X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=src2%2Ffr%2Forsay%2Flri%2Fvarna%2Fapplications%2FSuperpositionDemo.java;fp=src2%2Ffr%2Forsay%2Flri%2Fvarna%2Fapplications%2FSuperpositionDemo.java;h=edef438dff8ec97de72796190a862eadd80914c4;hb=665d2c2f4c1310e6985b93b7c2c8a8eec2fa9086;hp=0000000000000000000000000000000000000000;hpb=0e684f72690bd6532272a39ab6c188a27559fd09;p=jalview.git

diff --git a/src2/fr/orsay/lri/varna/applications/SuperpositionDemo.java b/src2/fr/orsay/lri/varna/applications/SuperpositionDemo.java
new file mode 100644
index 0000000..edef438
--- /dev/null
+++ b/src2/fr/orsay/lri/varna/applications/SuperpositionDemo.java
@@ -0,0 +1,467 @@
+/*
+ VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
+ Copyright (C) 2008  Kevin Darty, Alain Denise and Yann Ponty.
+ electronic mail : Yann.Ponty@lri.fr
+ paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
+
+ This file is part of VARNA version 3.1.
+ VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
+ as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+
+ VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
+ without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+ See the GNU General Public License for more details.
+
+ You should have received a copy of the GNU General Public License along with VARNA version 3.1.
+ If not, see http://www.gnu.org/licenses.
+ */
+package fr.orsay.lri.varna.applications;
+
+import java.awt.BorderLayout;
+import java.awt.Color;
+import java.awt.Dimension;
+import java.awt.Font;
+import java.awt.GridLayout;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+
+import javax.swing.JButton;
+import javax.swing.JFrame;
+import javax.swing.JLabel;
+import javax.swing.JPanel;
+import javax.swing.JTextField;
+
+import fr.orsay.lri.varna.VARNAPanel;
+import fr.orsay.lri.varna.controlers.ControleurInterpolator;
+import fr.orsay.lri.varna.exceptions.ExceptionDrawingAlgorithm;
+import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
+import fr.orsay.lri.varna.exceptions.ExceptionModeleStyleBaseSyntaxError;
+import fr.orsay.lri.varna.exceptions.ExceptionNAViewAlgorithm;
+import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
+import fr.orsay.lri.varna.exceptions.ExceptionParameterError;
+import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
+import fr.orsay.lri.varna.exceptions.MappingException;
+import fr.orsay.lri.varna.models.VARNAConfig;
+import fr.orsay.lri.varna.models.rna.Mapping;
+import fr.orsay.lri.varna.models.rna.ModeleBase;
+import fr.orsay.lri.varna.models.rna.ModelBaseStyle;
+import fr.orsay.lri.varna.models.rna.RNA;
+
+import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;;
+
+public class SuperpositionDemo extends JFrame implements InterfaceVARNAListener {
+
+	/**
+	 * 
+	 */
+	private static final long serialVersionUID = -790155708306987257L;
+
+	private static final String DEFAULT_SEQUENCE1 = "CGCGCACGCGAUAUUUCGCGUCGCGCAUUUGCGCGUAGCGCG";
+	private static final String DEFAULT_SEQUENCE2 = "CGCGCACGCGAUAUUUCGCGUCGCGCAUUUGCGCGUAGCGCG";
+
+	private static final String DEFAULT_STRUCTURE1 = "(((((.(((((----....----))))).(((((....)))))..)))))";
+	private static final String DEFAULT_STRUCTURE2 = "(((((.(((((((((....))))))))).--------------..)))))";
+	// private static final String DEFAULT_STRUCTURE1 = "((((....))))";
+	// private static final String DEFAULT_STRUCTURE2 =
+	// "((((..(((....)))..))))";
+
+	private VARNAPanel _vpMaster;
+	private VARNAPanel _vpSlave;
+
+	private JPanel _tools = new JPanel();
+	private JPanel _input = new JPanel();
+
+	private JPanel _seqPanel = new JPanel();
