X-Git-Url: http://source.jalview.org/gitweb/?a=blobdiff_plain;f=test%2Fjalview%2Fdatamodel%2FSequenceTest.java;h=065bed7b37e211c1bcdfc840b2bb7dd5f666d94b;hb=37de9310bec3501cbc6381e0c3dcb282fcaad812;hp=d9101cfe09c0e22b3221d1359062740a6db97c4f;hpb=bb8d445ac21fbb53ec754d9acdd18a693e6d80d9;p=jalview.git

diff --git a/test/jalview/datamodel/SequenceTest.java b/test/jalview/datamodel/SequenceTest.java
index d9101cf..065bed7 100644
--- a/test/jalview/datamodel/SequenceTest.java
+++ b/test/jalview/datamodel/SequenceTest.java
@@ -1,25 +1,96 @@
+/*
+ * Jalview - A Sequence Alignment Editor and Viewer ($$Version-Rel$$)
+ * Copyright (C) $$Year-Rel$$ The Jalview Authors
+ * 
+ * This file is part of Jalview.
+ * 
+ * Jalview is free software: you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License 
+ * as published by the Free Software Foundation, either version 3
+ * of the License, or (at your option) any later version.
+ *  
+ * Jalview is distributed in the hope that it will be useful, but 
+ * WITHOUT ANY WARRANTY; without even the implied warranty 
+ * of MERCHANTABILITY or FITNESS FOR A PARTICULAR 
+ * PURPOSE.  See the GNU General Public License for more details.
+ * 
+ * You should have received a copy of the GNU General Public License
+ * along with Jalview.  If not, see <http://www.gnu.org/licenses/>.
+ * The Jalview Authors are detailed in the 'AUTHORS' file.
+ */
 package jalview.datamodel;
 
-import static org.junit.Assert.assertEquals;
-import static org.junit.Assert.assertNull;
-import static org.junit.Assert.assertSame;
-import static org.junit.Assert.assertTrue;
+import static org.testng.AssertJUnit.assertEquals;
+import static org.testng.AssertJUnit.assertFalse;
+import static org.testng.AssertJUnit.assertNotNull;
+import static org.testng.AssertJUnit.assertNull;
+import static org.testng.AssertJUnit.assertSame;
+import static org.testng.AssertJUnit.assertTrue;
+import static org.testng.internal.junit.ArrayAsserts.assertArrayEquals;
 
+import jalview.datamodel.PDBEntry.Type;
+import jalview.util.MapList;
+
+import java.io.File;
+import java.util.ArrayList;
+import java.util.Arrays;
 import java.util.List;
+import java.util.Vector;
 
-import org.junit.Before;
-import org.junit.Test;
+import org.testng.Assert;
+import org.testng.annotations.BeforeMethod;
+import org.testng.annotations.Test;
 
 public class SequenceTest
 {
   Sequence seq;
 
-  @Before
+  @BeforeMethod(alwaysRun = true)
   public void setUp()
   {
     seq = new Sequence("FER1", "AKPNGVL");
   }
-  @Test
+
+  @Test(groups = { "Functional" })
+  public void testInsertGapsAndGapmaps()
+  {
+    SequenceI aseq = seq.deriveSequence();
+    aseq.insertCharAt(2, 3, '-');
+    aseq.insertCharAt(6, 3, '-');
+    assertEquals("Gap insertions not correct", "AK---P---NGVL",
+            aseq.getSequenceAsString());
+    List<int[]> gapInt = aseq.getInsertions();
+    assertEquals("Gap interval 1 start wrong", 2, gapInt.get(0)[0]);
+    assertEquals("Gap interval 1 end wrong", 4, gapInt.get(0)[1]);
+    assertEquals("Gap interval 2 start wrong", 6, gapInt.get(1)[0]);
+    assertEquals("Gap interval 2 end wrong", 8, gapInt.get(1)[1]);
+  }
+
+  @Test(groups = ("Functional"))
+  public void testIsProtein()
+  {
+    // test Protein
+    assertTrue(new Sequence("prot", "ASDFASDFASDF").isProtein());
+    // test DNA
+    assertFalse(new Sequence("prot", "ACGTACGTACGT").isProtein());
+    // test RNA
+    SequenceI sq = new Sequence("prot", "ACGUACGUACGU");
+    assertFalse(sq.isProtein());
+    // change sequence, should trigger an update of cached result
+    sq.setSequence("ASDFASDFADSF");
+    assertTrue(sq.isProtein());
+    /*
+     * in situ change of sequence doesn't change hashcode :-O
+     * (sequence should not expose internal implementation)
+     */
+    for (int i = 0; i < sq.getSequence().length; i++)
+    {
+      sq.getSequence()[i] = "acgtu".charAt(i % 5);
+    }
+    assertTrue(sq.isProtein()); // but it isn't
+  }
+
+  @Test(groups = { "Functional" })
   public void testGetAnnotation()
   {
     // initial state returns null not an empty array
@@ -35,12 +106,14 @@ public class SequenceTest
     assertNull(seq.getAnnotation());
   }
 
-  @Test
+  @Test(groups = { "Functional" })
   public void testGetAnnotation_forLabel()
   {
-    AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1", 1f);
-    AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2", 1f);
-    AlignmentAnnotation ann3 = addAnnotation("label1", "desc3", "calcId3", 1f);
+    AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1",
+            1f);
+    addAnnotation("label2", "desc2", "calcId2", 1f);
+    AlignmentAnnotation ann3 = addAnnotation("label1", "desc3", "calcId3",
+            1f);
     AlignmentAnnotation[] anns = seq.getAnnotation("label1");
     assertEquals(2, anns.length);
     assertSame(ann1, anns[0]);
@@ -48,37 +121,33 @@ public class SequenceTest
   }
 
   private AlignmentAnnotation addAnnotation(String label,
-          String description, String calcId,
-          float value)
+          String description, String calcId, float value)
