X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=srcjar%2Ffr%2Forsay%2Flri%2Fvarna%2Fapplications%2FNussinovDemo.java;fp=srcjar%2Ffr%2Forsay%2Flri%2Fvarna%2Fapplications%2FNussinovDemo.java;h=94ac79d13946df977a3f75b2193a1b781fa2600b;hb=4f30214e8098748469c6a4269ac2ed6c5750e4b0;hp=0000000000000000000000000000000000000000;hpb=9dabc02511e3a334a5749a504f57f69d6c9017bd;p=jalview.git

diff --git a/srcjar/fr/orsay/lri/varna/applications/NussinovDemo.java b/srcjar/fr/orsay/lri/varna/applications/NussinovDemo.java
new file mode 100644
index 0000000..94ac79d
--- /dev/null
+++ b/srcjar/fr/orsay/lri/varna/applications/NussinovDemo.java
@@ -0,0 +1,819 @@
+/*
+ VARNA is a tool for the automated drawing, visualization and annotation of the secondary structure of RNA, designed as a companion software for web servers and databases.
+ Copyright (C) 2008  Kevin Darty, Alain Denise and Yann Ponty.
+ electronic mail : Yann.Ponty@lri.fr
+ paper mail : LRI, bat 490 Université Paris-Sud 91405 Orsay Cedex France
+
+ This file is part of VARNA version 3.1.
+ VARNA version 3.1 is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License
+ as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+
+ VARNA version 3.1 is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
+ without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+ See the GNU General Public License for more details.
+
+ You should have received a copy of the GNU General Public License along with VARNA version 3.1.
+ If not, see http://www.gnu.org/licenses.
+ */
+package fr.orsay.lri.varna.applications;
+
+import java.awt.BorderLayout;
+import java.awt.Color;
+import java.awt.Dimension;
+import java.awt.Font;
+import java.awt.GridLayout;
+import java.awt.event.ActionEvent;
+import java.awt.event.ActionListener;
+import java.awt.event.MouseEvent;
+import java.math.BigInteger;
+import java.util.ArrayList;
+import java.util.Collections;
+
+import javax.swing.BorderFactory;
+import javax.swing.DefaultComboBoxModel;
+import javax.swing.JButton;
+import javax.swing.JComboBox;
+import javax.swing.JFrame;
+import javax.swing.JLabel;
+import javax.swing.JPanel;
+import javax.swing.JTextArea;
+import javax.swing.JTextField;
+import javax.swing.JTextPane;
+import javax.swing.border.BevelBorder;
+
+import fr.orsay.lri.varna.VARNAPanel;
+import fr.orsay.lri.varna.controlers.ControleurInterpolator;
+import fr.orsay.lri.varna.exceptions.ExceptionDrawingAlgorithm;
+import fr.orsay.lri.varna.exceptions.ExceptionFileFormatOrSyntax;
+import fr.orsay.lri.varna.exceptions.ExceptionModeleStyleBaseSyntaxError;
+import fr.orsay.lri.varna.exceptions.ExceptionNAViewAlgorithm;
+import fr.orsay.lri.varna.exceptions.ExceptionNonEqualLength;
+import fr.orsay.lri.varna.exceptions.ExceptionParameterError;
+import fr.orsay.lri.varna.exceptions.ExceptionUnmatchedClosingParentheses;
+import fr.orsay.lri.varna.exceptions.MappingException;
+import fr.orsay.lri.varna.models.VARNAConfig;
+import fr.orsay.lri.varna.models.VARNAConfig.BP_STYLE;
+import fr.orsay.lri.varna.models.rna.Mapping;
+import fr.orsay.lri.varna.models.rna.ModeleBase;