+	private JPanel _struct1Panel = new JPanel();
+	private JPanel _struct2Panel = new JPanel();
+	private JLabel _info = new JLabel();
+	private JTextField _struct1 = new JTextField(DEFAULT_STRUCTURE1);
+	private JTextField _struct2 = new JTextField(DEFAULT_STRUCTURE2);
+	private JTextField _seq1 = new JTextField(DEFAULT_SEQUENCE1);
+	private JTextField _seq2 = new JTextField(DEFAULT_SEQUENCE2);
+	private JLabel _struct1Label = new JLabel(" Str1:");
+	private JLabel _struct2Label = new JLabel(" Str2:");
+	private JLabel _seqLabel = new JLabel(" Seq:");
+	private JButton _goButton = new JButton("Go");
+	private JButton _switchButton = new JButton("Switch");
+
+	private String _str1Backup = "";
+	private String _str2Backup = "";
+	private RNA _RNA1 = new RNA();
+	private RNA _RNA2 = new RNA();
+
+	private static String errorOpt = "error";
+	@SuppressWarnings("unused")
+	private boolean _error;
+
+	private Color _backgroundColor = Color.white;
+
+	@SuppressWarnings("unused")
+	private int _algoCode;
+
+	private int _currentDisplay = 1;
+
+	public static ModelBaseStyle createStyle(String txt) 
+	{
+		ModelBaseStyle result = new ModelBaseStyle();
+		try {
+			result.assignParameters(txt);
+		} catch (ExceptionModeleStyleBaseSyntaxError e) {
+			// TODO Auto-generated catch block
+			e.printStackTrace();
+		} catch (ExceptionParameterError e) {
+			// TODO Auto-generated catch block
+			e.printStackTrace();
+		}
+		return result;
+	}
+	
+	public void applyTo(VARNAPanel vp, ModelBaseStyle mb, int[] indices)
+	{
+		for(int i=0;i<indices.length;i++)
+		{ 
+			ModeleBase m = vp.getRNA().getBaseAt(indices[i]);
+			m.setStyleBase(mb);
+			if (m.getElementStructure()!=-1)
+			{
+				vp.getRNA().getBaseAt(m.getElementStructure()).setStyleBase(mb);
+			}
+		}
+		vp.repaint();
+	}
+	
+	
+	public SuperpositionDemo() {
+		super();
+		try {
+			_vpMaster = new VARNAPanel(getText1(), getStruct1());
+			_vpSlave = new VARNAPanel(getText2(), getStruct2());
+		} catch (ExceptionNonEqualLength e) {
+			_vpMaster.errorDialog(e);
+		}
+		_vpMaster.setPreferredSize(new Dimension(400, 400));
+		RNAPanelDemoInit();
+	}
+
+	private void RNAPanelDemoInit() {
+		int marginTools = 40;
+
+		setBackground(_backgroundColor);
+		_vpMaster.setBackground(_backgroundColor);
+		_vpMaster.addVARNAListener(this);
+		//_vpSlave.setModifiable(false);
+		_vpSlave.setBackground(Color.decode("#F0F0F0"));
+
+		_vpMaster.drawRNA(getRNA((_currentDisplay)%2));
+		_vpSlave.drawRNA(getRNA((_currentDisplay+1)%2));
+
+		/*ModeleStyleBase red = createStyle("label=#ff4d4d,fill=#ffdddd,outline=#ff4d4d");
+		int[] ired = {6,7,8,9,10};
+		applyTo(_vpMaster, red, ired);
+		applyTo(_vpSlave, red, ired);
+		ModeleStyleBase blue = createStyle("label=#0000ff,fill=#ddddff,outline=#0000ff");
+		int[] iblue = {0,1,2,3,4};
+		applyTo(_vpMaster, blue, iblue);
+		applyTo(_vpSlave, blue, iblue);
+		ModeleStyleBase purple = createStyle("label=#cc00cc,fill=#ffddff,outline=#cc00cc");
+		int[] ipurple = {21,22,23,24,25};
+		applyTo(_vpMaster, purple, ipurple);
+		ModeleStyleBase green = createStyle("label=#009900,fill=#aaeeaa,outline=#009900");
+		int[] igreen = {11,12,13,14};
+		applyTo(_vpSlave, green, igreen);*/
+		
+		Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12");
+
+		_seqLabel.setHorizontalTextPosition(JLabel.LEFT);
+		_seqLabel.setPreferredSize(new Dimension(marginTools, 15));
+		_seq1.setFont(textFieldsFont);
+		_seq1.setText(getRNA1().getSeq());
+		_seq2.setFont(textFieldsFont);
+		_seq2.setText(getRNA2().getSeq());
+
+		_goButton.addActionListener(new ActionListener() {
+
