X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Fanalysis%2FDnaTranslation.java;h=708ee21eac546c67f4ca232e5ccf7fd3a68a909a;hb=eaf7f233ca7cf7a3995c26a77620e666c7970e77;hp=da2fac45dc3bd2554057355390f37e5264dd1616;hpb=b2f9a8d7bce642ff4011bc6d49e02bb0569fbb11;p=jalview.git

diff --git a/test/jalview/analysis/DnaTranslation.java b/test/jalview/analysis/DnaTranslation.java
index da2fac4..708ee21 100644
--- a/test/jalview/analysis/DnaTranslation.java
+++ b/test/jalview/analysis/DnaTranslation.java
@@ -1,19 +1,21 @@
 /*
- * Jalview - A Sequence Alignment Editor and Viewer (Version 2.8.1)
+ * Jalview - A Sequence Alignment Editor and Viewer (Version 2.8.2)
  * Copyright (C) 2014 The Jalview Authors
  * 
  * This file is part of Jalview.
  * 
  * Jalview is free software: you can redistribute it and/or
  * modify it under the terms of the GNU General Public License 
- * as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
  *  
  * Jalview is distributed in the hope that it will be useful, but 
  * WITHOUT ANY WARRANTY; without even the implied warranty 
  * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
  * PURPOSE.  See the GNU General Public License for more details.
  * 
- * You should have received a copy of the GNU General Public License along with Jalview.  If not, see <http://www.gnu.org/licenses/>.
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview.  If not, see <http://www.gnu.org/licenses/>.
  * The Jalview Authors are detailed in the 'AUTHORS' file.
  */
 package jalview.analysis;
@@ -87,7 +89,6 @@ public class DnaTranslation
           + "GCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAAATCATTATATAATACAGTAGCAACCCTCTATTG\n"
           + "TGTACATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGAA\n";
 
-  
   @Test
   public void translationWithUntranslatableCodonsTest()
   {
@@ -96,8 +97,9 @@ public class DnaTranslation
     jalview.datamodel.AlignmentI alf = null;
     try
     {
-      alf = new jalview.io.FormatAdapter().readFile(JAL_1312_example_align_fasta,
-              jalview.io.FormatAdapter.PASTE, "FASTA");
+      alf = new jalview.io.FormatAdapter().readFile(
+              JAL_1312_example_align_fasta, jalview.io.FormatAdapter.PASTE,
+              "FASTA");
     } catch (IOException x)
     {
       x.printStackTrace();