   {
-    final AlignmentAnnotation annotation = new AlignmentAnnotation(label, description,
-            value);
+    final AlignmentAnnotation annotation = new AlignmentAnnotation(label,
+            description, value);
     annotation.setCalcId(calcId);
     seq.addAlignmentAnnotation(annotation);
     return annotation;
   }
 
-  @Test
+  @Test(groups = { "Functional" })
   public void testGetAlignmentAnnotations_forCalcIdAndLabel()
   {
-    AlignmentAnnotation ann1 = addAnnotation("label1", "desc1", "calcId1",
-            1f);
+    addAnnotation("label1", "desc1", "calcId1", 1f);
     AlignmentAnnotation ann2 = addAnnotation("label2", "desc2", "calcId2",
             1f);
-    AlignmentAnnotation ann3 = addAnnotation("label2", "desc3", "calcId3",
-            1f);
+    addAnnotation("label2", "desc3", "calcId3", 1f);
     AlignmentAnnotation ann4 = addAnnotation("label2", "desc3", "calcId2",
             1f);
-    AlignmentAnnotation ann5 = addAnnotation("label5", "desc3", null,
-            1f);
-    AlignmentAnnotation ann6 = addAnnotation(null, "desc3", "calcId3",
-            1f);
+    addAnnotation("label5", "desc3", null, 1f);
+    addAnnotation(null, "desc3", "calcId3", 1f);
+
     List<AlignmentAnnotation> anns = seq.getAlignmentAnnotations("calcId2",
             "label2");
     assertEquals(2, anns.size());
     assertSame(ann2, anns.get(0));
     assertSame(ann4, anns.get(1));
-    
+
     assertTrue(seq.getAlignmentAnnotations("calcId2", "label3").isEmpty());
     assertTrue(seq.getAlignmentAnnotations("calcId3", "label5").isEmpty());
     assertTrue(seq.getAlignmentAnnotations("calcId2", null).isEmpty());
@@ -88,12 +157,13 @@ public class SequenceTest
 
   /**
    * Tests for addAlignmentAnnotation. Note this method has the side-effect of
-   * setting the sequenceRef on the annotation.
+   * setting the sequenceRef on the annotation. Adding the same annotation twice
+   * should be ignored.
    */
-  @Test
+  @Test(groups = { "Functional" })
   public void testAddAlignmentAnnotation()
   {
-    assertNull(seq.annotation);
+    assertNull(seq.getAnnotation());
     final AlignmentAnnotation annotation = new AlignmentAnnotation("a",
             "b", 2d);
     assertNull(annotation.sequenceRef);
@@ -102,5 +172,832 @@ public class SequenceTest
     AlignmentAnnotation[] anns = seq.getAnnotation();
     assertEquals(1, anns.length);
     assertSame(annotation, anns[0]);
+
+    // re-adding does nothing
+    seq.addAlignmentAnnotation(annotation);
+    anns = seq.getAnnotation();
+    assertEquals(1, anns.length);
+    assertSame(annotation, anns[0]);
+
+    // an identical but different annotation can be added
+    final AlignmentAnnotation annotation2 = new AlignmentAnnotation("a",
+            "b", 2d);
+    seq.addAlignmentAnnotation(annotation2);
+    anns = seq.getAnnotation();
+    assertEquals(2, anns.length);
+    assertSame(annotation, anns[0]);
+    assertSame(annotation2, anns[1]);
+  }
+
+  @Test(groups = { "Functional" })
+  public void testGetStartGetEnd()
+  {
+    SequenceI sq = new Sequence("test", "ABCDEF");
+    assertEquals(1, sq.getStart());
+    assertEquals(6, sq.getEnd());
+
+    sq = new Sequence("test", "--AB-C-DEF--");
+    assertEquals(1, sq.getStart());
+    assertEquals(6, sq.getEnd());
+
+    sq = new Sequence("test", "----");
+    assertEquals(1, sq.getStart());
+    assertEquals(0, sq.getEnd()); // ??
+  }
+
+  /**
+   * Tests for the method that returns an alignment column position (base 1) for
+   * a given sequence position (base 1).
+   */
+  @Test(groups = { "Functional" })
+  public void testFindIndex()
+  {
+    SequenceI sq = new Sequence("test", "ABCDEF");
+    assertEquals(0, sq.findIndex(0));
+    assertEquals(1, sq.findIndex(1));
+    assertEquals(5, sq.findIndex(5));
+    assertEquals(6, sq.findIndex(6));
+    assertEquals(6, sq.findIndex(9));
+
+    sq = new Sequence("test", "-A--B-C-D-E-F--");
+    assertEquals(2, sq.findIndex(1));
+    assertEquals(5, sq.findIndex(2));
+    assertEquals(7, sq.findIndex(3));
+
+    // before start returns 0
+    assertEquals(0, sq.findIndex(0));
+    assertEquals(0, sq.findIndex(-1));
+
+    // beyond end returns last residue column
+    assertEquals(13, sq.findIndex(99));
+
+  }
+
+  /**
+   * Tests for the method that returns a dataset sequence position (base 1) for
+   * an aligned column position (base 0).
+   */
+  @Test(groups = { "Functional" })
+  public void testFindPosition()
+  {
+    SequenceI sq = new Sequence("test", "ABCDEF");
+    assertEquals(1, sq.findPosition(0));
+    assertEquals(6, sq.findPosition(5));
+    // assertEquals(-1, seq.findPosition(6)); // fails
+
+    sq = new Sequence("test", "AB-C-D--");
+    assertEquals(1, sq.findPosition(0));
+    assertEquals(2, sq.findPosition(1));
+    // gap position 'finds' residue to the right (not the left as per javadoc)
+    assertEquals(3, sq.findPosition(2));
+    assertEquals(3, sq.findPosition(3));
+    assertEquals(4, sq.findPosition(4));
+    assertEquals(4, sq.findPosition(5));
+    // returns 1 more than sequence length if off the end ?!?