+import fr.orsay.lri.varna.models.rna.ModelBaseStyle;
+import fr.orsay.lri.varna.models.rna.RNA;
+import fr.orsay.lri.varna.interfaces.InterfaceVARNABasesListener;
+import fr.orsay.lri.varna.interfaces.InterfaceVARNAListener;;
+
+public class NussinovDemo extends JFrame implements InterfaceVARNAListener,InterfaceVARNABasesListener {
+
+	/**
+	 * 
+	 */
+	private static final long serialVersionUID = -790155708306987257L;
+
+	private static final String SEQUENCE_DUMMY =        "AAAAAAAAAA";
+	private static final String SEQUENCE_A =        "AGGCACGUCU";
+	private static final String SEQUENCE_B =  "GAGUAGCCUC";
+	private static final String SEQUENCE_C = "GCAUAGCUGC";
+	private static final String SEQUENCE_INRIA = "GAGAAGUACUUGAAAUUGGCCUCCUC";
+	
+
+	private static final String SEQUENCE_BIG = "AAAACAAAAACACCAUGGUGUUUUCACCCAAUUGGGUGAAAACAGAGAUCUCGAGAUCUCUGUUUUUGUUUU"; 
+
+	private static final String DEFAULT_STRUCTURE = "..........";
+	// private static final String DEFAULT_STRUCTURE1 = "((((....))))";
+	// private static final String DEFAULT_STRUCTURE2 =
+	// "((((..(((....)))..))))";
+
+	private VARNAPanel _vpMaster;
+
+	private InfoPanel _infos = new InfoPanel();
+	private JPanel _tools = new JPanel();
+	private JPanel _input = new JPanel();
+
+	private JPanel _seqPanel = new JPanel();
+	private JPanel _structPanel = new JPanel();
+	private JLabel _actions = new JLabel();
+	private JLabel _struct = new JLabel(DEFAULT_STRUCTURE);
+	private JComboBox _seq1 = new JComboBox();
+	private JLabel _structLabel = new JLabel("Structure Secondaire");
+	private JLabel _seqLabel = new JLabel("Sequence d'ARN");
+	private JButton _goButton = new JButton("Repliement");
+	private JButton _switchButton = new JButton("Effacer");
+
+
+	private Color _backgroundColor = Color.white;
+	
+	public static Font textFieldsFont = Font.decode("MonoSpaced-BOLD-16");
+	public static Font labelsFont = Font.decode("SansSerif-BOLD-20");
+	public static final int marginTools = 250;
+	public static String APP_TITLE = "Fête de la science 2015 - Inria AMIB - Repliement d'ARN";
+	
+
+	public static ModelBaseStyle createStyle(String txt) 
+	{
+		ModelBaseStyle result = new ModelBaseStyle();
+		try {
+			result.assignParameters(txt);
+		} catch (ExceptionModeleStyleBaseSyntaxError e) {
+			// TODO Auto-generated catch block
+			e.printStackTrace();
+		} catch (ExceptionParameterError e) {
+			// TODO Auto-generated catch block
+			e.printStackTrace();
+		}
+		return result;
+	}
+	
+	public void applyTo(VARNAPanel vp, ModelBaseStyle mb, int[] indices)
+	{
+		for(int i=0;i<indices.length;i++)
+		{ 
+			ModeleBase m = vp.getRNA().getBaseAt(indices[i]);
+			m.setStyleBase(mb);
+			if (m.getElementStructure()!=-1)
+			{
+				vp.getRNA().getBaseAt(m.getElementStructure()).setStyleBase(mb);
+			}
+		}
+		vp.repaint();
+	}
+	
+	
+	public NussinovDemo() {
+		super();
+		try {
+			_vpMaster = new VARNAPanel(getSeq(), "");
+		} catch (ExceptionNonEqualLength e) {
+			_vpMaster.errorDialog(e);
+		}
+		_vpMaster.setPreferredSize(new Dimension(600, 600));
+		RNAPanelDemoInit();
+	}
+
+	public static void formatLabel(JLabel j)
