X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=src2%2Ffr%2Forsay%2Flri%2Fvarna%2Fviews%2FVueAboutPanel.java;fp=src2%2Ffr%2Forsay%2Flri%2Fvarna%2Fviews%2FVueAboutPanel.java;h=fffbc80a41cd6685cd94aa3b05e7393fb85cbbeb;hb=665d2c2f4c1310e6985b93b7c2c8a8eec2fa9086;hp=0000000000000000000000000000000000000000;hpb=0e684f72690bd6532272a39ab6c188a27559fd09;p=jalview.git diff --git a/src2/fr/orsay/lri/varna/views/VueAboutPanel.java b/src2/fr/orsay/lri/varna/views/VueAboutPanel.java new file mode 100644 index 0000000..fffbc80 --- /dev/null +++ b/src2/fr/orsay/lri/varna/views/VueAboutPanel.java @@ -0,0 +1,210 @@ +/* + VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases. + Copyright (C) 2008 Kevin Darty, Alain Denise and Yann Ponty. + electronic mail : Yann.Ponty@lri.fr + paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France + + This file is part of VARNA version 3.1. + VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License + as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. + + VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; + without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. + See the GNU General Public License for more details. + + You should have received a copy of the GNU General Public License along with VARNA version 3.1. + If not, see http://www.gnu.org/licenses. + */ +package fr.orsay.lri.varna.views; + +import java.awt.BorderLayout; +import java.awt.Color; +import java.awt.Dimension; +import java.awt.event.ActionEvent; +import java.awt.event.ActionListener; +import java.util.ArrayList; + +import javax.swing.BorderFactory; +import javax.swing.JPanel; +import javax.swing.JTextArea; +import javax.swing.Timer; + +import fr.orsay.lri.varna.VARNAPanel; +import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength; +import fr.orsay.lri.varna.models.VARNAConfig; + +/** + * BH j2s SwingJS replaces thread with simple javax.swing.Timer + * + */ +public class VueAboutPanel extends JPanel { + + /** + * + */ + private static final long serialVersionUID = 4525998278180950602L; + + private AboutAnimator _anim; + private JPanel _textPanel; + private JTextArea _textArea; + + public VueAboutPanel() { + init(); + } + + private void init() { + try { + setBorder(BorderFactory.createEtchedBorder()); + setLayout(new BorderLayout()); + setBackground(Color.WHITE); + + String message = "VARNA " + + VARNAConfig.MAJOR_VERSION + + "." + + VARNAConfig.MINOR_VERSION + + "\n" + + "\n" + + "Created by: Kevin Darty, Alain Denise and Yann Ponty\n" + + "Contact: ponty@lri.fr\n" + + "\n" + + "VARNA is freely distributed under the terms of the GNU GPL 3.0 license.\n" + + "\n" + + "Supported by the BRASERO project (ANR-06-BLAN-0045)\n"; + + _textArea = new JTextArea(); + _textArea.setText(message); + _textArea.setEditable(false); + + _textPanel = new JPanel(); + _textPanel.setBackground(Color.WHITE); + _textPanel.setLayout(new BorderLayout()); + _textPanel.setBorder(BorderFactory.createMatteBorder(0, 15, 0, 15, + getBackground())); + _textPanel.add(_textArea); + + VARNAPanel vp = new VARNAPanel("GGGGAAAACCCC", "((((....))))"); + vp.setModifiable(false); + vp.setPreferredSize(new Dimension(100, 100)); + // vp.setBorder(BorderFactory.createLineBorder(Color.gray)); + + _anim = new AboutAnimator(vp); + _anim + .addRNA("GGGGAAGGGGAAAACCCCAACCCC", + "((((..((((....))))..))))"); + _anim.addRNA("GGGGAAGGGGAAGGGGAAAACCCCAACCCCAACCCC", + "((((..((((..((((....))))..))))..))))"); + _anim + .addRNA( + "GGGGAGGGGAAAACCCCAGGGGAGGGGAAAACCCCAGGGGAAAACCCCAGGGGAAAACCCCACCCCAGGGGAAAACCCCACCCC", + "((((.((((....)))).((((.((((....)))).((((....)))).((((....)))).)))).((((....)))).))))"); + _anim + .addRNA( + "GGGGGGGGAAAACCCCAGGGGAAAACCCCAGGGGGGGGAAAACCCCAGGGGAAAACCCCAGGGGAAAACCCCAGGGGAAAACCCCGGGGAAAACCCCACCCCAGGGGAAAACCCCAGGGGAAAACCCCCCCC", + "((((((((....)))).((((....)))).((((((((....)))).((((....)))).((((....)))).((((....))))((((....)))).)))).((((....)))).((((....))))))))"); + _anim.addRNA("GGGGAAAACCCC", "((((....))))"); + _anim.addRNA("GGGGAAGGGGAAAACCCCAGGGGAAAACCCCACCCC", + "((((..((((....)))).((((....)))).))))"); + _anim.addRNA("GGGGAGGGGAAAACCCCAGGGGAAAACCCCAGGGGAAAACCCCACCCC", + "((((.((((....)))).((((....)))).((((....)))).))))"); + _anim + .addRNA( + "GGGGAGGGGAAAAAAACCCCAGGGGAAAAAAACCCCAGGGGAAAAAAACCCCACCCC", + "((((.((((.......)))).((((.......)))).((((.......)))).))))"); + _anim.start(); + + add(vp, BorderLayout.WEST); + add(_textPanel, BorderLayout.CENTER); + } catch (ExceptionNonEqualLength e) { + } + } + + public void gracefulStop() { + _anim.gracefulStop(); + } + + private class AboutAnimator implements ActionListener { + VARNAPanel _vp; + ArrayList _structures = new ArrayList(); + ArrayList _sequences = new ArrayList(); + int _period = 2000; + boolean _over = false; + + public AboutAnimator(VARNAPanel vp) { + super(); + _vp = vp; + } + + /** + * mode pointer for timer cycle -- DELAY1, TASK, DELAY2, STOP + */ + int mode = 0; + + /** + * modes for run() + * + */ + final int DELAY1 = 0, TASK = 1, DELAY2 = 2, STOP = 3; + int i = 0; + + @Override + public void actionPerformed(ActionEvent e) { + run(); + } + + public void start() { + int mode = DELAY1; + run(); + } + + public void addRNA(String seq, String str) { + _sequences.add(seq); + _structures.add(str); + } + + public void gracefulStop() { + _over = true; + } + + public void run() { + int initialDelay; + if (_over) + mode = STOP; + switch (mode) { + case DELAY1: + mode = TASK; + initialDelay = _period; + break; + case TASK: + String seq = _sequences.get(i); + String str = _structures.get(i); + try { + _vp.drawRNAInterpolated(seq, str); + mode = DELAY2; + initialDelay = 500; + } catch (ExceptionNonEqualLength e) { + initialDelay = -1; + } + break; + case DELAY2: + i = (i + 1) % _sequences.size(); + mode = DELAY1; + initialDelay = 0; + break; + case STOP: + default: + initialDelay = -1; + break; + } + if (initialDelay >= 0) { + Timer t = new Timer(initialDelay, this); + t.setDelay(0); + t.setRepeats(false); + t.start(); + } else { + System.out.println("VueAbout done"); + } + + } + } + +}