+    assertEquals(5, sq.findPosition(6));
+    assertEquals(5, sq.findPosition(7));
+
+    sq = new Sequence("test", "--AB-C-DEF--");
+    assertEquals(1, sq.findPosition(0));
+    assertEquals(1, sq.findPosition(1));
+    assertEquals(1, sq.findPosition(2));
+    assertEquals(2, sq.findPosition(3));
+    assertEquals(3, sq.findPosition(4));
+    assertEquals(3, sq.findPosition(5));
+    assertEquals(4, sq.findPosition(6));
+    assertEquals(4, sq.findPosition(7));
+    assertEquals(5, sq.findPosition(8));
+    assertEquals(6, sq.findPosition(9));
+    assertEquals(7, sq.findPosition(10));
+    assertEquals(7, sq.findPosition(11));
+  }
+
+  @Test(groups = { "Functional" })
+  public void testDeleteChars()
+  {
+    SequenceI sq = new Sequence("test", "ABCDEF");
+    assertEquals(1, sq.getStart());
+    assertEquals(6, sq.getEnd());
+    sq.deleteChars(2, 3);
+    assertEquals("ABDEF", sq.getSequenceAsString());
+    assertEquals(1, sq.getStart());
+    assertEquals(5, sq.getEnd());
+
+    sq = new Sequence("test", "ABCDEF");
+    sq.deleteChars(0, 2);
+    assertEquals("CDEF", sq.getSequenceAsString());
+    assertEquals(3, sq.getStart());
+    assertEquals(6, sq.getEnd());
+  }
+
+  @Test(groups = { "Functional" })
+  public void testInsertCharAt()
+  {
+    // non-static methods:
+    SequenceI sq = new Sequence("test", "ABCDEF");
+    sq.insertCharAt(0, 'z');
+    assertEquals("zABCDEF", sq.getSequenceAsString());
+    sq.insertCharAt(2, 2, 'x');
+    assertEquals("zAxxBCDEF", sq.getSequenceAsString());
+
+    // for static method see StringUtilsTest
+  }
+
+  /**
+   * Test the method that returns an array of aligned sequence positions where
+   * the array index is the data sequence position (both base 0).
+   */
+  @Test(groups = { "Functional" })
+  public void testGapMap()
+  {
+    SequenceI sq = new Sequence("test", "-A--B-CD-E--F-");
+    sq.createDatasetSequence();
+    assertEquals("[1, 4, 6, 7, 9, 12]", Arrays.toString(sq.gapMap()));
+  }
+
+  /**
+   * Test the method that gets sequence features, either from the sequence or
+   * its dataset.
+   */
+  @Test(groups = { "Functional" })
+  public void testGetSequenceFeatures()
+  {
+    SequenceI sq = new Sequence("test", "GATCAT");
+    sq.createDatasetSequence();
+
+    assertNull(sq.getSequenceFeatures());
+
+    /*
+     * SequenceFeature on sequence
+     */
+    SequenceFeature sf = new SequenceFeature();
+    sq.addSequenceFeature(sf);
+    SequenceFeature[] sfs = sq.getSequenceFeatures();
+    assertEquals(1, sfs.length);
+    assertSame(sf, sfs[0]);
+
+    /*
+     * SequenceFeature on sequence and dataset sequence; returns that on
+     * sequence
+     * 
+     * Note JAL-2046: spurious: we have no use case for this at the moment.
+     * This test also buggy - as sf2.equals(sf), no new feature is added
+     */
+    SequenceFeature sf2 = new SequenceFeature();
+    sq.getDatasetSequence().addSequenceFeature(sf2);
+    sfs = sq.getSequenceFeatures();
+    assertEquals(1, sfs.length);
+    assertSame(sf, sfs[0]);
+
+    /*
+     * SequenceFeature on dataset sequence only
+     * Note JAL-2046: spurious: we have no use case for setting a non-dataset sequence's feature array to null at the moment.
+     */
+    sq.setSequenceFeatures(null);
+    assertNull(sq.getDatasetSequence().getSequenceFeatures());
+
+    /*
+     * Corrupt case - no SequenceFeature, dataset's dataset is the original
+     * sequence. Test shows no infinite loop results.
+     */
+    sq.getDatasetSequence().setSequenceFeatures(null);
+    /**
+     * is there a usecase for this ? setDatasetSequence should throw an error if
+     * this actually occurs.
+     */
+    try
+    {
+      sq.getDatasetSequence().setDatasetSequence(sq); // loop!
+      Assert.fail("Expected Error to be raised when calling setDatasetSequence with self reference");
+    } catch (IllegalArgumentException e)
+    {
+      // TODO Jalview error/exception class for raising implementation errors
+      assertTrue(e.getMessage().toLowerCase()
+              .contains("implementation error"));
+    }
+    assertNull(sq.getSequenceFeatures());
+  }
+
+  /**
+   * Test the method that returns an array, indexed by sequence position, whose
+   * entries are the residue positions at the sequence position (or to the right
+   * if a gap)
+   */
+  @Test(groups = { "Functional" })
+  public void testFindPositionMap()
+  {
+    /*
+     * Note: Javadoc for findPosition says it returns the residue position to
+     * the left of a gapped position; in fact it returns the position to the
+     * right. Also it returns a non-existent residue position for a gap beyond
+     * the sequence.