+	{
+		j.setHorizontalTextPosition(JLabel.LEFT);
+		j.setPreferredSize(new Dimension(marginTools, 15));
+		j.setFont(labelsFont);
+	}
+	
+	private void RNAPanelDemoInit() {
+		
+		
+
+		_seq1.setFont(textFieldsFont);
+		String[] seqs = {SEQUENCE_DUMMY,SEQUENCE_INRIA,SEQUENCE_A,SEQUENCE_B,SEQUENCE_C,SEQUENCE_BIG};
+		_seq1.setModel(new DefaultComboBoxModel(seqs));
+		_seq1.setEditable(true);
+		
+
+		setBackground(_backgroundColor);
+		_vpMaster.setBackground(_backgroundColor);
+		_vpMaster.addVARNAListener(this);
+		_vpMaster.setFlatExteriorLoop(true);
+		
+
+
+		formatLabel(_seqLabel);
+		formatLabel(_structLabel);
+
+		_goButton.addActionListener(new ActionListener() {
+			public void actionPerformed(ActionEvent e) {
+				showSolution();
+				onStructureRedrawn();
+			}
+		});
+
+		_switchButton.addActionListener(new ActionListener() {
+			public void actionPerformed(ActionEvent e) {
+				try {
+							RNA r = new RNA();
+							r.setRNA("", "");
+							_struct.setText("");
+							_vpMaster.setTitle("");
+							_vpMaster.showRNA(r);
+							onStructureRedrawn();
+					} 
+				catch (ExceptionFileFormatOrSyntax e2) {
+					e2.printStackTrace();
+				} catch (ExceptionUnmatchedClosingParentheses e2) {
+					// TODO Auto-generated catch block
+					e2.printStackTrace();
+				}
+				_vpMaster.repaint();
+			}
+		});
+
+		_seqPanel.setLayout(new BorderLayout());
+		_seqPanel.add(_seqLabel, BorderLayout.WEST);
+		_seqPanel.add(_seq1, BorderLayout.CENTER);
+
+		_structLabel.setPreferredSize(new Dimension(marginTools, 15));
+		_structLabel.setHorizontalTextPosition(JLabel.LEFT);
+		_struct.setFont(textFieldsFont);
+		_structPanel.setLayout(new BorderLayout());
+		_structPanel.add(_structLabel, BorderLayout.WEST);
+		_structPanel.add(_struct, BorderLayout.CENTER);
+
+		_input.setLayout(new GridLayout(0, 1));
+		_input.add(_seqPanel);
+		_input.add(_structPanel);
+
+		JPanel goPanel = new JPanel();
+		goPanel.setLayout(new BorderLayout());
+
+		_infos.setFont(labelsFont);
+
+		
+		_tools.setLayout(new BorderLayout());
+		_tools.add(_infos, BorderLayout.SOUTH);
+		_tools.add(_input, BorderLayout.CENTER);
+		_tools.add(_actions, BorderLayout.NORTH);
+		_tools.add(goPanel, BorderLayout.EAST);
+		_tools.setBorder(BorderFactory.createEmptyBorder(5, 5, 5, 5));
+
+		goPanel.add(_goButton, BorderLayout.CENTER);
+		goPanel.add(_switchButton, BorderLayout.SOUTH);
+
+		getContentPane().setLayout(new BorderLayout());
+		JPanel VARNAs = new JPanel();
+		VARNAs.setLayout(new GridLayout(1,2));
+		VARNAs.add(_vpMaster);
+		VARNAs.setBorder(BorderFactory.createBevelBorder(BevelBorder.RAISED));
+		getContentPane().add(VARNAs, BorderLayout.CENTER);
+		getContentPane().add(_tools, BorderLayout.SOUTH);
+
+		setVisible(true);
+
+		_vpMaster.getVARNAUI().UIRadiate();
+		_vpMaster.setTitleFontSize(26f);
+		_vpMaster.setTitleFontStyle(Font.PLAIN);
+		_vpMaster.addVARNABasesListener(this);
+		_vpMaster.setBackground(Color.decode("#308099"));
+		_vpMaster.setModifiable(false);
+		_vpMaster.setTitle("Repliement cible");
+		_vpMaster.setBPStyle(BP_STYLE.SIMPLE);
+		_vpMaster.setBackboneColor(Color.white);
