X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=src2%2Ffr%2Forsay%2Flri%2Fvarna%2Fapplications%2FVARNAEditor.java;fp=src2%2Ffr%2Forsay%2Flri%2Fvarna%2Fapplications%2FVARNAEditor.java;h=818cfda56dd0b9221e4c83e4d964f61398aa8c9a;hb=665d2c2f4c1310e6985b93b7c2c8a8eec2fa9086;hp=0000000000000000000000000000000000000000;hpb=0e684f72690bd6532272a39ab6c188a27559fd09;p=jalview.git diff --git a/src2/fr/orsay/lri/varna/applications/VARNAEditor.java b/src2/fr/orsay/lri/varna/applications/VARNAEditor.java new file mode 100644 index 0000000..818cfda --- /dev/null +++ b/src2/fr/orsay/lri/varna/applications/VARNAEditor.java @@ -0,0 +1,659 @@ +/* + VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases. + Copyright (C) 2008 Kevin Darty, Alain Denise and Yann Ponty. + electronic mail : Yann.Ponty@lri.fr + paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France + + This file is part of VARNA version 3.1. + VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License + as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. + + VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; + without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + See the GNU General Public License for more details. + + You should have received a copy of the GNU General Public License along with VARNA version 3.1. + If not, see http://www.gnu.org/licenses. + */ +package fr.orsay.lri.varna.applications; + +import java.awt.BorderLayout; +import java.awt.Color; +import java.awt.Component; +import java.awt.Dimension; +import java.awt.Font; +import java.awt.GridLayout; +import java.awt.datatransfer.DataFlavor; +import java.awt.datatransfer.Transferable; +import java.awt.dnd.DnDConstants; +import java.awt.dnd.DropTarget; +import java.awt.dnd.DropTargetDragEvent; +import java.awt.dnd.DropTargetDropEvent; +import java.awt.dnd.DropTargetEvent; +import java.awt.dnd.DropTargetListener; +import java.awt.event.ActionEvent; +import java.awt.event.ActionListener; +import java.awt.event.MouseEvent; +import java.awt.event.MouseListener; +import java.awt.geom.Point2D.Double; +import java.io.File; +import java.text.DateFormat; +import java.util.ArrayList; +import java.util.Collection; +import java.util.Date; +import java.util.Hashtable; +import java.util.List; +import java.util.Set; + +import javax.swing.DefaultListModel; +import javax.swing.DefaultListSelectionModel; +import javax.swing.Icon; +import javax.swing.JButton; +import javax.swing.JFrame; +import javax.swing.JLabel; +import javax.swing.JList; +import javax.swing.JOptionPane; +import javax.swing.JPanel; +import javax.swing.JScrollPane; +import javax.swing.JSplitPane; +import javax.swing.JTextField; +import javax.swing.ListModel; +import javax.swing.ListSelectionModel; +import javax.swing.UIManager; +import javax.swing.UnsupportedLookAndFeelException; +import javax.swing.event.ListSelectionEvent; +import javax.swing.event.ListSelectionListener; +import javax.swing.text.BadLocationException; +import javax.swing.text.DefaultHighlighter; + +import fr.orsay.lri.varna.VARNAPanel; +import fr.orsay.lri.varna.components.ReorderableJList; +import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax; +import fr.orsay.lri.varna.exceptions.ExceptionLoadingFailed; +import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength; +import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses; +import fr.orsay.lri.varna.factories.RNAFactory; +import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener; +import fr.orsay.lri.varna.interfaces.InterfaceVARNARNAListener; +import fr.orsay.lri.varna.interfaces.InterfaceVARNASelectionListener; +import fr.orsay.lri.varna.models.BaseList; +import fr.orsay.lri.varna.models.FullBackup; +import