+     */
+    Sequence sq = new Sequence("TestSeq", "AB.C-D E.");
+    int[] map = sq.findPositionMap();
+    assertEquals(Arrays.toString(new int[] { 1, 2, 3, 3, 4, 4, 5, 5, 6 }),
+            Arrays.toString(map));
+  }
+
+  /**
+   * Test for getSubsequence
+   */
+  @Test(groups = { "Functional" })
+  public void testGetSubsequence()
+  {
+    SequenceI sq = new Sequence("TestSeq", "ABCDEFG");
+    sq.createDatasetSequence();
+
+    // positions are base 0, end position is exclusive
+    SequenceI subseq = sq.getSubSequence(2, 4);
+
+    assertEquals("CD", subseq.getSequenceAsString());
+    // start/end are base 1 positions
+    assertEquals(3, subseq.getStart());
+    assertEquals(4, subseq.getEnd());
+    // subsequence shares the full dataset sequence
+    assertSame(sq.getDatasetSequence(), subseq.getDatasetSequence());
+  }
+
+  /**
+   * test createDatasetSequence behaves to doc
+   */
+  @Test(groups = { "Functional" })
+  public void testCreateDatasetSequence()
+  {
+    SequenceI sq = new Sequence("my", "ASDASD");
+    assertNull(sq.getDatasetSequence());
+    SequenceI rds = sq.createDatasetSequence();
+    assertNotNull(rds);
+    assertNull(rds.getDatasetSequence());
+    assertEquals(sq.getDatasetSequence(), rds);
+  }
+
+  /**
+   * Test for deriveSequence applied to a sequence with a dataset
+   */
+  @Test(groups = { "Functional" })
+  public void testDeriveSequence_existingDataset()
+  {
+    Sequence sq = new Sequence("Seq1", "CD");
+    sq.setDatasetSequence(new Sequence("Seq1", "ABCDEF"));
+    sq.getDatasetSequence().addSequenceFeature(
+            new SequenceFeature("", "", 1, 2, 0f, null));
+    sq.setStart(3);
+    sq.setEnd(4);
+
+    sq.setDescription("Test sequence description..");
+    sq.setVamsasId("TestVamsasId");
+    sq.addDBRef(new DBRefEntry("PDB", "version0", "1TST"));
+
+    sq.addDBRef(new DBRefEntry("PDB", "version1", "1PDB"));
+    sq.addDBRef(new DBRefEntry("PDB", "version2", "2PDB"));
+    sq.addDBRef(new DBRefEntry("PDB", "version3", "3PDB"));
+    sq.addDBRef(new DBRefEntry("PDB", "version4", "4PDB"));
+
+    sq.addPDBId(new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1"));
+    sq.addPDBId(new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1"));
+    sq.addPDBId(new PDBEntry("2PDB", "A", Type.MMCIF, "filePath/test2"));
+    sq.addPDBId(new PDBEntry("2PDB", "B", Type.MMCIF, "filePath/test2"));
+
+    // these are the same as ones already added
+    DBRefEntry pdb1pdb = new DBRefEntry("PDB", "version1", "1PDB");
+    DBRefEntry pdb2pdb = new DBRefEntry("PDB", "version2", "2PDB");
+
+    List<DBRefEntry> primRefs = Arrays.asList(new DBRefEntry[] { pdb1pdb,
+        pdb2pdb });
+
+    sq.getDatasetSequence().addDBRef(pdb1pdb); // should do nothing
+    sq.getDatasetSequence().addDBRef(pdb2pdb); // should do nothing
+    sq.getDatasetSequence().addDBRef(
+            new DBRefEntry("PDB", "version3", "3PDB")); // should do nothing
+    sq.getDatasetSequence().addDBRef(
+            new DBRefEntry("PDB", "version4", "4PDB")); // should do nothing
+
+    PDBEntry pdbe1a = new PDBEntry("1PDB", "A", Type.PDB, "filePath/test1");
+    PDBEntry pdbe1b = new PDBEntry("1PDB", "B", Type.PDB, "filePath/test1");
+    PDBEntry pdbe2a = new PDBEntry("2PDB", "A", Type.MMCIF,
+            "filePath/test2");
+    PDBEntry pdbe2b = new PDBEntry("2PDB", "B", Type.MMCIF,
+            "filePath/test2");
+    sq.getDatasetSequence().addPDBId(pdbe1a);
+    sq.getDatasetSequence().addPDBId(pdbe1b);
+    sq.getDatasetSequence().addPDBId(pdbe2a);
+    sq.getDatasetSequence().addPDBId(pdbe2b);
+
+    /*
+     * test we added pdb entries to the dataset sequence
+     */
+    Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries(), Arrays
+            .asList(new PDBEntry[] { pdbe1a, pdbe1b, pdbe2a, pdbe2b }),
+            "PDB Entries were not found on dataset sequence.");
+
+    /*
+     * we should recover a pdb entry that is on the dataset sequence via PDBEntry
+     */
+    Assert.assertEquals(pdbe1a,
+            sq.getDatasetSequence().getPDBEntry("1PDB"),
+            "PDB Entry '1PDB' not found on dataset sequence via getPDBEntry.");
+    ArrayList<Annotation> annotsList = new ArrayList<Annotation>();
+    System.out.println(">>>>>> " + sq.getSequenceAsString().length());
+    annotsList.add(new Annotation("A", "A", 'X', 0.1f));
+    annotsList.add(new Annotation("A", "A", 'X', 0.1f));
+    Annotation[] annots = annotsList.toArray(new Annotation[0]);
+    sq.addAlignmentAnnotation(new AlignmentAnnotation("Test annot",
+            "Test annot description", annots));
+    sq.getDatasetSequence().addAlignmentAnnotation(
+            new AlignmentAnnotation("Test annot", "Test annot description",
+                    annots));
+    Assert.assertEquals(sq.getDescription(), "Test sequence description..");