+		_vpMaster.setDefaultBPColor(Color.white);
+		_vpMaster.setBaseNumbersColor(Color.white);
+		_vpMaster.setBaseOutlineColor(Color.white);
+		_vpMaster.setTitleColor(Color.white);		
+		_vpMaster.setTitleFontSize(26f);
+
+		
+		
+		this.setTitle(APP_TITLE);
+		
+		showSolution();
+		onStructureRedrawn();
+	}
+
+	private synchronized void showSolution()
+	{
+		ArrayList<String> sols = getStructs();
+		_infos.setInfo(sols, count(getSeq()));
+	}
+	
+
+
+
+ 	public String getSeq()
+	{
+		return (""+_seq1.getSelectedItem()).toUpperCase();
+	}
+
+ 	
+ 	private boolean canBasePairAll(char a, char b)
+ 	{
+		return true;
+ 	}
+
+ 	private boolean canBasePairBasic(char a, char b)
+ 	{
+ 		if ((a=='G')&&(b=='C'))
+ 			return true;
+ 		if ((a=='C')&&(b=='G'))
+ 			return true;
+ 		if ((a=='U')&&(b=='A'))
+ 			return true;
+ 		if ((a=='A')&&(b=='U'))
+ 			return true;
+ 		if ((a=='G')&&(b=='U'))
+ 			return true;
+ 		if ((a=='U')&&(b=='G'))
+ 			return true;
+ 		return false;
+ 	}
+
+ 	private double basePairScoreBasic(char a, char b)
+ 	{
+ 		if ((a=='G')&&(b=='C'))
+ 			return 1.0;
+ 		if ((a=='C')&&(b=='G'))
+ 			return 1.0;
+ 		if ((a=='U')&&(b=='A'))
+ 			return 1.0;
+ 		if ((a=='A')&&(b=='U'))
+ 			return 1.0;
+ 		if ((a=='G')&&(b=='U'))
+ 			return 1.0;
+ 		if ((a=='U')&&(b=='G'))
+ 			return 1.0;
+ 		return Double.NEGATIVE_INFINITY;
+ 	}
+
+ 	
+ 	private boolean canBasePairNussinov(char a, char b)
+ 	{
+ 		if ((a=='G')&&(b=='C'))
+ 			return true;
+ 		if ((a=='C')&&(b=='G'))
+ 			return true;
+ 		if ((a=='U')&&(b=='A'))
+ 			return true;
+ 		if ((a=='A')&&(b=='U'))
+ 			return true;
+ 		if ((a=='U')&&(b=='G'))
+ 			return true;
+ 		if ((a=='G')&&(b=='U'))
+ 			return true;
+ 		return false;
+ 	}
+
+ 	private double basePairScoreNussinov(char a, char b)
+ 	{
+ 		if ((a=='G')&&(b=='C'))
+ 			return 3.0;
+ 		if ((a=='C')&&(b=='G'))
+ 			return 3.0;
+ 		if ((a=='U')&&(b=='A'))
+ 			return 2.0;
+ 		if ((a=='A')&&(b=='U'))
+ 			return 2.0;
+ 		if ((a=='U')&&(b=='G'))
+ 			return 1.0;
+ 		if ((a=='G')&&(b=='U'))
+ 			return 1.0;
+ 		return Double.NEGATIVE_INFINITY;
+ 	}
+
+ 	private boolean canBasePairINRIA(char a, char b)
+ 	{
+ 		if ((a=='U')&&(b=='A'))
+ 			return true;
+ 		if ((a=='A')&&(b=='U'))
+ 			return true;
+ 		if ((a=='G')&&(b=='C'))
+ 			return true;
+ 		if ((a=='C')&&(b=='G'))
+ 			return true;
+
+ 		if ((a=='A')&&(b=='G'))
+ 			return true;
+ 		if ((a=='G')&&(b=='A'))
+ 			return true;
+ 		if ((a=='U')&&(b=='C'))
+ 			return true;
+ 		if ((a=='C')&&(b=='U'))
+ 			return true;
+ 		if ((a=='A')&&(b=='A'))
+ 			return true;
+ 		if ((a=='U')&&(b=='U'))
+ 			return true;
+
+ 		if ((a=='U')&&(b=='G'))
+ 			return true;
+ 		if ((a=='G')&&(b=='U'))
+ 			return true;
+ 		if ((a=='A')&&(b=='C'))
+ 			return true;
+ 		if ((a=='C')&&(b=='A'))
+ 			return true;
+ 		return false;
+ 	}
+
+ 	private double basePairScoreINRIA(char a, char b)
+ 	{
+ 		if ((a=='U')&&(b=='A'))
+ 			return 3;
+ 		if ((a=='A')&&(b=='U'))
+ 			return 3;
+ 		if ((a=='G')&&(b=='C'))
+ 			return 3;
+ 		if ((a=='C')&&(b=='G'))
+ 			return 3;
+
+ 		if ((a=='A')&&(b=='G'))