fr.orsay.lri.varna.models.VARNAConfig; +import fr.orsay.lri.varna.models.rna.Mapping; +import fr.orsay.lri.varna.models.rna.ModeleBP; +import fr.orsay.lri.varna.models.rna.ModeleBase; +import fr.orsay.lri.varna.models.rna.RNA; + +public class VARNAEditor extends JFrame implements DropTargetListener, InterfaceVARNAListener, MouseListener { + + /** + * + */ +// private static final_long serialVersionUID = -790155708306987257L; + + private static final String DEFAULT_SEQUENCE = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIA"; + + private static final String DEFAULT_STRUCTURE1 = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...))))).."; + private static final String DEFAULT_STRUCTURE2 = "..(((((...(((((...(((((........(((((...(((((.....)))))...)))))..................))))).....)))))...))))).."; + // private static final String DEFAULT_STRUCTURE1 = "((((....))))"; + // private static final String DEFAULT_STRUCTURE2 = + // "((((..(((....)))..))))"; + + private VARNAPanel _vp; + + private JPanel _tools = new JPanel(); + private JPanel _input = new JPanel(); + + private JPanel _seqPanel = new JPanel(); + private JPanel _strPanel = new JPanel(); + private JLabel _info = new JLabel(); + + private JTextField _str = new JTextField(DEFAULT_STRUCTURE1); + Object _hoverHighlightStr = null; + ArrayList _selectionHighlightStr = new ArrayList(); + + private JTextField _seq = new JTextField(DEFAULT_SEQUENCE); + Object _hoverHighlightSeq = null; + ArrayList _selectionHighlightSeq = new ArrayList(); + + + private JLabel _strLabel = new JLabel(" Str:"); + private JLabel _seqLabel = new JLabel(" Seq:"); + private JButton _deleteButton = new JButton("Delete"); + private JButton _duplicateButton = new JButton("Duplicate"); + + private JPanel _listPanel = new JPanel(); + private ReorderableJList _sideList = null; + + + + private static String errorOpt = "error"; + @SuppressWarnings("unused") + private boolean _error; + + private Color _backgroundColor = Color.white; + + private static int _nextID = 1; + @SuppressWarnings("unused") + private int _algoCode; + + private BackupHolder _rnaList; + + + public VARNAEditor() { + super("VARNA Editor"); + RNAPanelDemoInit(); + } + + private void RNAPanelDemoInit() + { + DefaultListModel dlm = new DefaultListModel(); + + + int marginTools = 40; + + DefaultListSelectionModel m = new DefaultListSelectionModel(); + m.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); + m.setLeadAnchorNotificationEnabled(false); + + + _sideList = new ReorderableJList(); + _sideList.setModel(dlm); + _sideList.addMouseListener(this); + _sideList.setSelectionModel(m); + _sideList.setPreferredSize(new Dimension(100, 0)); + _sideList.addListSelectionListener( new ListSelectionListener(){ + public void valueChanged(ListSelectionEvent arg0) { + //System.out.println(arg0); + if (!_sideList.isSelectionEmpty() && !arg0.getValueIsAdjusting()) + { + FullBackup sel = (FullBackup) _sideList.getSelectedValue(); + Mapping map = Mapping.DefaultOutermostMapping(_vp.getRNA().getSize(), sel.rna.getSize()); + _vp.showRNAInterpolated(sel.rna,sel.config,map); + _seq.setText(sel.rna.getSeq()); + _str.setText(sel.rna.getStructDBN(true)); + } + } + }); + + _rnaList = new BackupHolder(dlm,_sideList); + RNA _RNA1 = new RNA("User defined 1"); + RNA _RNA2 = new RNA("User defined 2"); + try { + _vp = new VARNAPanel("0","."); + _RNA1.