+    Assert.assertEquals(sq.getDBRefs().length, 5); // DBRefs are on dataset
+                                                   // sequence
+    Assert.assertEquals(sq.getAllPDBEntries().size(), 4);
+    Assert.assertNotNull(sq.getAnnotation());
+    Assert.assertEquals(sq.getAnnotation()[0].annotations.length, 2);
+    Assert.assertEquals(sq.getDatasetSequence().getDBRefs().length, 5); // same
+                                                                        // as
+                                                                        // sq.getDBRefs()
+    Assert.assertEquals(sq.getDatasetSequence().getAllPDBEntries().size(),
+            4);
+    Assert.assertNotNull(sq.getDatasetSequence().getAnnotation());
+
+    Sequence derived = (Sequence) sq.deriveSequence();
+
+    Assert.assertEquals(derived.getDescription(),
+            "Test sequence description..");
+    Assert.assertEquals(derived.getDBRefs().length, 5); // come from dataset
+    Assert.assertEquals(derived.getAllPDBEntries().size(), 4);
+    Assert.assertNotNull(derived.getAnnotation());
+    Assert.assertEquals(derived.getAnnotation()[0].annotations.length, 2);
+    Assert.assertEquals(derived.getDatasetSequence().getDBRefs().length, 5);
+    Assert.assertEquals(derived.getDatasetSequence().getAllPDBEntries()
+            .size(), 4);
+    Assert.assertNotNull(derived.getDatasetSequence().getAnnotation());
+
+    assertEquals("CD", derived.getSequenceAsString());
+    assertSame(sq.getDatasetSequence(), derived.getDatasetSequence());
+
+    assertNull(sq.sequenceFeatures);
+    assertNull(derived.sequenceFeatures);
+    // derived sequence should access dataset sequence features
+    assertNotNull(sq.getSequenceFeatures());
+    assertArrayEquals(sq.getSequenceFeatures(),
+            derived.getSequenceFeatures());
+
+    /*
+     *  verify we have primary db refs *just* for PDB IDs with associated
+     *  PDBEntry objects
+     */
+
+    assertEquals(primRefs, sq.getPrimaryDBRefs());
+    assertEquals(primRefs, sq.getDatasetSequence().getPrimaryDBRefs());
+
+    assertEquals(sq.getPrimaryDBRefs(), derived.getPrimaryDBRefs());
+
+  }
+
+  /**
+   * Test for deriveSequence applied to an ungapped sequence with no dataset
+   */
+  @Test(groups = { "Functional" })
+  public void testDeriveSequence_noDatasetUngapped()
+  {
+    SequenceI sq = new Sequence("Seq1", "ABCDEF");
+    assertEquals(1, sq.getStart());
+    assertEquals(6, sq.getEnd());
+    SequenceI derived = sq.deriveSequence();
+    assertEquals("ABCDEF", derived.getSequenceAsString());
+    assertEquals("ABCDEF", derived.getDatasetSequence()
+            .getSequenceAsString());
+  }
+
+  /**
+   * Test for deriveSequence applied to a gapped sequence with no dataset
+   */
+  @Test(groups = { "Functional" })
+  public void testDeriveSequence_noDatasetGapped()
+  {
+    SequenceI sq = new Sequence("Seq1", "AB-C.D EF");
+    assertEquals(1, sq.getStart());
+    assertEquals(6, sq.getEnd());
+    assertNull(sq.getDatasetSequence());
+    SequenceI derived = sq.deriveSequence();
+    assertEquals("AB-C.D EF", derived.getSequenceAsString());
+    assertEquals("ABCDEF", derived.getDatasetSequence()
+            .getSequenceAsString());
+  }
+
+  @Test(groups = { "Functional" })
+  public void testCopyConstructor_noDataset()
+  {
+    SequenceI seq1 = new Sequence("Seq1", "AB-C.D EF");
+    seq1.setDescription("description");
+    seq1.addAlignmentAnnotation(new AlignmentAnnotation("label", "desc",
+            1.3d));
+    seq1.addSequenceFeature(new SequenceFeature("type", "desc", 22, 33,
+            12.4f, "group"));
+    seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File"));
+    seq1.addDBRef(new DBRefEntry("EMBL", "1.2", "AZ12345"));
+
+    SequenceI copy = new Sequence(seq1);
+
+    assertNull(copy.getDatasetSequence());
+
+    verifyCopiedSequence(seq1, copy);
+
+    // copy has a copy of the DBRefEntry
+    // this is murky - DBrefs are only copied for dataset sequences
+    // where the test for 'dataset sequence' is 'dataset is null'
+    // but that doesn't distinguish it from an aligned sequence
+    // which has not yet generated a dataset sequence
+    // NB getDBRef looks inside dataset sequence if not null
+    DBRefEntry[] dbrefs = copy.getDBRefs();
+    assertEquals(1, dbrefs.length);
+    assertFalse(dbrefs[0] == seq1.getDBRefs()[0]);
+    assertTrue(dbrefs[0].equals(seq1.getDBRefs()[0]));
+  }
+
+  @Test(groups = { "Functional" })
+  public void testCopyConstructor_withDataset()
+  {
+    SequenceI seq1 = new Sequence("Seq1", "AB-C.D EF");
+    seq1.createDatasetSequence();
+    seq1.setDescription("description");
+    seq1.addAlignmentAnnotation(new AlignmentAnnotation("label", "desc",
+            1.3d));
+    // JAL-2046 - what is the contract for using a derived sequence's
+    // addSequenceFeature ?
