rna) + { + VARNAConfig config = vp.getConfig().clone(); // BH 2018 this will NOT be a + // clone in SwingJS + addStructure(rna, config); } - @Override - public void onStructureRedrawn() + /** + * @param rna + * @param config + */ + protected void addStructure(final RNA rna, final VARNAConfig config) { - // TODO Auto-generated method stub + drawRna(rna, config); + _rnaList.add(config, rna, rna.getName()); + } + /** + * @param rna + * @param config + */ + protected void drawRna(final RNA rna, final VARNAConfig config) + { + try + { + rna.drawRNA(rna.getDrawMode(), config); + } catch (ExceptionNAViewAlgorithm e) + { + // only throwable for draw mode = 3 NAView + jalview.bin.Console + .errPrintln("Error drawing RNA: " + e.getMessage()); + } } } - -/* - * public static void main(String[] args) { JTextField str = new - * JTextField("ATGC"); - * - * AppVarnaBinding vab = new AppVarnaBinding(); vab.varnagui.set_seq(str); - * vab.varnagui.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); - * vab.varnagui.pack(); vab.varnagui.setVisible(true); } } - */ \ No newline at end of file