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE1); + _RNA1.drawRNARadiate(_vp.getConfig()); + _RNA2.setRNA(DEFAULT_SEQUENCE, DEFAULT_STRUCTURE2); + _RNA2.drawRNARadiate(_vp.getConfig()); + } catch (ExceptionNonEqualLength e) { + _vp.errorDialog(e); + } catch (ExceptionUnmatchedClosingParentheses e2) { + e2.printStackTrace(); + } catch (ExceptionFileFormatOrSyntax e3) { + e3.printStackTrace(); + } + _vp.setPreferredSize(new Dimension(400, 400)); + // + + // BH 2018 this will NOT be a clone in SwingJS + _rnaList.add(_vp.getConfig().clone(),_RNA2,generateDefaultName()); + _rnaList.add(_vp.getConfig().clone(),_RNA1,generateDefaultName(),true); + + JScrollPane listScroller = new JScrollPane(_sideList); + listScroller.setPreferredSize(new Dimension(150, 0)); + + setBackground(_backgroundColor); + _vp.setBackground(_backgroundColor); + + + Font textFieldsFont = Font.decode("MonoSpaced-PLAIN-12"); + + _seqLabel.setHorizontalTextPosition(JLabel.LEFT); + _seqLabel.setPreferredSize(new Dimension(marginTools, 15)); + _seq.setFont(textFieldsFont); + _seq.setText(DEFAULT_SEQUENCE); + _seq.setEditable(false); + + + _seqPanel.setLayout(new BorderLayout()); + _seqPanel.add(_seqLabel, BorderLayout.WEST); + _seqPanel.add(_seq, BorderLayout.CENTER); + + _strLabel.setPreferredSize(new Dimension(marginTools, 15)); + _strLabel.setHorizontalTextPosition(JLabel.LEFT); + _str.setFont(textFieldsFont); + _str.setEditable(false); + _strPanel.setLayout(new BorderLayout()); + _strPanel.add(_strLabel, BorderLayout.WEST); + _strPanel.add(_str, BorderLayout.CENTER); + + _input.setLayout(new GridLayout(2, 0)); + _input.add(_seqPanel); + _input.add(_strPanel); + + + _tools.setLayout(new BorderLayout()); + _tools.add(_input, BorderLayout.CENTER); + _tools.add(_info, BorderLayout.SOUTH); + + _deleteButton.addActionListener(new ActionListener() { + public void actionPerformed(ActionEvent e) { + _rnaList.removeSelected(); + } + }); +// _duplicateButton.addActionListener(new ActionListener() { +// public void actionPerformed(ActionEvent e) { +// _rnaList.add((VARNAConfig)_vp.getConfig().clone(),_vp.getRNA().clone(),_vp.getRNA().getName()+"-"+DateFormat.getTimeInstance(DateFormat.LONG).format(new Date()),true); +// }}); + + JPanel ops = new JPanel(); + ops.setLayout(new GridLayout(1,2)); + ops.add(_deleteButton); + ops.add(_duplicateButton); + + JLabel j = new JLabel("Structures",JLabel.CENTER); + _listPanel.setLayout(new BorderLayout()); + + _listPanel.add(ops,BorderLayout.SOUTH); + _listPanel.add(j,BorderLayout.NORTH); + _listPanel.add(listScroller,BorderLayout.CENTER); + + + JSplitPane split = new JSplitPane(JSplitPane.HORIZONTAL_SPLIT,true,_listPanel,_vp); + getContentPane().setLayout(new BorderLayout()); + getContentPane().add(split, BorderLayout.CENTER); + getContentPane().add(_tools, BorderLayout.NORTH); + + setVisible(true); + DropTarget dt = new DropTarget(_vp, this); + + _vp.addRNAListener(new InterfaceVARNARNAListener(){ + public void onSequenceModified(int index, String oldseq, String newseq) { + _seq.setText(_vp.getRNA().getSeq()); + } + + public void onStructureModified(Set current, + Set addedBasePairs, Set removedBasePairs) { + _str.setText(_vp.getRNA().getStructDBN(true)); + } + + public void onRNALayoutChanged(Hashtable previousPositions) { + } + + }); + + _vp.addSelectionListener(new InterfaceVARNASelectionListener(){ + + public void onHoverChanged(ModeleBase oldbase, ModeleBase newBase) { + if (_hoverHighlightSeq!=null) + { + _seq.getHighlighter().removeHighlight(_hoverHighlightSeq); + _hoverHighlightSeq = null; + } + if (_hoverHighlightStr!=null) + { + _str.getHighlighter().removeHighlight(_hoverHighlightStr); + _hoverHighlightStr = null; + } + if (newBase!=null) + { + try { + _hoverHighlightSeq = _seq.getHighlighter().addHighlight(newBase.getIndex(), newBase.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) ); + _hoverHighlightStr = _str.getHighlighter().addHighlight(newBase.getIndex(), newBase.