+    seq1.addSequenceFeature(new SequenceFeature("type", "desc", 22, 33,
+            12.4f, "group"));
+    seq1.addPDBId(new PDBEntry("1A70", "B", Type.PDB, "File"));
+    // here we add DBRef to the dataset sequence:
+    seq1.getDatasetSequence().addDBRef(
+            new DBRefEntry("EMBL", "1.2", "AZ12345"));
+
+    SequenceI copy = new Sequence(seq1);
+
+    assertNotNull(copy.getDatasetSequence());
+    assertSame(copy.getDatasetSequence(), seq1.getDatasetSequence());
+
+    verifyCopiedSequence(seq1, copy);
+
+    // getDBRef looks inside dataset sequence and this is shared,
+    // so holds the same dbref objects
+    DBRefEntry[] dbrefs = copy.getDBRefs();
+    assertEquals(1, dbrefs.length);
+    assertSame(dbrefs[0], seq1.getDBRefs()[0]);
+  }
+
+  /**
+   * Helper to make assertions about a copied sequence
+   * 
+   * @param seq1
+   * @param copy
+   */
+  protected void verifyCopiedSequence(SequenceI seq1, SequenceI copy)
+  {
+    // verify basic properties:
+    assertEquals(copy.getName(), seq1.getName());
+    assertEquals(copy.getDescription(), seq1.getDescription());
+    assertEquals(copy.getStart(), seq1.getStart());
+    assertEquals(copy.getEnd(), seq1.getEnd());
+    assertEquals(copy.getSequenceAsString(), seq1.getSequenceAsString());
+
+    // copy has a copy of the annotation:
+    AlignmentAnnotation[] anns = copy.getAnnotation();
+    assertEquals(1, anns.length);
+    assertFalse(anns[0] == seq1.getAnnotation()[0]);
+    assertEquals(anns[0].label, seq1.getAnnotation()[0].label);
+    assertEquals(anns[0].description, seq1.getAnnotation()[0].description);
+    assertEquals(anns[0].score, seq1.getAnnotation()[0].score);
+
+    // copy has a copy of the sequence feature:
+    SequenceFeature[] sfs = copy.getSequenceFeatures();
+    assertEquals(1, sfs.length);
+    if (seq1.getDatasetSequence() != null
+            && copy.getDatasetSequence() == seq1.getDatasetSequence())
+    {
+      assertTrue(sfs[0] == seq1.getSequenceFeatures()[0]);
+    }
+    else
+    {
+      assertFalse(sfs[0] == seq1.getSequenceFeatures()[0]);
+    }
+    assertTrue(sfs[0].equals(seq1.getSequenceFeatures()[0]));
+
+    // copy has a copy of the PDB entry
+    Vector<PDBEntry> pdbs = copy.getAllPDBEntries();
+    assertEquals(1, pdbs.size());
+    assertFalse(pdbs.get(0) == seq1.getAllPDBEntries().get(0));
+    assertTrue(pdbs.get(0).equals(seq1.getAllPDBEntries().get(0)));
+  }
+
+  @Test(groups = "Functional")
+  public void testGetCharAt()
+  {
+    SequenceI sq = new Sequence("", "abcde");
+    assertEquals('a', sq.getCharAt(0));
+    assertEquals('e', sq.getCharAt(4));
+    assertEquals(' ', sq.getCharAt(5));
+    assertEquals(' ', sq.getCharAt(-1));
+  }
+
+  /**
+   * Tests for adding (or updating) dbrefs
+   * 
+   * @see DBRefEntry#updateFrom(DBRefEntry)
+   */
+  @Test(groups = { "Functional" })
+  public void testAddDBRef()
+  {
+    SequenceI sq = new Sequence("", "abcde");
+    assertNull(sq.getDBRefs());
+    DBRefEntry dbref = new DBRefEntry("Uniprot", "1", "P00340");
+    sq.addDBRef(dbref);
+    assertEquals(1, sq.getDBRefs().length);
+    assertSame(dbref, sq.getDBRefs()[0]);
+
+    /*
+     * change of version - new entry
+     */
+    DBRefEntry dbref2 = new DBRefEntry("Uniprot", "2", "P00340");
+    sq.addDBRef(dbref2);
+    assertEquals(2, sq.getDBRefs().length);
+    assertSame(dbref, sq.getDBRefs()[0]);
+    assertSame(dbref2, sq.getDBRefs()[1]);
+
+    /*
+     * matches existing entry - not added
+     */
+    sq.addDBRef(new DBRefEntry("UNIPROT", "1", "p00340"));
+    assertEquals(2, sq.getDBRefs().length);
+
+    /*
+     * different source = new entry
+     */
+    DBRefEntry dbref3 = new DBRefEntry("UniRef", "1", "p00340");
+    sq.addDBRef(dbref3);
+    assertEquals(3, sq.getDBRefs().length);
+    assertSame(dbref3, sq.getDBRefs()[2]);
+
+    /*
+     * different ref = new entry
+     */
+    DBRefEntry dbref4 = new DBRefEntry("UniRef", "1", "p00341");