+			public void actionPerformed(ActionEvent e) {
+				_currentDisplay = (_currentDisplay + 1) % 2;
+				_vpMaster.drawRNA(getRNA(_currentDisplay));
+				_vpSlave.drawRNA(getRNA((_currentDisplay + 1) % 2));
+				onStructureRedrawn();
+			}
+		});
+
+		_switchButton.addActionListener(new ActionListener() {
+			public void actionPerformed(ActionEvent e) {
+				try {
+					_currentDisplay = (_currentDisplay + 1) % 2;
+
+							Mapping m = Mapping.readMappingFromAlignment(
+									getStruct(_currentDisplay), getStruct((_currentDisplay+1)%2));
+							Mapping m2 = Mapping.readMappingFromAlignment(
+									getStruct((_currentDisplay+1)%2), getStruct(_currentDisplay));
+							_vpMaster.showRNAInterpolated(getRNA(_currentDisplay), m);
+							_vpSlave.showRNAInterpolated(getRNA((_currentDisplay+1)%2), m2);
+							onStructureRedrawn();
+					} 
+				catch (MappingException e3) 
+				{
+							try {
+								_vpMaster.drawRNAInterpolated(getText(_currentDisplay),getStruct(_currentDisplay));
+							} catch (ExceptionNonEqualLength e1) {
+								// TODO Auto-generated catch block
+								e1.printStackTrace();
+							}
+						}
+				_vpMaster.repaint();
+				_vpSlave.repaint();
+			}
+		});
+
+		_seqPanel.setLayout(new BorderLayout());
+		_seqPanel.add(_seqLabel, BorderLayout.WEST);
+		_seqPanel.add(_seq1, BorderLayout.CENTER);
+
+		_struct1Label.setPreferredSize(new Dimension(marginTools, 15));
+		_struct1Label.setHorizontalTextPosition(JLabel.LEFT);
+		_struct1.setFont(textFieldsFont);
+		_struct1Panel.setLayout(new BorderLayout());
+		_struct1Panel.add(_struct1Label, BorderLayout.WEST);
+		_struct1Panel.add(_struct1, BorderLayout.CENTER);
+
+		_struct2Label.setPreferredSize(new Dimension(marginTools, 15));
+		_struct2Label.setHorizontalTextPosition(JLabel.LEFT);
+		_struct2.setFont(textFieldsFont);
+		_struct2Panel.setLayout(new BorderLayout());
+		_struct2Panel.add(_struct2Label, BorderLayout.WEST);
+		_struct2Panel.add(_struct2, BorderLayout.CENTER);
+
+		_input.setLayout(new GridLayout(3, 0));
+		_input.add(_seqPanel);
+		_input.add(_struct1Panel);
+		_input.add(_struct2Panel);
+
+		JPanel goPanel = new JPanel();
+		goPanel.setLayout(new BorderLayout());
+
+		_tools.setLayout(new BorderLayout());
+		_tools.add(_input, BorderLayout.CENTER);
+		_tools.add(_info, BorderLayout.SOUTH);
+		_tools.add(goPanel, BorderLayout.EAST);
+
+		goPanel.add(_goButton, BorderLayout.CENTER);
+		goPanel.add(_switchButton, BorderLayout.SOUTH);
+
+		getContentPane().setLayout(new BorderLayout());
+		JPanel VARNAs = new JPanel();
+		VARNAs.setLayout(new GridLayout(1,2));
+		VARNAs.add(_vpMaster);
+		VARNAs.add(_vpSlave);
+		getContentPane().add(VARNAs, BorderLayout.CENTER);
+		getContentPane().add(_tools, BorderLayout.SOUTH);
+
+		setVisible(true);
+
+		_vpMaster.getVARNAUI().UIRadiate();
+		_vpSlave.getVARNAUI().UIRadiate();		
+		
+		onStructureRedrawn();
+	}
+
+	public RNA getMasterRNA()
+	{
+		return getRNA(_currentDisplay);
+	}
+
+	public RNA getSlaveRNA1()
+	{
+		return getRNA((_currentDisplay+1)%2);
+	}
+
+	public RNA getSlaveRNA2()
+	{
+		return getRNA((_currentDisplay+2)%2);
+	}
+
+	
+	public RNA getRNA(int i) {
+	  if (i==0)
+	  {  return getRNA1();  }
+	  else 
+	  {  return getRNA2();  }
+	}
+
+	
+	public RNA getRNA1() {
+		if (!_str1Backup.equals(getStruct1())) {
+			try {
+				_RNA1.setRNA(getText1(), getStruct1());
+				_RNA1.drawRNA(_vpMaster.getDrawMode(),_vpMaster.getConfig());
+			} catch (ExceptionUnmatchedClosingParentheses e) {
+				e.printStackTrace();
+			} catch (ExceptionFileFormatOrSyntax e1) {
+				_vpMaster.errorDialog(e1);