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.green) ); + } catch (BadLocationException e) { + e.printStackTrace(); + } + } + } + + public void onSelectionChanged(BaseList selection, + BaseList addedBases, BaseList removedBases) { + for(Object tag: _selectionHighlightSeq) + { + _seq.getHighlighter().removeHighlight(tag); + } + _selectionHighlightSeq.clear(); + for(Object tag: _selectionHighlightStr) + { + _str.getHighlighter().removeHighlight(tag); + } + _selectionHighlightStr.clear(); + for (ModeleBase m: selection.getBases()) + { + try { + _selectionHighlightSeq.add(_seq.getHighlighter().addHighlight(m.getIndex(), m.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) )); + _selectionHighlightStr.add(_str.getHighlighter().addHighlight(m.getIndex(), m.getIndex()+1, new DefaultHighlighter.DefaultHighlightPainter(Color.orange) )); + } catch (BadLocationException e) { + e.printStackTrace(); + } + } + } + + }); + + _vp.addVARNAListener(this); + } + + public static String generateDefaultName() + { + return "User file #"+_nextID++; + } + + public RNA getRNA() { + return (RNA)_sideList.getSelectedValue(); + } + + + + public String[][] getParameterInfo() { + String[][] info = { + // Parameter Name Kind of Value Description, + { "sequenceDBN", "String", "A raw RNA sequence" }, + { "structureDBN", "String", + "An RNA structure in dot bracket notation (DBN)" }, + { errorOpt, "boolean", "To show errors" }, }; + return info; + } + + public void init() { + _vp.setBackground(_backgroundColor); + _error = true; + } + + @SuppressWarnings("unused") + private Color getSafeColor(String col, Color def) { + Color result; + try { + result = Color.decode(col); + } catch (Exception e) { + try { + result = Color.getColor(col, def); + } catch (Exception e2) { + return def; + } + } + return result; + } + + public VARNAPanel get_varnaPanel() { + return _vp; + } + + public void set_varnaPanel(VARNAPanel surface) { + _vp = surface; + } + + + public JTextField get_seq() { + return _seq; + } + + public void set_seq(JTextField _seq) { + this._seq = _seq; + } + + public JLabel get_info() { + return _info; + } + + public void set_info(JLabel _info) { + this._info = _info; + } + + public static void main(String[] args) { + VARNAEditor d = new VARNAEditor(); + d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); + d.pack(); + d.setVisible(true); + } + + + public void dragEnter(DropTargetDragEvent arg0) { + // TODO Auto-generated method stub + + } + + public void dragExit(DropTargetEvent arg0) { + // TODO Auto-generated method stub + + } + + public void dragOver(DropTargetDragEvent arg0) { + // TODO Auto-generated method stub + + } + + public void drop(DropTargetDropEvent dtde) { + try { + Transferable tr = dtde.getTransferable(); + DataFlavor[] flavors = tr.getTransferDataFlavors(); + for (int i = 0; i < flavors.length; i++) { + if (flavors[i].isFlavorJavaFileListType()) { + dtde.acceptDrop(DnDConstants.ACTION_COPY_OR_MOVE); + Object ob = tr.getTransferData(flavors[i]); + if (ob instanceof List) + { + List list = (List) ob; + for (int j = 0; j < list.size(); j++) { + Object o = list.get(j); + + if (dtde.getSource() instanceof DropTarget) + { + DropTarget dt = (DropTarget) dtde.getSource(); + Component c = dt.getComponent(); + if (c instanceof VARNAPanel) + { + String path = o.toString(); + VARNAPanel vp = (VARNAPanel) c; + try{ + FullBackup bck = VARNAPanel.importSession((File) o); // BH SwingJS + _rnaList.add(bck.config, bck.rna,bck.name,true); + } + catch (ExceptionLoadingFailed e3) + { + Collection rnas = RNAFactory.loadSecStr((File) o); // BH SwingJS + if (rnas.isEmpty()) + { + throw new ExceptionFileFormatOrSyntax("No RNA could be parsed from that source."); + } + + int id = 1; + for(RNA r: rnas) + { + r.drawRNA(vp.getConfig()); + String name = r.getName(); + if (name.equals("")) + { + name = path.substring(path.lastIndexOf(File.separatorChar)+1); + } + if (rnas.size()>1) + { + name += " - Molecule# "+id++; + } + _rnaList.add(vp.getConfig().clone(),r,name,true); + } + } + } + } + } + } + // If we made it this far, everything worked. + dtde.dropComplete(true); + return; + } + } + // Hmm, the user must not have dropped a file list + dtde.rejectDrop(); + } catch (Exception e) { + e.printStackTrace(); + dtde.rejectDrop(); + } + + } + + public void dropActionChanged(DropTargetDragEvent arg0) { + } + + private class BackupHolder{ + private DefaultListModel _rnaList; + private ArrayList _rnas = new ArrayList(); + JList _l; + + public BackupHolder(DefaultListModel rnaList, JList l) + { + _rnaList = rnaList; + _l = l; + } + + public void add(VARNAConfig c, RNA r) + { + add(c, r, r.getName(),false); + } + + public void add(VARNAConfig c, RNA r,boolean select) + { + add(c, r, r.getName(),select); + } + + public void add(VARNAConfig c, RNA r, String name) + { + add(c, r, name,false); + } + public void add(VARNAConfig c, RNA r, String name, boolean select) + { + if (select){ + _l.removeSelectionInterval(0, _rnaList.size()); + } + if (name.equals("")) + { + name = generateDefaultName(); + } + FullBackup bck = new FullBackup(c,r,name); + _rnas.add(0, r); + _rnaList.add(0,bck); + if (select){ + _l.setSelectedIndex(0); + } + } + + public void remove(int i) + { + _rnas.remove(i); + _rnaList.remove(i); + + } + public DefaultListModel getModel() + { + return _rnaList; + } + public boolean contains(RNA r) + { + return _rnas.contains(r); + } + /*public int getSize() + { + return _rnaList.getSize(); + }*/ + public FullBackup getElementAt(int i) + { + return (FullBackup) _rnaList.getElementAt(i); + } + + public void removeSelected() + { + int i = _l.getSelectedIndex(); + if (i!=-1) + { + if (_rnaList.getSize()==1) + { + RNA r = new RNA(); + try { + r.setRNA(" ", "."); + } catch (ExceptionUnmatchedClosingParentheses e1) { + } catch (ExceptionFileFormatOrSyntax e1) { + } + _vp.showRNA(r); + _vp.repaint(); + } + else + { + int newi = i+1; + if (newi==_rnaList.getSize()) + { + newi = _rnaList.getSize()-2; + } + FullBackup bck = (FullBackup) _rnaList.getElementAt(newi); + _l.setSelectedValue(bck,true); + } + _rnaList.remove(i); + } + + } + } + + public void onStructureRedrawn() { + // TODO Auto-generated method stub + + } + + public void onUINewStructure(VARNAConfig v, RNA r) { + _rnaList.add(v, r,"",true); + } + + public void onWarningEmitted(String s) { + // TODO Auto-generated method stub + + } + + public void mouseClicked(MouseEvent e) { + if(e.getClickCount() == 2){ + int index = _sideList.locationToIndex(e.getPoint()); + ListModel dlm = _sideList.getModel(); + FullBackup item = (FullBackup) dlm.getElementAt(index);; + _sideList.ensureIndexIsVisible(index); + Object newName = JOptionPane.showInputDialog( + this, + "Specify a new name for this RNA", + "Rename RNA", + JOptionPane.QUESTION_MESSAGE, + (Icon)null, + null, + item.toString()); + if (newName!=null) + { + item.name = newName.toString(); + this._sideList.repaint(); + } + } + } + + public void mouseEntered(MouseEvent arg0) { + // TODO Auto-generated method stub + + } + + public void mouseExited(MouseEvent arg0) { + // TODO Auto-generated method stub + + } + + public void mousePressed(MouseEvent arg0) { + // TODO Auto-generated method stub + + } + + public void mouseReleased(MouseEvent arg0) { + // TODO Auto-generated method stub + + } + + public void onZoomLevelChanged() { + // TODO Auto-generated method stub + + } + + public void onTranslationChanged() { + // TODO Auto-generated method stub + + } +}