X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=src2%2Ffr%2Forsay%2Flri%2Fvarna%2Fviews%2FVueAboutPanel.java;fp=src2%2Ffr%2Forsay%2Flri%2Fvarna%2Fviews%2FVueAboutPanel.java;h=0000000000000000000000000000000000000000;hb=a1225b9392dc7657d5cef12907385b07527d6122;hp=fffbc80a41cd6685cd94aa3b05e7393fb85cbbeb;hpb=b513684c725997c77341f30ce4e584cf9f7cdfed;p=jalview.git

diff --git a/src2/fr/orsay/lri/varna/views/VueAboutPanel.java b/src2/fr/orsay/lri/varna/views/VueAboutPanel.java
deleted file mode 100644
index fffbc80..0000000
--- a/src2/fr/orsay/lri/varna/views/VueAboutPanel.java
+++ /dev/null
@@ -1,210 +0,0 @@
-/*
- VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
- Copyright (C) 2008  Kevin Darty, Alain Denise and Yann Ponty.
- electronic mail : Yann.Ponty@lri.fr
- paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
-
- This file is part of VARNA version 3.1.
- VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
- as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
-
- VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
- without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
- See the GNU General Public License for more details.
-
- You should have received a copy of the GNU General Public License along with VARNA version 3.1.
- If not, see http://www.gnu.org/licenses.
- */
-package fr.orsay.lri.varna.views;
-
-import java.awt.BorderLayout;
-import java.awt.Color;
-import java.awt.Dimension;
-import java.awt.event.ActionEvent;
-import java.awt.event.ActionListener;
-import java.util.ArrayList;
-
-import javax.swing.BorderFactory;
-import javax.swing.JPanel;
-import javax.swing.JTextArea;
-import javax.swing.Timer;
-
-import fr.orsay.lri.varna.VARNAPanel;
-import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
-import fr.orsay.lri.varna.models.VARNAConfig;
-
-/**
- * BH j2s SwingJS replaces thread with simple javax.swing.Timer
- * 
- */
-public class VueAboutPanel extends JPanel {
-
-	/**
-	 * 
-	 */
-	private static final long serialVersionUID = 4525998278180950602L;
-
-	private AboutAnimator _anim;
-	private JPanel _textPanel;
-	private JTextArea _textArea;
-
-	public VueAboutPanel() {
-		init();
-	}
-
-	private void init() {
-		try {
-			setBorder(BorderFactory.createEtchedBorder());
-			setLayout(new BorderLayout());
-			setBackground(Color.WHITE);
-
-			String message = "VARNA "
-					+ VARNAConfig.MAJOR_VERSION
-					+ "."
-					+ VARNAConfig.MINOR_VERSION
-					+ "\n"
-					+ "\n"
-					+ "Created by: Kevin Darty, Alain Denise and Yann Ponty\n"
-					+ "Contact: ponty@lri.fr\n"
-					+ "\n"
-					+ "VARNA is freely distributed under the terms of the GNU GPL 3.0 license.\n"
-					+ "\n"
-					+ "Supported by the BRASERO project (ANR-06-BLAN-0045)\n";
-
-			_textArea = new JTextArea();
-			_textArea.setText(message);
-			_textArea.setEditable(false);
-
-			_textPanel = new JPanel();
-			_textPanel.setBackground(Color.WHITE);
-			_textPanel.setLayout(new BorderLayout());
-			_textPanel.setBorder(BorderFactory.createMatteBorder(0, 15, 0, 15,
-					getBackground()));
-			_textPanel.add(_textArea);
-
-			VARNAPanel vp = new VARNAPanel("GGGGAAAACCCC", "((((....))))");
-			vp.setModifiable(false);