+ 			return 2;
+ 		if ((a=='G')&&(b=='A'))
+ 			return 2;
+ 		if ((a=='U')&&(b=='C'))
+ 			return 2;
+ 		if ((a=='C')&&(b=='U'))
+ 			return 2;
+ 		if ((a=='A')&&(b=='A'))
+ 			return 2;
+ 		if ((a=='U')&&(b=='U'))
+ 			return 2;
+
+ 		if ((a=='U')&&(b=='G'))
+ 			return 1;
+ 		if ((a=='G')&&(b=='U'))
+ 			return 1;
+ 		if ((a=='A')&&(b=='C'))
+ 			return 1;
+ 		if ((a=='C')&&(b=='A'))
+ 			return 1;
+ 		return Double.NEGATIVE_INFINITY;
+ 	}
+ 	
+ 	private boolean canBasePair(char a, char b)
+ 	{
+ 		return canBasePairBasic(a,b);
+ 		//return canBasePairNussinov(a,b);
+ 		//return canBasePairINRIA(a,b);
+ 	}
+ 	
+ 	private double basePairScore(char a, char b)
+ 	{
+ 		return basePairScoreBasic(a,b);
+ 		//return basePairScoreNussinov(a,b);
+ 		//return basePairScoreINRIA(a,b);
+ 	}
+ 	
+ 	public double[][] fillMatrix(String seq)
+ 	{
+		int n = seq.length();
+		double[][] tab = new double[n][n];
+		for(int m=1;m<=n;m++)
+		{
+			for(int i=0;i<n-m+1;i++)
+			{
+				int j = i+m-1;
+				tab[i][j] = 0;
+				if (i<j)
+				{ 
+					tab[i][j] = Math.max(tab[i][j], tab[i+1][j]); 
+					for (int k=i+1;k<=j;k++)
+					{
+						if (canBasePair(seq.charAt(i),seq.charAt(k)))
+						{
+							double fact1 = 0;
+							if (k>i+1)
+							{
+								fact1 = tab[i+1][k-1];
+							}
+							double fact2 = 0;
+							if (k<j)
+							{
+								fact2 = tab[k+1][j];
+							}
+							tab[i][j] = Math.max(tab[i][j],basePairScore(seq.charAt(i),seq.charAt(k))+fact1+fact2);
+						} 
+					}
+				}
+			}			
+		}
+ 		return tab;
+ 	}
+
+ 	public static ArrayList<Double> combine(double bonus, ArrayList<Double> part1, ArrayList<Double> part2)
+ 	{
+ 		ArrayList<Double> base = new ArrayList<Double>();
+ 		for(double d1: part1)
+ 		{
+ 	 		for(double d2: part2)
+ 	 		{
+ 	 			base.add(bonus+d1+d2);
+ 	 		}
+ 		}
+ 		return base;
+ 	}
+
+ 	public static ArrayList<Double> selectBests(ArrayList<Double> base)
+ 	{
+ 		ArrayList<Double> result = new ArrayList<Double>();
+ 		double best = Double.NEGATIVE_INFINITY;
+ 		for(double val: base)
+ 		{
+ 			best = Math.max(val, best);
+ 		}
+ 		for(double val: base)
+ 		{
+ 			if (val == best)
+ 				result.add(val);
+ 		}
+ 		return result;
+ 	}
+
+ 	
+ 	private ArrayList<String> backtrack(double[][] tab, String seq)
+ 	{
+ 		return backtrack(tab,seq, 0, seq.length()-1);
+ 	}
+
+ 	private ArrayList<String> backtrack(double[][] tab, String seq, int i, int j)
+ 	{
+ 		ArrayList<String> result = new ArrayList<String>();
+ 		if (i<j)
+		{ 
+ 			ArrayList<Integer> indices = new ArrayList<Integer>();
+ 			indices.add(-1);
+			for (int k=i+1;k<=j;k++)
+			{
+				indices.add(k);
+			}
+			for (int k : indices)
+ 			{
+ 				if (k==-1)
+ 				{
+ 					if (tab[i][j] == tab[i+1][j])
+ 					{
+ 						for (String s:backtrack(tab, seq, i+1,j))
+ 						{
+ 							result.add("."+s);
+ 						}
+ 					}
+ 				}
+ 				else
+ 				{
+ 					if (canBasePair(seq.charAt(i),seq.charAt(k)))
+ 					{
+ 						double fact1 = 0;
+ 						if (k>i+1)
+ 						{
+ 							fact1 = tab[i+1][k-1];
+ 						}
+ 						double fact2 = 0;
+ 						if (k<j)
+ 						{
+ 							fact2 = tab[k+1][j];