+			} catch (ExceptionDrawingAlgorithm e) {
+				// TODO Auto-generated catch block
+				e.printStackTrace();
+			}
+			_str1Backup = getStruct1();
+		}
+		return _RNA1;
+	}
+
+	public RNA getRNA2() {
+		if (!_str2Backup.equals(getStruct2())) {
+			try {
+				_RNA2.setRNA(getText2(), getStruct2());
+				_RNA2.drawRNA(_vpMaster.getDrawMode(),_vpMaster.getConfig());
+			} catch (ExceptionUnmatchedClosingParentheses e) {
+				e.printStackTrace();
+			} catch (ExceptionFileFormatOrSyntax e1) {
+				_vpMaster.errorDialog(e1);
+			} catch (ExceptionDrawingAlgorithm e) {
+				// TODO Auto-generated catch block
+				e.printStackTrace();
+			}
+			_str2Backup = getStruct2();
+		}
+		return _RNA2;
+	}
+
+    public String getText(int i)
+    {
+    	return "";
+    }
+
+    public String getStruct(int i)
+    {
+    	if (i==0) 
+    		return _struct1.getText();
+    	else
+    		return _struct2.getText();
+    }
+
+    
+	public String getText1()
+	{
+		return _seq1.getText();
+	}
+
+	public String getText2()
+	{
+		return _seq2.getText();
+	}
+
+	public String getStruct1() {
+		return cleanStruct(_struct1.getText());
+	}
+
+	public String getStruct2() {
+		return cleanStruct(_struct2.getText());
+	}
+
+	private String cleanStruct(String struct) {
+		struct = struct.replaceAll("[:-]", "");
+		return struct;
+	}
+
+	public String[][] getParameterInfo() {
+		String[][] info = {
+				// Parameter Name Kind of Value Description,
+				{ "sequenceDBN", "String", "A raw RNA sequence" },
+				{ "structureDBN", "String",
+						"An RNA structure in dot bracket notation (DBN)" },
+				{ errorOpt, "boolean", "To show errors" }, };
+		return info;
+	}
+
+	public void init() {
+		_vpMaster.setBackground(_backgroundColor);
+		_error = true;
+	}
+
+	@SuppressWarnings("unused")
+	private Color getSafeColor(String col, Color def) {
+		Color result;
+		try {
+			result = Color.decode(col);
+		} catch (Exception e) {
+			try {
+				result = Color.getColor(col, def);
+			} catch (Exception e2) {
+				return def;
+			}
+		}
+		return result;
+	}
+
+	public VARNAPanel get_varnaPanel() {
+		return _vpMaster;
+	}
+
+	public void set_varnaPanel(VARNAPanel surface) {
+		_vpMaster = surface;
+	}
+
+	public JTextField get_struct() {
+		return _struct1;
+	}
+
+	public void set_struct(JTextField _struct) {
+		this._struct1 = _struct;
+	}
+
+	public JLabel get_info() {
+		return _info;
+	}
+
+	public void set_info(JLabel _info) {
+		this._info = _info;
+	}
+
+	public static void main(String[] args) {
+		SuperpositionDemo d = new SuperpositionDemo();
+		d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
+		d.pack();
+		d.setVisible(true);
+	}
+
+	public void onStructureRedrawn() {
+		try{
+					Mapping m = Mapping.readMappingFromAlignment(
+							this.getStruct((_currentDisplay+1)%2), getStruct((_currentDisplay)%2));
+					ControleurInterpolator.moveNearOtherRNA(getRNA((_currentDisplay)%2), getRNA((_currentDisplay+1)%2), m);
+					_vpSlave.repaint();
+					_vpMaster.repaint();
+		}
+		catch (MappingException e3) {System.out.println(e3.toString());}
+	}
+
+	public void onWarningEmitted(String s) {
+		// TODO Auto-generated method stub
+		
+	}
+
+	public void onLoad(String path) {
+		// TODO Auto-generated method stub
+		
+	}
+
+	public void onLoaded() {
+		// TODO Auto-generated method stub
+		
+	}
+
+	public void onUINewStructure(VARNAConfig v, RNA r) {
+		// TODO Auto-generated method stub
+		
+	}
+
+	public void onZoomLevelChanged(){
+		// TODO Auto-generated method stub
+		
+	}
+
+	public void onTranslationChanged() {
+		// TODO Auto-generated method stub
+		
+	}
+}