-			vp.setPreferredSize(new Dimension(100, 100));
-			// vp.setBorder(BorderFactory.createLineBorder(Color.gray));
-
-			_anim = new AboutAnimator(vp);
-			_anim
-					.addRNA("GGGGAAGGGGAAAACCCCAACCCC",
-							"((((..((((....))))..))))");
-			_anim.addRNA("GGGGAAGGGGAAGGGGAAAACCCCAACCCCAACCCC",
-					"((((..((((..((((....))))..))))..))))");
-			_anim
-					.addRNA(
-							"GGGGAGGGGAAAACCCCAGGGGAGGGGAAAACCCCAGGGGAAAACCCCAGGGGAAAACCCCACCCCAGGGGAAAACCCCACCCC",
-							"((((.((((....)))).((((.((((....)))).((((....)))).((((....)))).)))).((((....)))).))))");
-			_anim
-					.addRNA(
-							"GGGGGGGGAAAACCCCAGGGGAAAACCCCAGGGGGGGGAAAACCCCAGGGGAAAACCCCAGGGGAAAACCCCAGGGGAAAACCCCGGGGAAAACCCCACCCCAGGGGAAAACCCCAGGGGAAAACCCCCCCC",
-							"((((((((....)))).((((....)))).((((((((....)))).((((....)))).((((....)))).((((....))))((((....)))).)))).((((....)))).((((....))))))))");
-			_anim.addRNA("GGGGAAAACCCC", "((((....))))");
-			_anim.addRNA("GGGGAAGGGGAAAACCCCAGGGGAAAACCCCACCCC",
-					"((((..((((....)))).((((....)))).))))");
-			_anim.addRNA("GGGGAGGGGAAAACCCCAGGGGAAAACCCCAGGGGAAAACCCCACCCC",
-					"((((.((((....)))).((((....)))).((((....)))).))))");
-			_anim
-					.addRNA(
-							"GGGGAGGGGAAAAAAACCCCAGGGGAAAAAAACCCCAGGGGAAAAAAACCCCACCCC",
-							"((((.((((.......)))).((((.......)))).((((.......)))).))))");
-			_anim.start();
-
-			add(vp, BorderLayout.WEST);
-			add(_textPanel, BorderLayout.CENTER);
-		} catch (ExceptionNonEqualLength e) {
-		}
-	}
-
-	public void gracefulStop() {
-		_anim.gracefulStop();
-	}
-
-	private class AboutAnimator implements ActionListener {
-		VARNAPanel _vp;
-		ArrayList<String> _structures = new ArrayList<String>();
-		ArrayList<String> _sequences = new ArrayList<String>();
-		int _period = 2000;
-		boolean _over = false;
-
-		public AboutAnimator(VARNAPanel vp) {
-			super();
-			_vp = vp;
-		}
-
-		/**
-		 * mode pointer for timer cycle -- DELAY1, TASK, DELAY2, STOP
-		 */
-		int mode = 0;
-		
-		/**
-		 * modes for run()
-		 * 
-		 */
-		final int DELAY1 = 0, TASK = 1, DELAY2 = 2, STOP = 3;
-		int i = 0;
-
-		@Override
-		public void actionPerformed(ActionEvent e) {
-			run();
-		}
-
-		public void start() {
-			int mode = DELAY1;
-			run();
-		}
-
-		public void addRNA(String seq, String str) {
-			_sequences.add(seq);
-			_structures.add(str);
-		}
-
-		public void gracefulStop() {
-			_over = true;
-		}
-
-		public void run() {
-			int initialDelay;
-			if (_over)
-				mode = STOP;
-			switch (mode) {
-			case DELAY1:
-				mode = TASK;
-				initialDelay = _period;
-				break;
-			case TASK:
-				String seq = _sequences.get(i);
-				String str = _structures.get(i);
-				try {
-					_vp.drawRNAInterpolated(seq, str);
-					mode = DELAY2;
-					initialDelay = 500;
-				} catch (ExceptionNonEqualLength e) {
-					initialDelay = -1;
-				}
-				break;
-			case DELAY2:
-				i = (i + 1) % _sequences.size();
-				mode = DELAY1;
-				initialDelay = 0;
-				break;
-			case STOP:
-			default:
-				initialDelay = -1;
-				break;
-			}
-			if (initialDelay >= 0) {
-				Timer t = new Timer(initialDelay, this);
-				t.setDelay(0);
-				t.setRepeats(false);
-				t.start();
-			} else {
-				System.out.println("VueAbout done");
-			}
-
-		}
-	}
-
-}