+ 						}
+ 						if (tab[i][j]==basePairScore(seq.charAt(i),seq.charAt(k))+fact1+fact2)
+ 						{ 
+ 	 						for (String s1:backtrack(tab, seq, i+1,k-1))
+ 	 						{
+ 	 	 						for (String s2:backtrack(tab, seq, k+1,j))
+ 	 	 						{
+ 	 	 							result.add("("+s1+")"+s2);
+ 	 	 						}
+ 	 						}
+ 						}
+ 					}  					
+ 				} 				
+			}
+		}
+		else if  (i==j)
+		{
+			result.add(".");
+		}
+		else 
+		{
+			result.add("");
+		}
+ 		return result;
+ 	}
+ 	
+ 	public BigInteger count(String seq)
+ 	{
+		int n = seq.length();
+		
+		BigInteger[][] tab = new BigInteger[n][n];
+		for(int m=1;m<=n;m++)
+		{
+			for(int i=0;i<n-m+1;i++)
+			{
+				int j = i+m-1;
+				tab[i][j] = BigInteger.ZERO;
+				if (i<j)
+				{ 
+					tab[i][j] = tab[i][j].add(tab[i+1][j]); 
+					for (int k=i+1;k<=j;k++)
+					{
+						if (canBasePair(seq.charAt(i),seq.charAt(k)))
+						{
+							BigInteger fact1 = BigInteger.ONE;
+							if (k>i+1)
+							{
+								fact1 = tab[i+1][k-1];
+							}
+							BigInteger fact2 = BigInteger.ONE;
+							if (k<j)
+							{
+								fact2 = tab[k+1][j];
+							}
+							tab[i][j] = tab[i][j].add(fact1.multiply(fact2));
+						} 
+					}
+				}
+				else
+				{
+					tab[i][j] = BigInteger.ONE;
+				}
+			}			
+		}
+ 		return tab[0][n-1];
+ 	}
+ 	
+ 	private String _cache = "";
+ 	ArrayList<String> _cacheStructs = new ArrayList<String>(); 
+ 	
+	public ArrayList<String> getStructs() {
+		String seq = getSeq();
+		seq = seq.toUpperCase();
+		if (!_cache.equals(seq))
+		{
+			double[][] mfe = fillMatrix(seq);
+			_cacheStructs = backtrack(mfe,seq);
+			_cache = seq;
+		}
+		return _cacheStructs;
+	}
+
+	public VARNAPanel get_varnaPanel() {
+		return _vpMaster;
+	}
+
+	public void set_varnaPanel(VARNAPanel surface) {
+		_vpMaster = surface;
+	}
+
+
+	public JLabel get_info() {
+		return _actions;
+	}
+
+	public void set_info(JLabel _info) {
+		this._actions = _info;
+	}
+
+	public static void main(String[] args) {
+		NussinovDemo d = new NussinovDemo();
+		d.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
+		d.pack();
+		d.setVisible(true);
+	}
+
+	public void onStructureRedrawn() {
+		_vpMaster.repaint();
+	}
+
+	public void onWarningEmitted(String s) {
+		// TODO Auto-generated method stub
+		
+	}
+
+	public void onLoad(String path) {
+		// TODO Auto-generated method stub
+		
+	}
+
+	public void onLoaded() {
+		// TODO Auto-generated method stub
+		
+	}
+
+	public void onUINewStructure(VARNAConfig v, RNA r) {
+		// TODO Auto-generated method stub
+		
+	}
+
+	static final String[] _bases =     {"A","C","G","U"};
+	static final String[] _basesComp = {"U","G","C","A"};
+	
+	public void onBaseClicked(ModeleBase mb, MouseEvent e) {
+	}
+	
+	public void onZoomLevelChanged() {
+		// TODO Auto-generated method stub
+		
+	}
+
+	public void onTranslationChanged() {
+		// TODO Auto-generated method stub
+		
+	}
+	private class InfoPanel extends JPanel
+	{
+		ArrayList<String> _sols = new ArrayList<String>();
+		BigInteger _nbFolds = BigInteger.ZERO;
+		JTextArea _text = new JTextArea("");
+		JTextArea _subopts = new JTextArea("");