+    sq.addDBRef(dbref4);
+    assertEquals(4, sq.getDBRefs().length);
+    assertSame(dbref4, sq.getDBRefs()[3]);
+
+    /*
+     * matching ref with a mapping - map updated
+     */
+    DBRefEntry dbref5 = new DBRefEntry("UniRef", "1", "p00341");
+    Mapping map = new Mapping(new MapList(new int[] { 1, 3 }, new int[] {
+        1, 1 }, 3, 1));
+    dbref5.setMap(map);
+    sq.addDBRef(dbref5);
+    assertEquals(4, sq.getDBRefs().length);
+    assertSame(dbref4, sq.getDBRefs()[3]);
+    assertSame(map, dbref4.getMap());
+
+    /*
+     * 'real' version replaces "0" version
+     */
+    dbref2.setVersion("0");
+    DBRefEntry dbref6 = new DBRefEntry(dbref2.getSource(), "3",
+            dbref2.getAccessionId());
+    sq.addDBRef(dbref6);
+    assertEquals(4, sq.getDBRefs().length);
+    assertSame(dbref2, sq.getDBRefs()[1]);
+    assertEquals("3", dbref2.getVersion());
+
+    /*
+     * 'real' version replaces "source:0" version
+     */
+    dbref3.setVersion("Uniprot:0");
+    DBRefEntry dbref7 = new DBRefEntry(dbref3.getSource(), "3",
+            dbref3.getAccessionId());
+    sq.addDBRef(dbref7);
+    assertEquals(4, sq.getDBRefs().length);
+    assertSame(dbref3, sq.getDBRefs()[2]);
+    assertEquals("3", dbref2.getVersion());
+  }
+
+  @Test(groups = { "Functional" })
+  public void testGetPrimaryDBRefs_peptide()
+  {
+    SequenceI sq = new Sequence("aseq", "ASDFKYLMQPRST", 10, 22);
+
+    // no dbrefs
+    List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
+    assertTrue(primaryDBRefs.isEmpty());
+
+    // empty dbrefs
+    sq.setDBRefs(new DBRefEntry[] {});
+    primaryDBRefs = sq.getPrimaryDBRefs();
+    assertTrue(primaryDBRefs.isEmpty());
+
+    // primary - uniprot
+    DBRefEntry upentry1 = new DBRefEntry("UNIPROT", "0", "Q04760");
+    sq.addDBRef(upentry1);
+
+    // primary - uniprot with congruent map
+    DBRefEntry upentry2 = new DBRefEntry("UNIPROT", "0", "Q04762");
+    upentry2.setMap(new Mapping(null, new MapList(new int[] { 10, 22 },
+            new int[] { 10, 22 }, 1, 1)));
+    sq.addDBRef(upentry2);
+
+    // primary - uniprot with map of enclosing sequence
+    DBRefEntry upentry3 = new DBRefEntry("UNIPROT", "0", "Q04763");
+    upentry3.setMap(new Mapping(null, new MapList(new int[] { 8, 24 },
+            new int[] { 8, 24 }, 1, 1)));
+    sq.addDBRef(upentry3);
+
+    // not primary - uniprot with map of sub-sequence (5')
+    DBRefEntry upentry4 = new DBRefEntry("UNIPROT", "0", "Q04764");
+    upentry4.setMap(new Mapping(null, new MapList(new int[] { 10, 18 },
+            new int[] { 10, 18 }, 1, 1)));
+    sq.addDBRef(upentry4);
+
+    // not primary - uniprot with map that overlaps 3'
+    DBRefEntry upentry5 = new DBRefEntry("UNIPROT", "0", "Q04765");
+    upentry5.setMap(new Mapping(null, new MapList(new int[] { 12, 22 },
+            new int[] { 12, 22 }, 1, 1)));
+    sq.addDBRef(upentry5);
+
+    // not primary - uniprot with map to different coordinates frame
+    DBRefEntry upentry6 = new DBRefEntry("UNIPROT", "0", "Q04766");
+    upentry6.setMap(new Mapping(null, new MapList(new int[] { 12, 18 },
+            new int[] { 112, 118 }, 1, 1)));
+    sq.addDBRef(upentry6);
+
+    // not primary - dbref to 'non-core' database
+    DBRefEntry upentry7 = new DBRefEntry("Pfam", "0", "PF00903");
+    sq.addDBRef(upentry7);
+
+    // primary - type is PDB
+    DBRefEntry pdbentry = new DBRefEntry("PDB", "0", "1qip");
+    sq.addDBRef(pdbentry);
+
+    // not primary - PDBEntry has no file
+    sq.addDBRef(new DBRefEntry("PDB", "0", "1AAA"));
+
+    // not primary - no PDBEntry
+    sq.addDBRef(new DBRefEntry("PDB", "0", "1DDD"));
+
+    // add corroborating PDB entry for primary DBref -
+    // needs to have a file as well as matching ID
+    // note PDB ID is not treated as case sensitive
+    sq.addPDBId(new PDBEntry("1QIP", null, Type.PDB, new File("/blah")
+            .toString()));
+
+    // not valid DBRef - no file..