+		JPanel _suboptBrowser = new JPanel();
+		JPanel _suboptCount = new JPanel();
+		int _selectedIndex = 0;
+		JButton next = new JButton(">");
+		JButton previous = new JButton("<");
+		
+		InfoPanel()
+		{
+			setLayout(new BorderLayout());
+			add(_suboptBrowser,BorderLayout.SOUTH);
+			add(_suboptCount,BorderLayout.NORTH);
+			
+			next.addActionListener(new ActionListener(){
+				public void actionPerformed(ActionEvent arg0) {
+					if (_sols.size()>0)
+					{
+						setSelectedIndex((_selectedIndex+1)%_sols.size());
+					}
+				}				
+			});
+
+			previous.addActionListener(new ActionListener(){
+				public void actionPerformed(ActionEvent arg0) {
+					if (_sols.size()>0)
+					{
+						setSelectedIndex((_selectedIndex+_sols.size()-1)%_sols.size());
+					}
+				}				
+			});
+			next.setEnabled(false);
+			previous.setEnabled(false);
+			
+
+			JLabel nbLab = new JLabel("#Repliements");
+			NussinovDemo.formatLabel(nbLab);
+
+			_suboptCount.setLayout(new BorderLayout());
+			_suboptCount.add(nbLab,BorderLayout.WEST);
+			_suboptCount.add(_text,BorderLayout.CENTER);
+
+			JLabel cooptlab = new JLabel("#Co-optimaux");
+			NussinovDemo.formatLabel(cooptlab);
+			
+			JPanel commands = new JPanel();
+			commands.add(previous);
+			commands.add(next);
+			
+			JPanel jp = new JPanel();
+			jp.setLayout(new BorderLayout());
+			jp.add(_subopts,BorderLayout.WEST);
+			jp.add(commands,BorderLayout.CENTER);
+
+			_suboptBrowser.setLayout(new BorderLayout());
+			_suboptBrowser.add(cooptlab,BorderLayout.WEST);
+			_suboptBrowser.add(jp,BorderLayout.CENTER);
+			
+			
+		}
+			
+				
+		public void setSelectedIndex(int i)
+		{
+			_selectedIndex = i;
+			RNA rfolded = new RNA();
+			try {
+				rfolded.setRNA(getSeq(), _sols.get(i));
+				rfolded.drawRNARadiate(_vpMaster.getConfig());
+				rfolded.setBaseNameColor(Color.white);
+				rfolded.setBaseOutlineColor(Color.white);
+				rfolded.setBaseNumbersColor(Color.white);
+				_vpMaster.setBaseNumbersColor(Color.white);
+				_vpMaster.setBaseOutlineColor(Color.white);
+				_vpMaster.setFillBases(false);
+				_vpMaster.setBaseNameColor(Color.white);
+				_vpMaster.showRNAInterpolated(rfolded);		        
+				
+			} catch (ExceptionUnmatchedClosingParentheses e) {
+				// TODO Auto-generated catch block
+				e.printStackTrace();
+			} catch (ExceptionFileFormatOrSyntax e) {
+				// TODO Auto-generated catch block
+				e.printStackTrace();
+			}
+			_struct.setText(_sols.get(i));
+			formatDescription();
+		}
+		
+		public void setFont(Font f)
+		{
+			super.setFont(f);
+			if(_text!=null)
+			{
+				_text.setFont(f);
+				_text.setOpaque(false);
+			}
+			if(_subopts!=null)
+			{
+			_subopts.setFont(f);
+			_subopts.setOpaque(false);
+			}
+		}
+		public void setInfo(ArrayList<String> sols, BigInteger nbFolds)
+		{
+			_sols = sols;
+			_nbFolds = nbFolds;
+			formatDescription();
+			setSelectedIndex(0);
+		}
+		
+		private void formatDescription()
+		{
+			_text.setText(""+_nbFolds);
+			_subopts.setText(""+_sols.size());
+			next.setEnabled(_sols.size()>1);
+			previous.setEnabled(_sols.size()>1);
+			
+		}
+		
+	}
+	
+}