+    sq.addPDBId(new PDBEntry("1AAA", null, null, null));
+
+    primaryDBRefs = sq.getPrimaryDBRefs();
+    assertEquals(4, primaryDBRefs.size());
+    assertTrue("Couldn't find simple primary reference (UNIPROT)",
+            primaryDBRefs.contains(upentry1));
+    assertTrue("Couldn't find mapped primary reference (UNIPROT)",
+            primaryDBRefs.contains(upentry2));
+    assertTrue("Couldn't find mapped context reference (UNIPROT)",
+            primaryDBRefs.contains(upentry3));
+    assertTrue("Couldn't find expected PDB primary reference",
+            primaryDBRefs.contains(pdbentry));
+  }
+
+  @Test(groups = { "Functional" })
+  public void testGetPrimaryDBRefs_nucleotide()
+  {
+    SequenceI sq = new Sequence("aseq", "TGATCACTCGACTAGCATCAGCATA", 10, 34);
+
+    // primary - Ensembl
+    DBRefEntry dbr1 = new DBRefEntry("ENSEMBL", "0", "ENSG1234");
+    sq.addDBRef(dbr1);
+
+    // not primary - Ensembl 'transcript' mapping of sub-sequence
+    DBRefEntry dbr2 = new DBRefEntry("ENSEMBL", "0", "ENST1234");
+    dbr2.setMap(new Mapping(null, new MapList(new int[] { 15, 25 },
+            new int[] { 1, 11 }, 1, 1)));
+    sq.addDBRef(dbr2);
+
+    // primary - EMBL with congruent map
+    DBRefEntry dbr3 = new DBRefEntry("EMBL", "0", "J1234");
+    dbr3.setMap(new Mapping(null, new MapList(new int[] { 10, 34 },
+            new int[] { 10, 34 }, 1, 1)));
+    sq.addDBRef(dbr3);
+
+    // not primary - to non-core database
+    DBRefEntry dbr4 = new DBRefEntry("CCDS", "0", "J1234");
+    sq.addDBRef(dbr4);
+
+    // not primary - to protein
+    DBRefEntry dbr5 = new DBRefEntry("UNIPROT", "0", "Q87654");
+    sq.addDBRef(dbr5);
+
+    List<DBRefEntry> primaryDBRefs = sq.getPrimaryDBRefs();
+    assertEquals(2, primaryDBRefs.size());
+    assertTrue(primaryDBRefs.contains(dbr1));
+    assertTrue(primaryDBRefs.contains(dbr3));
+  }
+
+  /**
+   * Test the method that updates the list of PDBEntry from any new DBRefEntry
+   * for PDB
+   */
+  @Test(groups = { "Functional" })
+  public void testUpdatePDBIds()
+  {
+    PDBEntry pdbe1 = new PDBEntry("3A6S", null, null, null);
+    seq.addPDBId(pdbe1);
+    seq.addDBRef(new DBRefEntry("Ensembl", "8", "ENST1234"));
+    seq.addDBRef(new DBRefEntry("PDB", "0", "1A70"));
+    seq.addDBRef(new DBRefEntry("PDB", "0", "4BQGa"));
+    seq.addDBRef(new DBRefEntry("PDB", "0", "3a6sB"));
+    // 7 is not a valid chain code:
+    seq.addDBRef(new DBRefEntry("PDB", "0", "2GIS7"));
+
+    seq.updatePDBIds();
+    List<PDBEntry> pdbIds = seq.getAllPDBEntries();
+    assertEquals(4, pdbIds.size());
+    assertSame(pdbe1, pdbIds.get(0));
+    // chain code got added to 3A6S:
+    assertEquals("B", pdbe1.getChainCode());
+    assertEquals("1A70", pdbIds.get(1).getId());
+    // 4BQGA is parsed into id + chain
+    assertEquals("4BQG", pdbIds.get(2).getId());
+    assertEquals("a", pdbIds.get(2).getChainCode());
+    assertEquals("2GIS7", pdbIds.get(3).getId());
+    assertNull(pdbIds.get(3).getChainCode());
+  }
+
+  /**
+   * Test the method that either adds a pdbid or updates an existing one
+   */
+  @Test(groups = { "Functional" })
+  public void testAddPDBId()
+  {
+    PDBEntry pdbe = new PDBEntry("3A6S", null, null, null);
+    seq.addPDBId(pdbe);
+    assertEquals(1, seq.getAllPDBEntries().size());
+    assertSame(pdbe, seq.getPDBEntry("3A6S"));
+    assertSame(pdbe, seq.getPDBEntry("3a6s")); // case-insensitive
+
+    // add the same entry
+    seq.addPDBId(pdbe);
+    assertEquals(1, seq.getAllPDBEntries().size());
+    assertSame(pdbe, seq.getPDBEntry("3A6S"));
+
+    // add an identical entry
+    seq.addPDBId(new PDBEntry("3A6S", null, null, null));
+    assertEquals(1, seq.getAllPDBEntries().size());
+    assertSame(pdbe, seq.getPDBEntry("3A6S"));
+
+    // add a different entry
+    PDBEntry pdbe2 = new PDBEntry("1A70", null, null, null);
+    seq.addPDBId(pdbe2);
+    assertEquals(2, seq.getAllPDBEntries().size());
+    assertSame(pdbe, seq.getAllPDBEntries().get(0));
+    assertSame(pdbe2, seq.getAllPDBEntries().get(1));
+
+    // update pdbe with chain code, file, type
+    PDBEntry pdbe3 = new PDBEntry("3a6s", "A", Type.PDB, "filepath");
+    seq.addPDBId(pdbe3);
+    assertEquals(2, seq.getAllPDBEntries().size());
+    assertSame(pdbe, seq.getAllPDBEntries().get(0)); // updated in situ
+    assertEquals("3A6S", pdbe.getId()); // unchanged
+    assertEquals("A", pdbe.getChainCode()); // updated
+    assertEquals(Type.PDB.toString(), pdbe.getType()); // updated
+    assertEquals("filepath", pdbe.getFile()); // updated
+    assertSame(pdbe2, seq.getAllPDBEntries().get(1));
+
+    // add with a different file path
+    PDBEntry pdbe4 = new PDBEntry("3a6s", "A", Type.PDB, "filepath2");
+    seq.addPDBId(pdbe4);
+    assertEquals(3, seq.getAllPDBEntries().size());
+    assertSame(pdbe4, seq.getAllPDBEntries().get(2));
+
+    // add with a different chain code
+    PDBEntry pdbe5 = new PDBEntry("3a6s", "B", Type.PDB, "filepath");
+    seq.addPDBId(pdbe5);
+    assertEquals(4, seq.getAllPDBEntries().size());
+    assertSame(pdbe5, seq.getAllPDBEntries().get(3));
+  }
+
+  @Test(
+    groups = { "Functional" },
+    expectedExceptions = { IllegalArgumentException.class })
+  public void testSetDatasetSequence_toSelf()
+  {
+    seq.setDatasetSequence(seq);
+  }
+
+  @Test(
+    groups = { "Functional" },
+    expectedExceptions = { IllegalArgumentException.class })
+  public void testSetDatasetSequence_cascading()
+  {
+    SequenceI seq2 = new Sequence("Seq2", "xyz");
+    seq2.createDatasetSequence();
+    seq.setDatasetSequence(seq2);
   }
 }